Literature DB >> 33116669

Effect of Sub-Minimum Inhibitory Concentrations of Tyrosol and EDTA on Quorum Sensing and Virulence of Pseudomonas aeruginosa.

Shaymaa H Abdel-Rhman1,2, Dina E Rizk1, Eman S Abdelmegeed1.   

Abstract

INTRODUCTION: Pseudomonas aeruginosa is considered a dangerous pathogen, as it causes many human diseases, besides that it is resistant to almost all types of antibacterial agents. So, new strategies to overcome P. aeruginosa infection have evolved to attenuate its virulence factors and inhibit its quorum-sensing (QS) activity.
PURPOSE: This study investigated the effect of tyrosol and EDTA as anti-quorum-sensing and antivirulence agents against P. aeruginosa PAO1.
METHODS: Anti-quorum activity of sub-minimum inhibitory concentrations (sub-MICs) of tyrosol and EDTA was tested using Chromobacterium violaceum (CV 12,472) biosensor bioassay. Miller assay was used to assess the inhibition of QS signal molecules by β-galactosidase activity determination. Also, their effects on the production of protease, lipase, lecithinase, and motility were tested. The inhibitory effects of these molecules on QS regulatory genes and exotoxins genes expression were evaluated by real-time PCR.
RESULTS: Tyrosol and EDTA at sub-MICs inhibited the production of violacein pigment. Both compounds inhibited QS molecules production and their associated virulence factors (protease, lipase, lecithinase, and motility) (P≤ 0.05). Besides, the expression levels of QS regulatory genes (lasI, lasR, rhƖI, rhIR, pqsA, and pqsR) and exotoxins genes (exoS and exoY) were significantly reduced (P≤ 0.05).
CONCLUSION: Both tyrosol and EDTA can be used to fight P. aeruginosa infection as anti-quorum-sensing and antivirulence agents at their sub-MICs.
© 2020 Abdel-Rhman et al.

Entities:  

Keywords:  C. violaceum; PAO1; QS regulatory genes; exotoxins; real-time PCR; signal molecules

Year:  2020        PMID: 33116669      PMCID: PMC7550211          DOI: 10.2147/IDR.S264805

Source DB:  PubMed          Journal:  Infect Drug Resist        ISSN: 1178-6973            Impact factor:   4.003


Introduction

P. aeruginosa is an opportunistic Gram-negative bacterium that can cause several lethal infections including urinary tract, burn, respiratory tract and eye infections. Multidrug-resistant pathogens have emerged due to the unlimited use of antimicrobials. A new strategy to control the infections aims to affect and stop the adaptability of microbes to the host environment and prevent their communication with each other rather than affecting their growth.1,2 Quorum sensing (QS) is defined as communication between cells that relies on the cells density and the concentration of specific signaling molecules known as the autoinducers (AIs).2 AIs bind to their receptors forming a complex that will bind to a promoter and regulate the QS genes. P. aeruginosa contains four distinguished QS systems (Las, Rhl, Pqs and Iqs) that use AIs: N-oxododecanoyl-l-homoserine lactone (OdDHL or 3OC12-HSL), N-butanoyl-l-homoserine lactone (BHL or C4-HSL), the Pseudomonas quinolone signal (PQS), and the integrated quorum-sensing signal (IQS), respectively.1,3 Once significant levels of these signals were reached, they control the transcriptional regulatory protein LasR, RhIR, and Pqs then virulence factors transcription was enhanced.4 P. aeruginosa produces various pathogenicity factors and enzymes including pyocyanin, elastases, rhamnolipids, protease and extracellular exotoxin A that assist in microbial dissemination and interfere with the host immune system.5 Virulence factors expression, production of enzymes, cells adhesion and formation of biofilm are regulated by QS systems.6,7 Inhibitors of QS are an advanced strategy discovered to decrease P. aeruginosa pathogenesis and its virulence, so they can be used in treatment of its infections.8 QS system inhibitors act by different mechanisms including inhibitors of the AIs biosynthetic pathway, interference with the AIs extracellular accumulation (through using enzymes that degrade or modify the signals, and/or antibodies and synthetic polymers that segregate the signals), interference with signal detection (by using compounds that affect binding of signal to receptors), intervention with the binding of transcription factors to DNA, inhibition the quorum-sensing signal synthesis, and the use of structural analogs to the AIs.9 Natural compounds such as ellagic acid,10 ginseng,11 eugenol,12 xanthones,13 penicillanic acid,14 and different plant extracts15,16 inhibit QS associated virulence expression. Halogenated furanones which were isolated from certain macroalgae and different acyl-homoserine lactones (AHLs) analogs were found to inhibit QS signals.17 Also, Signal-degrading or modifying enzymes like lactonase, oxidase, and paraoxonase have been reported.18–20 In addition, vaccines that antagonize QS signaling molecules such as C12-HSL-BSA and C12-HSL-r-PcrV have been settled.21,22 Tyrosol or 2-(4-hydroxyphenyl)ethanol is a natural compound found in the human diet (olives and olive oil)23 and is produced by Candida albicans as QS molecules.24,25 It exhibits antioxidant, anti-inflammatory, anticancer, antitrypanosomal and antileishmanial activities.25 Besides, it has antivirulence activity against P. aeruginosa and Staphylococcus aureus.24,26 It has a potent antibacterial activity that was explained by its ability to bind and inhibit bacterial ATP synthase.27 Ethylenediaminetetraacetic acid (EDTA) which is a polyamine carboxylic acid was utilized as a food preservative,28 metal chelator, anticoagulant29 and in combination with antibiotics and vitamins for several diseases therapy.30 This research was conducted to evaluate the anti-quorum-sensing and antivirulence activity of sub-MICs of tyrosol and EDTA and to investigate their effect on the expression levels of QS-regulatory genes and some virulence factors production.

Materials and Methods

Bacterial Strains, Culture Conditions, and Reagents

C. violaceum (CV 12,472) is a wild-type strain that produces quorum-sensing controlled purple pigment, violacein. It responds to AIs molecules C4 and C1 AHLs. P. aeruginosa PAO1, wild-type strain, was used to test QS and virulence factors. P. aeruginosa PAO-JP2 (QS deficient) (ΔLasI: Tn 10, Tcr, ΔrhII: Tn 501, Hgr) was used as QS negative control. Escherichia coli MG4/pkDT17 (Las reporter, LasB: LacZ plac-LasR; Apr) and Escherichia coli DH5α/pECP61.5 (rhI reporter, rhID rhIA: LacZ Apr) were used to test QS signal molecules. All strains were grown in LB broth/agar at 37°C for 16–18 h except for C. violaceum that was incubated at 28°C. Tyrosol (Sigma number 79,058) and EDTA (Sigma number 27,285) were used in the preparation of stock solution (500 mM) in water and stored at −20° C. This research was exempt from approval by the ethics committee of faculty of Pharmacy, Mansoura University, Egypt as it was conducted using reference bacterial strains.

Determination of Minimum Inhibitory Concentrations of Tyrosol and EDTA

The MIC of tyrosol and EDTA were determined by the broth microdilution method.31 Briefly, P. aeruginosa PAO1 overnight culture in LB medium was adjusted to OD600 nm=0.08 to 0.1 and mixed with two-fold serial dilutions of tyrosol (250–16,000 µg mL−1) and EDTA (39–5000 µg mL−1) in 96-well microtiter plate. The plates were incubated at 37°C and the MIC was calculated as the lowest concentration that shows no visible growth of the organism. Sub-MICs (1/2, 1/4, 1/8, 1/16, and 1/32x MIC) were used for further experiments.

Determination of Anti-Quorum-Sensing Activity of Tyrosol and EDTA

The anti-quorum-sensing activity of tyrosol and EDTA was determined against C. violaceum ATCC 12,472 by agar well diffusion assay.32 Briefly, 50 µL of sub-MICs (1/2x −1/32x MIC) of tyrosol and EDTA were added in wells made into LB agar plates that were seeded with C. violaceum (0.5 McFarland) then incubation at 30°C for 48 h was done. The pigment production inhibition without exhibiting antibacterial activity around the well was checked.

Effect of Sub-MICs on the Viability of P. aeruginosa

To determine the non-inhibitory action of tyrosol and EDTA sub-MICs on P. aeruginosa growth; MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) reduction assay was conducted on tyrosol and EDTA treated and untreated cells with the predetermined concentrations. Briefly, suspensions of tested strains (100µL) in phosphate-buffered saline (PBS) containing 0.2% glucose were dispensed in 96-well plates with sub-MICs of tyrosol and EDTA in PBS, incubated at 37°C for 24 h. Then, 10 μL of MTT solution (5 mg/mL) was added to the wells and plates were incubated at 37°C for 30 min with shaking. For solubilization of the formed formazan, 100 μL of dimethylsulfoxide (DMSO) solution was added then plates were left for 3 h at room temperature. Absorbance (A540) was recorded using a microtiter plate reader (BioTek ELx800).26,33,34

Inhibition of QS Signal Molecule

Supernatants of P. aeruginosa PAO1 overnight cultures treated with sub-MICs (1/4x −1/32x MIC) of tyrosol and EDTA, in addition to the supernatant of untreated cells and PAO1-JP2 (a negative control) were prepared as mentioned previously by Abdel-Rhman and Rizk.26 Miller assay was used to measure AHLs by β-galactosidase activity determination,35,36 utilizing E. coli DH5α/pECP61.5 and E. coli MG4/pkDT17 for measuring C4-HSL and C12-HSL, respectively.

Effect of Tyrosol and EDTA on Pseudomonas Virulence Factors

The effectiveness of tyrosol and EDTA at sub-MICs on the production of total protease, lipase, and lecithinase enzymes by P. aeruginosa PAO1 was detected. This was conducted as described previously by utilizing the modified skim milk assay for measuring total protease,26 p-nitrophenyl palmitate as the substrate for measuring lipase,24 and egg-yolk tellurite emulsion for lecithinase.26

Motility Assays

The swarming, swimming and twitching motilities of P. aeruginosa were measured in the presence or absence of tyrosol and EDTA sub-MICs as previously described.2,6 Reduction in the motility of P. aeruginosa indicated QS inhibitory activity of the used compounds.

Quantitative Real-Time PCR

P. aeruginosa was treated with tyrosol and EDTA sub-MICs, then TRI Reagent (T9424 Sigma-Aldrich) was used to extract the total RNA which was converted into cDNA using QuantiTect Reverse Transcription kit (QIAGEN, USA) as previously described.33 The level of (lasR, lasI, rhƖI, rhIR, pqsR, pqsA, exoS, and exoY) genes expression was measured by RT-PCR utilizing the primer sequences which are listed in Table 1. rpoD gene was used as an internal P. aeruginosa housekeeping gene. The reaction mixture was prepared using 5x FIREPol EvaGreen, qPCR Mix, ROX Dye; Solis BioDyne; Tartu, Estonia; and the program was run as described previously,37 using Rotor-Gene Q thermocycler (QIAGEN, Hilden, Germany). The level of expression of the tested genes was measured in treated relative to untreated samples using the 2−ΔΔCt method.33 Expression in the PAO1-JP2 strain was also assessed.
Table 1

The Sequence of Primers Used in the RT-PCR Amplification

Target GenePrimer Sequence 5`-3`Annealing Temp (°C)Product Size (bp)Reference
rpoD5`–CGAACTGCTTGCCGACTT–3`56°C13137
5`–GCGAGAGCCTCAAGGATAC–3`
lasI5`–CGCACATCTGGGAACTCA–3`55–56°C17637
5`–CGGCACGGATCATCATCT–3`
lasR5`–CTGTGGATGCTCAAGGACTAC–3`55°C13337
5`–AACTGGTCTTGCCGATGG–3`
rhlI5`–GTAGCGGGTTTGCGGATG–3`58°C10137
5`–CGGCATCAGGTCTTCATCG–3`
rhlR5`–GCCAGCGTCTTGTTCGG–3`58°C16037
5`–CGGTCTGCCTGAGCCATC–3`
pqsA5`–GACCGGCTGTATTCGATTC–3`53.2°C7437
5`–GCTGAACCAGGGAAAGAAC–3`
pqsR5`–CTGATCTGCCGGTAATTGG–3`52.8°C14237
5`–ATCGACGAGGAACTGAAGA–3`
exoS5`–CCATCACTTCGGCGTCACT–3`56–58°C12937
5`–GAGAGCGAGGTCAGCAGAG–3`
exoY5`–TGCCATAGAATCCGTCCTC–3`55°C14537
5`–GATGACCGCCGATTATGAC–3`

Abbreviation: bp, base pair.

The Sequence of Primers Used in the RT-PCR Amplification Abbreviation: bp, base pair.

Statistical Analysis

Results were analyzed using GraphPad Prism 5. One-way analysis of variance (ANOVA) for multiple comparisons, followed by Dunnett's posttest to compare the treated isolates versus the control group. A P value of ≤0.05 was considered statistically significant.

Results

Screening of Anti-Quorum-Sensing Activity of Sub-MICs of Tyrosol and EDTA

The MICs of tyrosol and EDTA were determined to estimate the effect of their sub-MICs on bacterial growth, virulence factors’ production, and expression of QS genes. The MICs of tyrosol and EDTA against P. aeruginosa PAO1 were 4000 µg mL−1 and 1250 µg mL−1, respectively. The sub-MICs of tyrosol and EDTA were used throughout the study. The quorum-sensing inhibitory (QSI) activity of sub-MICs of tyrosol and EDTA were evaluated against C. violaceum ATCC 12,472 by agar well diffusion assay. The 1/2x MIC of either tyrosol or EDTA inhibited the production of the purple pigment violacein (QS system indicator) and inhibited the bacterial growth. The other used concentrations (1/4x −1/32x MIC) were found to inhibit the violacein pigment production without inhibiting bacterial growth indicating their anti-quorum-sensing activity.

Effect of Sub-MICs of Tyrosol and EDTA on the Viability of P. aeruginosa.

The sub-MICs (1/4x −1/32x MIC) of tyrosol and EDTA were tested for their effect on P. aeruginosa PAO1 viability by MTT reduction assay. The results showed that the viability of treated cells with these compounds was not significantly affected as compared to the untreated cells over the whole course of growth indicating that these compounds did not affect the metabolic activity of the strain.

Effect of Tyrosol and EDTA on Quorum-Sensing Signals

The ability of tyrosol and EDTA at sub-MICs to inhibit QS signal molecules (C4-HSL and C12-HSL) was tested using reporter strain assay. Untreated PAO1 cells produce high levels of C4-HSL (2707 Miller units) and C12-HSL (11,120 Miller units). The P. aeruginosa double mutant PAO-JP2 did not produce any detectable quantity of QS molecules. On the other hand, tyrosol (Figure 1A) and EDTA (Figure 1B) treated P. aeruginosa cells exhibited a significant reduction in C4-HSL (P< 0.001) and C12-HSL (P< 0.05).
Figure 1

Effect of sub-MICs of tyrosol (A) and EDTA (B) on quorum-sensing signals molecules using reporter strain assay.

Effect of sub-MICs of tyrosol (A) and EDTA (B) on quorum-sensing signals molecules using reporter strain assay. The production of C4-HSL was decreased by 72%, 60%, and 39% with 1/4x, 1/8x, and 1/16x MIC of tyrosol, respectively. While with EDTA, the reduction was 70%, 41%, and 22% with 1/4x, 1/8x, and 1/16x MIC, respectively. The C12-HSL level was also decreased with all used concentrations of tyrosol and EDTA (P-value<0.001). The reduction was 75% by 1/4x, 1/8x, and 1/16x MIC and 60% by 1/32x MIC of tyrosol. EDTA reduced it by 72%, 70%, 63%, and 40% for 1/4x, 1/8x, 1/16x and 1/32x MIC, respectively.

Effect of Tyrosol and EDTA on the Production of Some Virulence Factors

Tyrosol at 1/4x and 1/8x MIC can significantly (P<0.001) reduce the total protease production by 80% and 52%, respectively (Figure 2A). EDTA can only decrease the protease production by 35% at 1/4x MIC (P<0.05) (Figure 2B). Interestingly, tyrosol and EDTA can significantly decrease lipase production by ≥63% at sub-MICs (1/4x, 1/8x, and 1/16x MIC) (P<0.001). EDTA gave a higher effect than tyrosol as the reduction ranged between 81% and 73%. EDTA (1/4x and 1/8x MIC) significantly reduced lecithinase production (P<0.05).
Figure 2

Effect of sub-MICs of tyrosol (A) and EDTA (B) on the production of lipase, protease, and lecithinase enzymes of PAO1.

Effect of sub-MICs of tyrosol (A) and EDTA (B) on the production of lipase, protease, and lecithinase enzymes of PAO1.

Effect of Tyrosol and EDTA on Motility

The motility (swimming, swarming, and twitching) of PAO1 was measured in the presence and absence of tyrosol and EDTA. Tyrosol can significantly reduce the swarming motility at 1/4x, 1/8x (P<0.0001), and 1/16x MIC (P-value<0.05). EDTA (1/4x and 1/8x MIC) significantly decreased both swimming (P=0.001) and swarming motility (P<0.0001 and P<0.05, respectively). Both tyrosol and EDTA decreased twitching motility but non-significantly as illustrated in Table 2.
Table 2

Comparison of the Swimming, Swarming and Twitching Motilities Which Were Shown by PAO1 and PAO-JP2 and Treated PAO1 with Sub-MICs of Tyrosol and EDTA

StrainsSwimming (mm)Swarming (mm)Twitching (mm)
ControlPAO185 ± 0.0785 ± 0.07037 ± 0.35
PAO-JP245 ± 0.140.0015 ± 0.14
Tyrosol sub-MICsPAO1+1/4xMIC65 ± 0.7046 ± 0.70***25 ± 0.28
PAO1+1/8xMIC70 ± 0.7746 ± 0.70***27 ± 0.56
PAO1+1/16xMIC75 ± 0.7064 ± 0.70**27 ± 0.42
PAO1+1/32xMIC85 ± 0.8485 ± 0.07027 ± 0.56
EDTA sub-MICsPAO1+1/4xMIC40 ± 0.70***18 ± 0.070***30 ± 0.77
PAO1+1/8xMIC55 ± 0.70***65 ± 0.70***32 ± 0.56
PAO1+1/16xMIC60 ± 2.1280 ± 0.7035 ± 0.49
PAO1+1/32xMIC75 ± 0.7085 ± 0.3538 ± 0.14

Notes: **P< 0.05, ***P< 0.001

Abbreviation: MIC, minimum inhibitory concentration.

Comparison of the Swimming, Swarming and Twitching Motilities Which Were Shown by PAO1 and PAO-JP2 and Treated PAO1 with Sub-MICs of Tyrosol and EDTA Notes: **P< 0.05, ***P< 0.001 Abbreviation: MIC, minimum inhibitory concentration.

Real-Time PCR Analysis of P. aeruginosa Exotoxins and QS Regulatory Genes

The expression level of QS regulatory genes was significantly reduced by 80–50% by tyrosol (1/4x and 1/8x MIC). Tyrosol (1/4x MIC) reduced the expression of LasI and LasR by 75% and 80%, respectively; while (1/8x MIC) decreased their expression by 60% and 64%, respectively (Figure 3A). For RhƖI/RhIR, tyrosol at 1/4x MIC reduced their expression by 78% and 75%, respectively; while at 1/8x MIC, they were reduced by 60% and 63%, respectively (Figure 3B). PqsA and PqsR were also decreased by tyrosol; 1/4x MIC caused a reduction in expression of PqsA and PqsR by 64% and 70%, respectively, while 1/8x MIC caused reduction by 50% and 57%, respectively (Figure 3C).
Figure 3

Effect of sub-MICs (1/4x and 1/8x MIC) of tyrosol and EDTA on the level of expression of QS regulatory genes: (A) relative expression of lasI/lasR, (B) relative expression of rhlI/rhIR and (C) relative expression of pqsA/pqsR of treated P. aeruginosa PAO1.

Effect of sub-MICs (1/4x and 1/8x MIC) of tyrosol and EDTA on the level of expression of QS regulatory genes: (A) relative expression of lasI/lasR, (B) relative expression of rhlI/rhIR and (C) relative expression of pqsA/pqsR of treated P. aeruginosa PAO1. EDTA (1/4x and 1/8x MIC) decreased the expression of LasI by 73% and 64%, respectively, and LasR by 75% and 47%, respectively (Figure 3A). While for the other genes, only 1/4x MIC EDTA can significantly reduce the expression of rhƖI, rhIR (Figure 3B), pqsA and pqsR (Figure 3C) by 71%, 73%, 51%, and 58%, respectively. The reduction in the QS genes expression level indicated the inhibitory activity of tyrosol and EDTA on the transcriptional level of these genes. For exotoxins, our results revealed that only EDTA (1/4x MIC) resulted in a significant reduction (P< 0.05) in the expression level of ExoS and ExoY (80% and 40%, respectively).

Discussion

The increased prevalence of antibiotic resistance in Gram-negative bacteria necessitates finding new strategies for bacterial infections treatment.38 New approaches focused on targeting Gram-negative virulence factors to decrease their pathogenicity without causing drug resistance such as inhibition of quorum sensing.39 QS regulates many bacterial physiological processes including virulence characteristics, production of proteolytic enzymes and motility.40 Attenuation of microbial virulence can be achieved by disruption of this communication system.41,42 P. aeruginosa is considered a highly pathogenic bacterium because of its high resistance to many classes of antibiotics and development of intrinsic, acquired and adaptive resistance mechanisms,43,44 as well as secretions of several virulence factors.45 A new anti-Pseudomonas strategy is targeting QS to reduce its pathogenicity without affecting microbial resistance inducement.46 Various QS inhibitors have been reported including natural47 or synthetic compounds.17 Several previous studies reported that sub-MICs of ciprofloxacin, ceftazidime, and azithromycin reduces the QS of P. aeruginosa.47,48 Other studies indicated that tyrosol, one of major olive oil phenolic compounds, has potent activity against many bacteria causing respiratory and intestinal infections.49 EDTA was also reported to have an antibacterial activity by destroying the outer membrane of bacterial cells,50 and prevention of biofilm formation by chelation of several divalent cations which are essential for stabilization of the biofilm.51 This is the first study to investigate the effect of tyrosol and EDTA on QS. Our results showed that tyrosol and EDTA have anti-QS activity at sub-MICs when they were screened using C. violaceum (CV 12,472) biosensor bioassay. The selected tested concentrations (1/4x −1/32x MIC) inhibited AHL-mediated violacein production without any bactericidal effect on the cells. To evaluate the impact of tyrosol and EDTA on QS signals and the associated virulence factors of P. aeruginosa PAO1 and to be sure that the results are not attributed to a decrease in the cell viability, we studied the effect of sub-MICs on the metabolic activity of P. aeruginosa PAO1. Interestingly, no decrease in the viability of tested strains was observed compared to the control untreated cells. This finding was consistent with previous studies reported by Abdel-Rhman et al, 2015 and Abdel-Rhman and Rizk, 2016 who found the same effectiveness of tyrosol sub-MICs on the viability of P. aeruginosa and Staphylococcus aureus, respectively.24,26 Also, Aboelenin et al, 2017 reported a similar effect of sub-MICs of EDTA on the viability of E. coli.51 Many studies reported that several antibacterial agents (tobramycin,52 ciprofloxacin,53 azithromycin,54 ceftazidime,48 aminoglycosides, tetracyclines55 and piperacillin-tazobactam56), natural plant-derived compounds as gall extract2,57 and onion extract58 and drugs such as aspirin37 can decrease QS signals (HSL) in P. aeruginosa at sub-MICs without any bactericidal effect. Our study showed the same result whereas both tyrosol and EDTA at sub-MICs verified a significant reduction of C4-HSL and C12-HSL signal molecules production in P. aeruginosa PAO1. P. aeruginosa produces various exotoxins and enzymes that have important role in tissue injury and causing dissemination of the infection. QS coordinates its virulence factors release.59 So, inhibition of C4-HSL and C12-HSL signals in P. aeruginosa leads to a marked reduction in its QS mediated virulence factors. For this reason, we evaluated the effect of tyrosol and EDTA sub-MICs on the production of some QS regulated virulence factors in P. aeruginosa PAO1 strain. Proteases, lipases, and lecithinase are considered to be remarkable virulence factors of P. aeruginosa because they have an important role in Pseudomonas pathogenesis.60 In the present research, we reported that EDTA and tyrosol at sub-MICs significantly quenched the production of protease. Also, sub-MICs of both compounds significantly reduced the production of lipase enzyme which consequently results in a decreased pathogenicity of the bacterial cells. In accordance with our results, previous studies reported that EDTA had an inhibitory effect on lipase activity.61 A significant reduction in lecithinase production was observed only with 1/4x and 1/8x MIC of EDTA. These findings were similar to what was reported by previous studies on other compounds such as that conducted by Mattmann and Blackwell about furanone C-30,62 Musthafa et al about phenylacetic acid,63 Quecan et al about onion extract58 and Ahmed et al about cinnamaldehyde and salicylic acid.64 Motility is an important factor in both adhesion and biofilm formation.65 P. aeruginosa has three types of motility that are swimming, swarming and twitching which are positively regulated by both LasIR and RhIR QS systems, where las control swimming, swarming and twitching and rhI regulates swarming and twitching.66 In this study both swimming and swarming motility were significantly attenuated by tyrosol (1/4x - 1/16x MIC) and EDTA (1/4x and 1/8x MIC). However, both compounds demonstrated no significant reduction of twitching motility. The effect of different compounds on motility varied. Similar to our results, berberine was reported to significantly reduce both swimming and swarming without affecting twitching motility.67 While azithromycin was reported to affect only swimming motility,54 other compounds such as tobramycin,52 FL fraction of Psidium guajava68 and clove oil69 impair swarming motility. Abbas et al reported a similar effect of Sitagliptin as QS inhibitor of P. aeruginosa and it blocked its twitching motility.70 Gupta et al reported that ciprofloxacin can significantly reduce all three types of motility.53 In addition to the role of sub-MICs of tyrosol and EDTA in inhibiting virulence production, it was found that both compounds inhibited the expression of QS regulatory and exotoxin genes. The expression level of lasR, lasI, rhƖI, rhIR, pqsR and pqsA genes was significantly inhibited by tyrosol (1/4x and 1/8x MIC) and EDTA (1/4x MIC), while EDTA (1/8x MIC) significantly reduced the expression of lasR and lasI genes only. This result was following that found by Ouyang et al and Okusa et al who reported the significant inhibition of QS-related genes expression by quercetin (a naturally occurring flavonol) and C. gilletii extracts, respectively.71,72 The type III secretion system (T3SS) in P. aeruginosa includes four exoenzymes S, U, T, and Y which lead to cell death by the destruction of cellular machinery.73 In the current study, the expression level of exoS and exoY genes was significantly reduced by EDTA (1/4x MIC) only. Similarly, naringenin down-regulated type III secretion system genes expression.74 Although the expression of T3SS in P. aeruginosa is negatively regulated by RhlI/RhlR system,75,76 our results showed that EDTA repressed both RhlI/RhlR system and T3SS exotoxins which suggests the QS independent decrease of their secretion. In agreement, Zhang et al and Kim et al reported that coumarin and 6-gingerol, respectively, are QS inhibitors that repressed T3SS genes.77,78 P. aeruginosa combines several QS systems to integrate different signals hierarchically in which four QS systems act in a network.79 The Las system is at the top of the signaling cascade since LasR/3O-C12-HSL controls the expression of the Rhl and Pqs systems.80 Tyrosol was found to provide two types of interactions with the LasR receptor, two hydrogen bonds, and the π-π interaction, while EDTA exhibited five intermolecular hydrogen bonds by molecular docking using MOE v102015.10 software (Data not shown). These interactions between tyrosol and EDTA with the LasR receptor may aid in an explanation of their QS inhibitory effect. Accordingly, tyrosol and EDTA may act by targeting the Las system firstly then the following cascade includes RhI and Pqs systems and as a consequence, the virulence factors production under their control will be reduced. The other possible QS inhibition mechanisms of these compounds necessitate further investigation in future studies.

Conclusion

Our data illustrated that tyrosol and EDTA reduced the production of QS controlled virulence factors (protease, lipase, lecithinase, and motility) and T3SS exotoxins (exoS and exoY). Also, they downregulated the key genes involved in QS (lasI, lasR, rhƖI, rhIR, pqsR and pqsA). Also, this is the first study that indicates the potential effect of tyrosol and EDTA at sub-MICs as anti-quorum-sensing and antivirulence compounds in P. aeruginosa. So the present data suggest the possible application of EDTA and tyrosol in P. aeruginosa infections therapy. Further investigations are required to confirm such inhibitory effects in clinical isolates, study their effect on other virulence factors, and the exact mechanism of such inhibitory action at the molecular level.
  68 in total

Review 1.  Multidrug efflux pumps and antimicrobial resistance in Pseudomonas aeruginosa and related organisms.

Authors:  K Poole
Journal:  J Mol Microbiol Biotechnol       Date:  2001-04

2.  Inhibition of quorum sensing in Pseudomonas aeruginosa by azithromycin and its effectiveness in urinary tract infections.

Authors:  Anju Bala; Ravi Kumar; Kusum Harjai
Journal:  J Med Microbiol       Date:  2010-12-02       Impact factor: 2.472

3.  Inhibition of Pseudomonas aeruginosa quorum sensing by subinhibitory concentrations of curcumin with gentamicin and azithromycin.

Authors:  Shahin Bahari; Habib Zeighami; Hesam Mirshahabi; Shekoufeh Roudashti; Fakhri Haghi
Journal:  J Glob Antimicrob Resist       Date:  2017-06-04       Impact factor: 4.035

4.  Quercetin is an effective inhibitor of quorum sensing, biofilm formation and virulence factors in Pseudomonas aeruginosa.

Authors:  J Ouyang; F Sun; W Feng; Y Sun; X Qiu; L Xiong; Y Liu; Y Chen
Journal:  J Appl Microbiol       Date:  2016-03-07       Impact factor: 3.772

5.  Anti-quorum sensing activity of Psidium guajava L. flavonoids against Chromobacterium violaceum and Pseudomonas aeruginosa PAO1.

Authors:  Halkare Suryanarayana Vasavi; Ananthapadmanabha Bhagwath Arun; Punchapady-Devasya Rekha
Journal:  Microbiol Immunol       Date:  2014-05       Impact factor: 1.955

6.  Appropriate Handling, Processing and Analysis of Blood Samples Is Essential to Avoid Oxidation of Vitamin C to Dehydroascorbic Acid.

Authors:  Juliet M Pullar; Simone Bayer; Anitra C Carr
Journal:  Antioxidants (Basel)       Date:  2018-02-11

7.  A Quorum-Sensing Inhibitor Strain of Vibrio alginolyticus Blocks Qs-Controlled Phenotypes in Chromobacterium violaceum and Pseudomonas aeruginosa.

Authors:  José Carlos Reina; Ignacio Pérez-Victoria; Jesús Martín; Inmaculada Llamas
Journal:  Mar Drugs       Date:  2019-08-24       Impact factor: 5.118

8.  Identification of FDA-Approved Drugs as Antivirulence Agents Targeting the pqs Quorum-Sensing System of Pseudomonas aeruginosa.

Authors:  Francesca D'Angelo; Valerio Baldelli; Nigel Halliday; Paolo Pantalone; Fabio Polticelli; Ersilia Fiscarelli; Paul Williams; Paolo Visca; Livia Leoni; Giordano Rampioni
Journal:  Antimicrob Agents Chemother       Date:  2018-10-24       Impact factor: 5.191

9.  Ellagic acid derivatives from Terminalia chebula Retz. downregulate the expression of quorum sensing genes to attenuate Pseudomonas aeruginosa PAO1 virulence.

Authors:  Sajal Sarabhai; Prince Sharma; Neena Capalash
Journal:  PLoS One       Date:  2013-01-08       Impact factor: 3.240

10.  Mechanism of the quorum-quenching lactonase (AiiA) from Bacillus thuringiensis. 1. Product-bound structures.

Authors:  Dali Liu; Jessica Momb; Pei W Thomas; Aaron Moulin; Gregory A Petsko; Walter Fast; Dagmar Ringe
Journal:  Biochemistry       Date:  2008-07-22       Impact factor: 3.162

View more
  1 in total

1.  Quorum quenchers affect the virulence regulation of non-mucoid, mucoid and heavily mucoid biofilms co-cultured on cell lines.

Authors:  Rachith Kalgudi; Roya Tamimi; Godfrey Kyazze; Tajalli Keshavarz
Journal:  Appl Microbiol Biotechnol       Date:  2021-10-30       Impact factor: 4.813

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.