Literature DB >> 33109220

NF-κB maintains the stemness of colon cancer cells by downregulating miR-195-5p/497-5p and upregulating MCM2.

Longgang Wang1, Jinxiang Guo2, Jin Zhou3, Dongyang Wang4, Xiuwen Kang5, Lei Zhou6.   

Abstract

BACKGROUND: Colon cancer represents one of the leading causes of gastrointestinal tumors in industrialized countries, and its incidence appears to be increasing at an alarming rate. Accumulating evidence has unveiled the contributory roles of cancer stem cells (CSCs) in tumorigenicity, recurrence, and metastases. The functions of NF-kappa B (NF-κB) activation on cancer cell survival, including colon cancer cells have encouraged us to study the role of NF-κB in the maintenance of CSCs in colon cancer.
METHODS: Tumor samples and matched normal samples were obtained from 35 colon cancer cases. CSCs were isolated from human colon cancer cell lines, where the stemness of the cells was evaluated by cell viability, colony-forming, spheroid-forming, invasion, migration, and apoptosis assays. NF-κB activation was then performed in subcutaneous tumor models of CSCs by injecting lipopolysaccharides (LPS) i.p.
RESULTS: We found that NF-κB activation could reduce the expression of miR-195-5p and miR-497-5p, where these two miRNAs were determined to be downregulated in colon cancer tissues, cultured colon CSCs, and LPS-injected subcutaneous tumor models. Elevation of miR-195-5p and miR-497-5p levels by their specific mimic could ablate the effects of NF-κB on the stemness of colon cancer cells in vivo and in vitro, suggesting that NF-κB could maintain the stemness of colon cancer cells by downregulating miR-195-5p/497-5p. MCM2 was validated as the target gene of miR-195-5p and miR-497-5p in cultured colon CSCs. Overexpression of MCM2 was shown to restore the stemness of colon cancer cells in the presence of miR-195-5p and miR-497-5p, suggesting that miR-195-5p and miR-497-5p could impair the stemness of colon cancer cells by targeting MCM2 in vivo and in vitro.
CONCLUSIONS: Our work demonstrates that the restoration of miR-195-5p and miR-497-5p may be a therapeutic strategy for colon cancer treatment in relation to NF-κB activation.

Entities:  

Keywords:  Cancer stem cells; Colon cancer; NF-κB; Stemness; microRNA-195-5p; microRNA-497-5p

Mesh:

Substances:

Year:  2020        PMID: 33109220      PMCID: PMC7592593          DOI: 10.1186/s13046-020-01704-w

Source DB:  PubMed          Journal:  J Exp Clin Cancer Res        ISSN: 0392-9078


Background

Colon cancer is a frequently occurring gastrointestinal tumor, which is responsible for over 1 million newly diagnosed cases across the world per year [1]. Colon cancer has been regarded as the fourth most fatal cancer in the world, with a mortality rate of about 50% [2]. Colon cancer is characterized by symptoms like obstruction, perforation as well as bleeding in the colon [3]. The possible etiology of colon cancer includes the conversion of cholesterol and δ5–7-dehydrocholesterol, dietary fat changes, and etc. [4]. At present, the first-line therapy for colon cancer is the combined application of surgical resection and adjuvant chemotherapy [5]. It is noteworthy that colon cancer is comprised of a small number of cancer stem cells (CSCs) that aid in tumor maintenance and confer resistance to cancer therapies, which is likely to allow for tumor recurrence upon the stopping of the treatment [6]. Interestingly, microRNAs (miRs) have been reported to be crucial regulators on CSCs and regarded to serve as a promising therapeutic target for colon cancer treatment [7]. It has been noted in a previous study that the inhibitory role of miR-195-5p in the stem-like ability of colorectal cancer cells [8]. Moreover, miR-497 could serve as an anti-tumor gene in diverse cancer, including colorectal cancer [9]. Intriguingly, an existing study has reported that miR-497/195 could be inhibited in myoblasts, as well as skeletal muscle tissues by nuclear factor κB (NF-κB) [10], a transcription factor which is identified as a type of transcription factor dimer composed of p50/NFKB1, p52/NFKB2, c-Rel, p65/RelA as well as RelB [11]. The activation of NF-κB has been demonstrated to encounter multiple solid as well as hematological tumors [12]. It has also been reported that NF-κB was capable of promoting stem-like properties of colon cancer stem cells (CCSCs) [13, 14]. More importantly, the binding site between microRNA (miR)-195-5p/497–5p and minichromosome maintenance marker 2 (MCM2) has been identified based on the prediction results on the starBase website. MCM2 is a component of the replicative helicase machinery that is capable of interacting with histones H3 and H4 via the N-terminal domain in the process of replication [15]. MCM2 can increase the sensitivity of ovarian cancer cells to carboplatin through p53-dependent apoptotic response, thereby improving the therapeutic application of carboplatin in ovarian cancer patients [16]. Besides, extent of HMGA1 phosphorylation has been found to be differentially expressed in response to MCM2 perturbation and has a significant role to play in modulating cell behaviors of lung cancer cells [17]. MCM2 also has wide clinical application value in breast cancer diagnosis and prognosis [18]. Of note, MCM2 has been proved to be closely related to stem cells. For instance, decreased MCM2 expression has been reported to cause serious deficiency in stem cells [19]. Moreover, portions of retinoblastoma cells have been detected to display immunoreactivity to MCM2, as one of the stem cell markers [20]. Although the relation between miR-195-5p/497–5p and MCM2 in colon cancer has rarely been studied before, MCM2 has been reported to be targeted by miR-31 in nasopharyngeal carcinoma and prostate cancer [21, 22]. To the best of our knowledge, this is the first study reporting the binding relation between miR-195-5p/497–5p and MCM2 in colon cancer. In this study, we hypothesized that NF-κB and miR-497-5p/195-5p may participate in the regulation of CCSCs with the involvement of MCM2, and thus this study was performed to verify this hypothesis.

Materials and methods

Ethics statement

The study was approved by the Medical Ethics Committee of Shandong Cancer Hospital and Institute, Shandong First Medical University and Shandong Academy of Medical Sciences and carried out in strict accordance with the Helsinki Declaration. All participating patients have signed the written informed consent. All animal experiments were performed with approval of the Animal Ethics Committee of Shandong Cancer Hospital and Institute, Shandong First Medical University and Shandong Academy of Medical Sciences and in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.

Study subjects

In this study, we collected colon cancer tissues and adjacent tissues from 35 patients with colon cancer (including 23 males and 12 females, aged 47–69 years) who underwent surgery in Shandong Cancer Hospital and Institute, Shandong First Medical University and Shandong Academy of Medical Sciences from January 2018 to March 2019. All specimens were confirmed as primary colorectal cancer by pathological examination, and none of the patients had received radiotherapy or chemotherapy prior to the surgery. Five colon cancer cell lines (LoVo, SW620, SW1116, SW480, HCT-116) and one immortalized normal colon epithelial cell line (NCM460) (American Type Culture Collection (ATCC), VA, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) or Roswell Park Memorial Institute (RPMI)-1640 (Gibco Company, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS, Gibco Company, Grand Island, NY, USA) in an incubator at 37 °C with 5% CO2.

Selection and characterization of CCSCs

SW620 and LoVo cells were seeded into an ultra-low attachment cell culture plate (Corning Glass Works, Corning, N.Y., USA), and cultured in the medium prepared as previously reported [23]. The cultured SW620 and LoVo cells were separately labeled with anti-AC133 microbeads conjugated antibody (1: 10) and anti-EpCAM microbeads conjugated antibody (1: 10) following the manufacturer’s instructions of the kit (Miltenyi Biotec, Bergisch-Gladbach, Germany) to isolate AC133+ SW620 cells and EpCAM+ LoVo cells on the FACS Calibur Flow Cytometer (Becton Dickinson, San Jose, Canada). AC133 is a type of antibody that is usually applied to isolate CSCs by testing a glycosylated epitope of CD133 on the cells [24].

Cell treatment

CCSCs were transfected with 100 nM miR-195-5p/497–5p mimic or negative control (NC), 70 nM si-MCM2/p65 or NC, 100 nM pcDNA-MCM2/p65 (Guangzhou Ribobio, Guangzhou, China) according to the manufacturer’s instructions of Lipofectamine 2000 reagent. Cultured CCSCs were then assigned into the following groups: (1) to detect the relationship between NF-κB and miR-195-5p/497–5p: i. the si-NC group; ii. the si-p65 group; iii, the pcDNA-3.1 + miR-NC group; iv. the pcDNA-p65 + miR-NC group; v. the pcDNA-p65 + miR-497-5p group; vi. the pcDNA-p65 + miR-195-5p; (2) to detect the relationship between miR-195-5p/497–5p and MCM2: i. the si-NC group; ii. the si-MCM2 group; iii. The pcDNA-3.1 + miR-NC group; iv. The pcDNA-MCM2 + miR-NC group; v. the pcDNA-MCM2 + miR-497-5p group; vi. the cDNA-MCM2 + miR-195-5p group.

Dual-luciferase reporter gene assay

The artificially synthesized MCM2 3’UTR gene fragment was introduced into the psiCHECK-2 vector (Promega Corporation, Madison, WI, USA). The complementary sequence mutation sites of seed sequences were designed based on the wild type (WT) of MCM2. Specifically, the first binding site (− 604 ~ 594 bp) was mutated as WTΔ1, the second biding site (− 377 ~ 367 bp) as WTΔ2, and the third binding site (+ 106 ~ 116 bp) as WTΔ3. Meanwhile, WT binding sites were set as WT. All the above-mentioned binding sites were inserted into the psiCHECK-2 vector reporter plasmid. The correctly sequenced luciferase reporter plasmids MCM2 3’UTR-WT (100 ng) and MCM2 3’UTR-mutant type (MUT; 100 ng) were co-transfected into HEK-293 T cells (CRL-1415, Xin Yu Biotechnology, Shanghai, China) with miR-195-5p/497–5p mimic/NC-mimic (2 nM, Dharmacon, Lafayette, CO, USA), respectively. Following 48 h of transfection, the cells were collected and lysed. In addition, the fragments containing predicted p65 binding sites were amplified through P195 and then inserted into the PGL3 vector (Promega Corporation, Madison, WI, USA) by restriction endonucleases MluMlu I (Fermentas, ME, USA) and Nhe I (Fermentas, ME, USA). pNF-κB-TA-luc (Beyotime, Shanghai, China) reflects the changes in the activity of NF-κB. Luciferase activity was detected on a Glomax 20/20 luminometer fluorescence detector (Promega Corporation, Madison, WI, USA) using a luciferase detection kit (RG005, Beyotime, Shanghai, China).

Cell counting kit-8 (CCK-8) assay

A CCK-8 detection kit (Dojindo Laboratories, Kumamoto, Japan) was used to detect cell viability. In brief, CCSCs (4 × 103 cells/well) were seeded into a 96-well plate. Subsequently, 10 μL of CCK-8 reagent was added into each well and incubated for 2 h, followed by measurement of the optical density at 450 nm.

Flow cytometry

Annexin V and propidium iodide (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA) was applied for the detection of cell apoptosis. In brief, the CCSCs were collected and rinsed with phosphate buffer saline (PBS), followed by rinsing with binding buffer. Next, the CCSCs were incubated with 5 μL of Annexin V for 15 min in the dark. Following another rinse, binding buffer and 5 μL of propidium iodide were sequentially added to the CCSCs. After on-ice incubation at 2 °C–8 °C, the cell mixture was subsequently analyzed using flow cytometry with the aid of the FACSAria II Special Order System (BD Biosciences, Franklin Lakes, NJ, USA).

Sphere formation assay

The transfected CCSCs were treated by trypsin and prepared into cell suspension with CCSCs medium. The cell suspension (1 × 102 cells/well) was seeded into a 96-well ultra-low adherence culture plate (Corning Glass Works, Corning, N.Y., USA) and cultured in a 37 °C incubator for 5 days. After the incubation, the number of the formed microspheres in each well was observed and photographed under an inverted microscope (IX53, OLYMPUS, Tokyo, Japan).

Soft agar colony formation assay

A 6-well plate was coated with 2 mL of 0.7% low-melting-point agarose and supplemented with the cell-agarose mixture (0.35% agarose) at a cell density of 1 × 104 cells for every 100 cm2. Cells were replaced once every 2 to 3 days during the culture, which was terminated after 1 month. The culture dishes were taken out and the cells were counted under an inverted microscope (IX53, OLYMPUS, Tokyo, Japan). The cell mass with more than 50 cells was regarded as one cell colony, which was then photographed and counted.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from tissues or cells using a TRIzol kit (15596–018, Solarbio, Beijing, China) in strict accordance with the manufacturer’s instructions, followed by the determination of the RNA concentration. The primers were synthesized by Takara (Dalian, China) (Table 1). The reverse transcription was carried out according to the manufacturer’s instructions provided by the one-step miRNA reverse transcription kit (D1801, Haigene, Harbin, China), as well as the complementary (cDNA) reverse transcription kit (K1622, Yaanda Biotechnology Co., Ltd., Beijing, China). Using 2 μg total cDNA as the template, as well as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 serving as internal references, the fold changes in gene expression were calculated via relative quantification (2-ΔΔCt method) with the use of a fluorescent qPCR (ViiA 7, DAAN Gene Co., Ltd. Of Sun Yat-sen University, Guangzhou, China).
Table 1

Primer sequences for RT-qPCR

RNAPrimer sequences (5′-3′)
miR-195-5pForward: ACACTCCAGCTGGGTAGCAGCACAGAAAT
Reverse: TGGTGTCGTGGAGTCG
miR-497-5pForward: CAGCAGCACTGTGGTTTGT
Reverse: CGACAGCAGCACACTGTGGTT
MCM2Forward: CCTCTGTGCTTTATGGACAC
Reverse: GGAGGCTCACGAAACAGAGG
U6Forward: CTCGCTTCGGCAGCACA
Reverse: AACGCTTCACGAATTTGCTTC
GAPDHForward: TCAAGGCTGAGAACGGGAAG
Reverse: TGGACTCCACGACGTACTCA-3
Primer sequences for RT-qPCR

Western blot analysis

High-efficiency radio-immunoprecipitation assay (RIPA) lysate (R0010, Solarbio, Beijing, China) was employed to extract the total protein from tissues or cells, in strict accordance with the manufacturer’s instructions. After protein separation through polyacrylamide gel electrophoresis, the protein was electrotransferred onto a polyvinylidene fluoride membrane (Merck Millipore, Billerica, MA, USA) using the wet transfer method. The membrane was then probed with the following diluted anti-rabbit primary antibodies (all purchased from Cell Signaling Technologies (CST), Beverly, MA,USA) against p65 (#8242, 1: 1000), p-p65 (#3039 s, 1: 1000), MCM2 (#3619, 1: 1000), CD133 (#64326, 1: 1000), epithelial cell adhesion molecule (EpCAM; #2626, 1: 1000), B-cell leukemia/lymphoma 2 (Bcl-2; #4223, 1: 1000), Bcl-2 associated X protein (Bax; #5023, 1: 1000), Nanog (#4903S, 1: 500), Oct-4 (#2890S, 1: 500), and Sox2 (#3579S, 1: 500), then subsequently re-probed with goat anti-rabbit immunoglobulin G (IgG; #7074, 1: 2000) diluent labeled with horseradish peroxidase and incubated for 1 h at room temperature. The ImageJ 1.48u software (National Institutes of Health, Bethesda, Maryland, USA) was utilized for the protein quantitative analysis. The ratio of gray value of the target protein band to that of the GAPDH internal reference band was regarded as the relative protein expression.

Human colon cancer xenografts in nude mice

CCSCs were inoculated into ultra-low adhesion culture plates and the transfected cells were assigned into the following groups: (1) to validate the effect of NF-κB on the tumorigenesis by regulating miR-195-5p/497–5p: I. the miR-NC + PBS group; ii. The miR-497-5p/195-5p agomir + PBS group; iv. the miR-497-5p/195-5p agomir + LPS group; (2) to validate the effect of miR-195-5p/497–5p on tumorigenesis by targeting MCM2: i. the miR-NC group; ii. the miR-497-5p/195-5p agomir group; iii. The miR-497-5p/195-5p agomir + pcDNA-3.1 group; iv. The miR-497-5p/195-5p agomir + pcDNA-MCM2 group. Cell microspheres were collected in a 10 mL centrifuge tube 7 days after culture, followed by centrifugation with the supernatant discarded. After treatment with 0.25% trypsin, a single-cell suspension was prepared using CCSCs medium suspension. Cell count was carried out using an amount of 10 μL single-cell suspension. Cell suspension (1 × 105 cells) was prepared, re-suspended in 50 mL saline and then sufficiently mixed with 50 mL Matrigel Matrix (1: 1). Finally, the suspension mixture was subcutaneously injected into the BALB/c-nu nude mice (5–6 weeks, 19–24 g, n = 6 in each group, Hunan Slac Laboratory Animals Co., Ltd., Changsha, Hunan, China).

Statistical analysis

The SPSS 21.0 (IBM Corp., Armonk, NY, USA) was applied for statistical data analysis. All data were presented as mean ± standard deviation (s.d.). Paired t-test was applied to compare data of the colon cancer tissues and adjacent tissues that conformed to normal distribution and homogeneity of variance. Unpaired t-test was utilized to analyze the data conforming to normal distribution and homogeneity of variance between two groups. Comparisons among multiple groups were analyzed using the one-way analysis of variance, and a Tukey’s test was performed for post-hoc test. Repeated measures analysis of variance was used for comparing data among multiple groups at different time points, followed by Bonferroni post-hoc test. A value of p < 0.05 indicates a statistically significant difference.

Results

miR-195-5p and miR-497-5p are poorly expressed in CCSCs

The colon cancer miR expression dataset GSE108153 and the mRNA expression dataset GSE75970 were downloaded from the GEO database. Fifty-four differentially expressed miRs between colon cancer tissues and normal tissues (|logFC| > 1, p < 0.05) were obtained from the analysis of miR expression dataset GSE108153 (Fig. 1a), including miR-497-5p and miR-195-5p. miR-195-5p and miR-497-5p were members of miR-15 family, which possess the same seed sequence (Fig. 1b). Next, RT-qPCR was performed to determine the expression of miR-195-5p and miR-497-5p in colon cancer. The results revealed that the expression of miR-195-5p and miR-497-5p in colon cancer tissues was significantly lower than that in adjacent tissues (Fig. 1c). Meanwhile, the results from RT-qPCR showed that the expression of miR-195-5p and miR-497-5p in colon cancer cell lines was significantly lower than that in immortalized normal colon epithelial cells (Fig. 1d).
Fig. 1

miR-195-5p and miR-497-5p were poorly expressed in CCSCs. a, Heat map of differentially expressed miRNAs between tumor samples and normal samples from the GSE108183 dataset. The x-axis represents the sample number, while the y-axis represents the name of the miRNA, the left dendrogram represents the clustering of miR expression, and the upper right histogram indicates the color gradation. b, Sequences for miR-497-5p and miR-195-5p. c, The expression of miR-195-5p and miR-497-5p in colon cancer tissues (n = 35) and adjacent tissues (n = 35) as detected by RT-qPCR. d, The expression of miR-195-5p and miR-497-5p in colon cancer cell lines (LoVo, SW620, SW1116, SW480 and HCT-116) and immortalized colon epithelial cell lines (NCM460) as detected by RT-qPCR. e, The morphology of colon cancer cells SW620 and LoVo and their corresponding CCSCs (× 200) as observed under the optical microscope. f, The expression of stem cell markers (Nanog, Oct-4, and SOX-2) in colon cancer cells and CCSCs, as detected by Western blot analysis. g, The expression of miR-195-5p and miR-497-5p in CCSCs and colon cancer cells were as detected by RT-qPCR. Measurement data were expressed as mean ± s.d. Data comparison between colon cancer tissues and adjacent tissues were compared using paired t-test. Data among multiple groups were compared using one-way analysis of variance and further analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. control

miR-195-5p and miR-497-5p were poorly expressed in CCSCs. a, Heat map of differentially expressed miRNAs between tumor samples and normal samples from the GSE108183 dataset. The x-axis represents the sample number, while the y-axis represents the name of the miRNA, the left dendrogram represents the clustering of miR expression, and the upper right histogram indicates the color gradation. b, Sequences for miR-497-5p and miR-195-5p. c, The expression of miR-195-5p and miR-497-5p in colon cancer tissues (n = 35) and adjacent tissues (n = 35) as detected by RT-qPCR. d, The expression of miR-195-5p and miR-497-5p in colon cancer cell lines (LoVo, SW620, SW1116, SW480 and HCT-116) and immortalized colon epithelial cell lines (NCM460) as detected by RT-qPCR. e, The morphology of colon cancer cells SW620 and LoVo and their corresponding CCSCs (× 200) as observed under the optical microscope. f, The expression of stem cell markers (Nanog, Oct-4, and SOX-2) in colon cancer cells and CCSCs, as detected by Western blot analysis. g, The expression of miR-195-5p and miR-497-5p in CCSCs and colon cancer cells were as detected by RT-qPCR. Measurement data were expressed as mean ± s.d. Data comparison between colon cancer tissues and adjacent tissues were compared using paired t-test. Data among multiple groups were compared using one-way analysis of variance and further analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. control Next, to further verify the expression of miR-195-5p and miR-497-5p in CCSCs, the two cell lines with strong metastasis were selected, which includes SW620 and LoVo. CCSCs were enriched in these two cell lines. Figure 1e illustrated that the colon cancer cell line and its counterpart CCSCs appeared as suspended tumor spheres. Based on the results from sphere formation assay, CCSCs possess a self-renewal ability and could be passaged at least 15 times in vitro. Western blot analysis revealed that the stem cell markers, Nanog, Oct-4 and SOX-2 were all increased in CCSCs when compared to that in colon cancer cell lines (Fig. 1f). In addition, the subcutaneous transplantation models of nude mice were employed to further test the stem-like properties of CCSCs. As illustrated in Table 2, the seeded 1 × 104 CCSCs in the two cell lines could all induce tumorigenesis within 1 week (5/5); while the counterpart colon cancer cells failed to induce tumorigenesis in the same order of magnitude (0/5), with the longest need of 9 days to make 1 × 106 cells reach 100% tumorigenesis (5/5). The above-mentioned results indicate that the selected two CCSCs might possess the stem-like properties of CSCs and thus named SW620 CSCs and LoVo CSCs. The results from RT-qPCR showed that the expression of miR-195-5p and miR-497-5p in two CCSCs was notably lower than that in their counterpart colon cancer cell lines (Fig. 1g). These results indicated that the miR-195-5p and miR-497-5p was lowly expressed in CCSCs.
Table 2

Identification of stem cell-like cells in colon cancer in mouse xenograft models

Cell typeInjection doseTumor incidenceLatency period (day)
SW6201 × 1041/530
1 × 1053/518
1 × 1065/58
SW620 CSCs1 × 1020/5
1 × 1033/516
1 × 1045/57
LoVo1 × 1040/5
1 × 1051/518
1 × 1065/59
LoVo CSCs1 × 1020/5
1 × 1032/515
1 × 1045/57
Identification of stem cell-like cells in colon cancer in mouse xenograft models

miR-195-5p and miR-497-5p are negatively regulated by NF-κB activation in CCSCs

Next, we explored whether NF-κB could negatively regulate the expression of miR-195-5p/497–5p in CCSCs. Firstly, the potential transcriptional binding sites of NF-κB in the 3 kb promoter region of miR-195-5p and miR-497-5p were predicted by TFSEARCH software, which showed three possible p65 binding sites located at − 604, − 337 and + 106 bp, respectively (Fig. 2a). These binding sites shared highly conserved nucleotides with the common sequence of p65 (GGGRNNYYC) (Fig. 2b). In addition, the 3090 bp fragment containing these three p65 binding sites was cloned into the pGL3 luciferase reporter probe. The deletion mutation indicated that the relative luciferase activity of the miR-195-5p and miR-497-5p promoters was elevated when the first p65 binding site (− 604 bp) was deleted, while the deletion of the second (− 337 bp) or the third (+ 106 bp) binding site did not induce significant change (Fig. 2b). Therefore, it is presumed that p65 bound directly to the promoter region of miR-195-5p and/or miR-497-5p, with the binding site mainly located at − 604 ~ − 594 bp.
Fig. 2

NF-κB activation could negatively regulate the expression of miR-195-5p/497–5p in CCSCs. a, Prediction of binding sites in the miR-195-5p and miR-497-5p promoter region. b, Dual-luciferase reporter assay results showing the relative luciferase activity after deletion mutation. c, The protein expression of p65 and extent of p65 phosphorylation detected by Western blot analysis after treatment with overexpressed or downregulated p65 in CCSCs. d, The activity of NF-κB and that of miR-195-5p/497–5p promoter after CCSCs were treated with p65 detected by luciferase assay. e, The expression of miR-497-5p and miR-195-5p after CCSCs were treated with p65 detected by RT-qPCR. f, The expression of miR-497-5p and miR-195-5p in nude mice tumors was detected by RT-qPCR. g, The protein expression of p65 and extent of p65 phosphorylation in tumor tissues in response to different treatments after 24 h detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data between two groups were compared using unpaired t-test. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Six mice in each group. Cell experiment was repeated three times. * p < 0.05 vs. control

NF-κB activation could negatively regulate the expression of miR-195-5p/497–5p in CCSCs. a, Prediction of binding sites in the miR-195-5p and miR-497-5p promoter region. b, Dual-luciferase reporter assay results showing the relative luciferase activity after deletion mutation. c, The protein expression of p65 and extent of p65 phosphorylation detected by Western blot analysis after treatment with overexpressed or downregulated p65 in CCSCs. d, The activity of NF-κB and that of miR-195-5p/497–5p promoter after CCSCs were treated with p65 detected by luciferase assay. e, The expression of miR-497-5p and miR-195-5p after CCSCs were treated with p65 detected by RT-qPCR. f, The expression of miR-497-5p and miR-195-5p in nude mice tumors was detected by RT-qPCR. g, The protein expression of p65 and extent of p65 phosphorylation in tumor tissues in response to different treatments after 24 h detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data between two groups were compared using unpaired t-test. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Six mice in each group. Cell experiment was repeated three times. * p < 0.05 vs. control Next, p65 expression in CCSCs (SW620 CSCs and LoVo CSCs) was overexpressed or knocked down. As shown in Western blot analysis, cells treated with the overexpressed p65 resulted in significantly upregulated p65 expression and enhanced extent of p65 phosphorylation when compared to the control cells, while those treated with knockdown of p65 displayed significantly downregulated p65 expression and curtailed extent of p65 phosphorylation (Fig. 2c). Detection of the activity of NF-κB and miR-195-5p/497–5p promoters showed that the overexpression of p65 could significantly increase the activity of NF-κB while decreasing the activity of the miR-195-5p/497–5p promoter. In contrast, the knockdown of p65 could significantly reduce the activity of NF-κB and increase the activity of miR-195-5p/497–5p promoter (Fig. 2d). At the same time, the results from RT-qPCR showed that the expression of miR-497-5p and miR-195-5p was significantly reduced after the overexpression of p65 when compared to that in control cells, while the knockdown of p65 could lead to a significant increase in the expression of miR-497-5p and miR-195-5p (Fig. 2e). In order to induce tumorigenesis in mice, lipopolysaccharides (LPS) were injected into the abdominal cavity of mice and the tumor tissues were collected after 24 h and 48 h, respectively. As detected in RT-qPCR, the expression of miR-497-5p and miR-195-5p was significantly decreased at 24 h after injection with LPS in relative to that after the treatment with PBS, while showing no significant changes at 48 h (Fig. 2f). Western blot results revealed that when compared with PBS, LPS injection resulted in significantly increased p65 protein expression and enhanced extent of p65 phosphorylation (Fig. 2g). These results suggested that NF-κB could downregulate the expression of miR-195-5p/497–5p in CCSCs.

Inhibition of miR-195-5p/497–5p by NF-κB activation promotes viability and inhibits apoptosis of CCSCs

In order to verify whether NF-κB could affect the stem-like properties of CCSCs by negatively regulating the expression of miR-195-5p/497–5p, p65 was overexpressed or knocked down in CCSCs (SW620 CSCs and LoVo CSCs). Meanwhile, miR-195-5p or miR-497-5p were overexpressed in the presence of p65 overexpression. The results from RT-qPCR showed that compared with the control, the expression of p65 was significantly decreased upon knockdown of p65 group, along with the increased expression of miR-195-5p and miR-497-5p. However, the expression of p65 was significantly increased in response to overexpression of p65, while the expression of miR-195-5p and miR-497-5p was significantly decreased. Moreover, compared with the overexpression of p65, overexpression of both p65 and miR-195-5p/497–5p did not cause significant changes in p65 expression but contributed to a significant increase in the expression of miR-195-5p and miR-497-5p (Fig. 3a).
Fig. 3

Inhibition of miR-195-5p/497–5p by NF-κB activation could promote viability and inhibit apoptosis of CCSCs. a, After simultaneous overexpression of p65 and miR-195-5p/497–5p in CCSCs, the expression of p65, miR-195-5p and miR-497-5p in CCSCs was detected by RT-qPCR. b, Cell viability as detected by CCK-8 assay. c, Quantitation for cell apoptosis as detected by flow cytometry. d, The protein expression of apoptosis-related proteins (Bcl-2 and Bax) detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. si-NC. # p < 0.05 vs. pcDNA-p65 + miR-NC

Inhibition of miR-195-5p/497–5p by NF-κB activation could promote viability and inhibit apoptosis of CCSCs. a, After simultaneous overexpression of p65 and miR-195-5p/497–5p in CCSCs, the expression of p65, miR-195-5p and miR-497-5p in CCSCs was detected by RT-qPCR. b, Cell viability as detected by CCK-8 assay. c, Quantitation for cell apoptosis as detected by flow cytometry. d, The protein expression of apoptosis-related proteins (Bcl-2 and Bax) detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. si-NC. # p < 0.05 vs. pcDNA-p65 + miR-NC Further, in order to validate the effects of NF-κB on growth and apoptosis of CCSCs and the related indicators of stem-like properties in CSCs, cell proliferative ability and apoptosis were evaluated by CCK-8 assay and flow cytometry, respectively. The results displayed that compared with control, knockdown of p65 decreased cell viability but enhanced apoptosis, accompanied with increased Bax level and reduced Bcl-2 level. In contrast, overexpression of p65 strengthened cell viability but curtailed apoptosis, along with increased level of Bcl-2 and decreased level of Bax. Moreover, the combined treatment of overexpressed p65 and miR-195-5p/497–5p induced apoptosis and lowered cell viability, along with reduced Bcl-2 level and elevated Bax level in contrast to the treatment of overexpressed p65 alone (Fig. 3b-d). Therefore, NF-κB could enhance the growth and attenuate the apoptosis of CCSCs by negatively regulating miR-195-5p/497–5p.

NF-κB maintains the stem-like properties of CCSCs by negatively regulating miR-195-5p/497–5p

In addition, sphere formation assay and soft agar colony formation assay were adopted to analyze the tumor microsphere formation and cell colony formation ability, respectively. Results exhibited that when compared to the control, the volume of tumor microsphere, colony formation ability, and expression of stem cell markers Nanog, Oct-4 and Sox-2 as well as CD133, EpCAM were reduced in the presence of knockdown of p65, while opposite results were observed after overexpression of p65. Relative to overexpression of p65 alone, simultaneous overexpression of p65 and miR-195-5p/497–5p led to dampened sphere formation and colony formation abilities, accompanied by a decline in the expression of CD133, EpCAM, Nanog, Oct-4 and Sox-2 (Fig. 4a-e, Supplementary Fig. 1A-B). In conclusion, NF-κB could facilitate the stem-like properties of CCSCs by negatively regulating miR-195-5p/497–5p.
Fig. 4

Inhibition of miR-195-5p/497–5p by NF-κB activation maintained the stemness of CCSCs. a, Quantitation for sphere formation ability manifested with volume of tumor microspheres as detected by sphere formation assay. b, Quantitation for colony formation ability as determined by soft agar colony formation assay. c, The protein expression of stem-like properties-related proteins (CD133 and EpCAM) as detected by Western blot analysis. d, The protein expression of stem cell markers (Nanog, Oct-4 and Sox-2) as determined by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. si-NC. # p < 0.05 vs. pcDNA-p65 + miR-NC

Inhibition of miR-195-5p/497–5p by NF-κB activation maintained the stemness of CCSCs. a, Quantitation for sphere formation ability manifested with volume of tumor microspheres as detected by sphere formation assay. b, Quantitation for colony formation ability as determined by soft agar colony formation assay. c, The protein expression of stem-like properties-related proteins (CD133 and EpCAM) as detected by Western blot analysis. d, The protein expression of stem cell markers (Nanog, Oct-4 and Sox-2) as determined by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. si-NC. # p < 0.05 vs. pcDNA-p65 + miR-NC

NF-κB activation downregulates miR-195-5p/497–5p to promote tumorigenesis and stem-like properties of CCSCs in vivo

We further verified the effects of negative regulation of miR-195-5p/497–5p by NF-κB on the tumorigenesis and stem-like properties of CCSCs in vivo. CCSCs (SW620 CSCs and LoVo CSCs) treated with overexpression of miR-195-5p/497–5p were subcutaneously injected into nude mice (1 × 105 cells) to establish a subcutaneous xenografted tumor model. Meanwhile, PBS was injected into the abdominal cavity of mice as a control. Compared with the control, the volume and weight of the xenografted tumors were significantly increased in mice injected with the LPS group, while the volume and weight showed a notable decrease in xenografted tumors treated with overexpression of miR-195-5p/497–5p. Compared with overexpression of miR-195-5p/497–5p, a combination of miR-195-5p/497–5p overexpression and LPS could significantly increase the volume and weight of xenografted tumors (Fig. 5a-b).
Fig. 5

NF-κB activation downregulates miR-195-5p/497–5p and thereby promotes tumorigenesis and stem-like properties of CCSCs in vivo. a & b, CCSCs were treated with overexpressed miR-195-5p/497–5p and then subcutaneously injected into nude mice to establish a subcutaneous xenograft tumor model. At the same time, mice were injected with LPS or PBS twice a week until the day before the end of the experiment. The volume and weight of xenografted tumors were observed and recorded (n = 6 for each group). c, RNA was extracted from tumor tissues and the expression of miR-195-5p and miR-497-5p was detected by RT-qPCR. d, The protein expression of p65, extent of p65 phosphorylation, CD133, Nanog, Oct-4, Sox-2, and EpCAM in tumor tissues as detected by Western blot analysis. e, The protein expression of apoptosis-related proteins (Bcl-2 and Bax) in tumor tissues as detected by Western blot analysis. (1, miR-NC + PBS; 2, miR-NC + LPS; 3, miR-497-5p/195-5p agomir + PBS; 4, miR-497-5p/195-5p agomir + LPS). Measurement data were expressed as mean ± s.d. Data between two groups were compared using unpaired t-test. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Repeated measures analysis of variance was used for comparing data among multiple groups at different time points, followed by Bonferroni post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. miR-NC + PBS. # p < 0.05 vs. miR-497-5p/195-5p agomir + PBS

NF-κB activation downregulates miR-195-5p/497–5p and thereby promotes tumorigenesis and stem-like properties of CCSCs in vivo. a & b, CCSCs were treated with overexpressed miR-195-5p/497–5p and then subcutaneously injected into nude mice to establish a subcutaneous xenograft tumor model. At the same time, mice were injected with LPS or PBS twice a week until the day before the end of the experiment. The volume and weight of xenografted tumors were observed and recorded (n = 6 for each group). c, RNA was extracted from tumor tissues and the expression of miR-195-5p and miR-497-5p was detected by RT-qPCR. d, The protein expression of p65, extent of p65 phosphorylation, CD133, Nanog, Oct-4, Sox-2, and EpCAM in tumor tissues as detected by Western blot analysis. e, The protein expression of apoptosis-related proteins (Bcl-2 and Bax) in tumor tissues as detected by Western blot analysis. (1, miR-NC + PBS; 2, miR-NC + LPS; 3, miR-497-5p/195-5p agomir + PBS; 4, miR-497-5p/195-5p agomir + LPS). Measurement data were expressed as mean ± s.d. Data between two groups were compared using unpaired t-test. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Repeated measures analysis of variance was used for comparing data among multiple groups at different time points, followed by Bonferroni post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. miR-NC + PBS. # p < 0.05 vs. miR-497-5p/195-5p agomir + PBS Moreover, RT-qPCR showed that the expression of miR-195-5p and miR-497-5p in tumors treated with LPS was significantly lower than that when treated with PBS. Overexpression of miR-195-5p/497–5p resulted in significantly elevated expression of miR-195-5p and miR-497-5p in comparison to PBS treatment. Interestingly, compared with overexpression of miR-195-5p/497–5p, combined treatment of both miR-195-5p/497–5p overexpression and LPS has contributed to a significantly decreased expression of miR-195-5p and miR-497-5p (Fig. 5c). Meanwhile, based on the results from Western blot analysis, compared with those in response to PBS treatment, the protein expression of p65, extent of p65 phosphorylation, CD133, EpCAM, Nanog, Oct-4, Sox-2, and Bcl-2 in tumor tissues was significantly increased in the presence of LPS, while a notable decrease in the protein expression of Bax was observed. However, overexpression of miR-195-5p/497–5p has led to a significantly increased in protein expression of Bax in tumor tissues, as well as significantly decreased in protein expression of CD133, EpCAM, Nanog, Oct-4, Sox-2, and Bcl-2, but the protein expression of p65 and extent of p65 phosphorylation did not show any significant changes. Compared to those after treatment with overexpression of miR-195-5p/497–5p, the protein expression of p65, extent of p65 phosphorylation, CD133, EpCAM, Nanog, Oct-4, Sox-2, and Bcl-2 in tumor tissues was significantly increased after combined treatment of both miR-195-5p/497–5p overexpression and LPS, with a decline in protein expression of Bax (Fig. 5d-e). These results suggested that NF-κB could promote the tumorigenesis and stem-like properties of CCSCs by negatively regulating the expression of miR-195-5p/497–5p.

miR-195-5p and miR-497-5p can bind to MCM2

In order to further understand the downstream regulatory mechanism of miRs, a differential analysis of the colon cancer gene expression dataset GSE75970 (Fig. 6a) was carried out. At the same time, the downstream target genes of these two miRs were predicted using the starBase database (http://starbase.sysu.edu.cn/index.php). The predicted results of target genes and the upregulatory genes obtained from the GSE75970 dataset were intersected (Fig. 6b), from which 307 potential target genes of the two miRs were finally obtained. Gene interaction analysis of these 307 genes was then performed in the STRING database (https://string-db.org) and the corresponding gene interaction network map (Fig. 6c) was constructed using the Cytoscape software (version 3.6.1). Results showed that KIF2C, KIF23, BIRC5, NCAPG, MCM2, and DLGAP5 were observed at the core location of the network map (degree ≥15). Furthermore, according to the data obtained from TCGA colon cancer dataset of the UALCAN database (http://ualcan.path.uab.edu/analysis.html) (Fig. 6d), the expression of MCM2 was significantly increased in primary colon cancer tissues.
Fig. 6

miR-195-5p and miR-497-5p target and inhibit the expression of MCM2. a, Differentially expressed genes between tumor samples and normal samples from the GSE75970 dataset. The x-axis represents - log10 p-value and the y-axis represents logFC value. Each dot on the way represents a gene, the red dots represent upregulated genes and the green dots represent downregulated genes. b, Prediction of target genes of miR-497-5p and miR-195-5p. The three circles in the figure represent the predicted results of two miRs and the upregulated genes expressed in the GSE75970 dataset, respectively. The middle part represents the intersection of the three sets of data. c, Interaction and correlation analysis of potential target genes. Each circle in the map represents a gene. Darker color of the circle reflects higher core level of the gene in the whole network map. d, The expression of MCM2 gene in the TCGA colon cancer database. The blue box chart on the left indicates normal samples and the red box chart on the right indicates tumor samples (p < 0.001). e, Specific binding sites of miR-497-5p and miR-195-5p to MCM2 predicted online. f, Luciferase activity at the MCM2 promoter region detected by dual-luciferase reporter gene assay. g, The expression of MCM2, miR-497-5p and miR-195-5p in CCSCs as detected by RT-qPCR. h, The protein expression of MCM 2 in colon cancer cells and CCSCs s detected by Western blot analysis. i, The protein expression of MCM2 in colon cancer and adjacent tissues as detected by Western blot analysis. j, The expression of miR-497-5p, miR-195-5p and MCM2 in colon cancer tissues as detected by RT-qPCR and the corresponding correlation analysis scatter plots (n = 35). Measurement data were expressed as mean ± s.d. Data between two groups were compared using unpaired t-test. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. NC mimic or adjacent tissues. # p < 0.05 vs. NC-inhibitor

miR-195-5p and miR-497-5p target and inhibit the expression of MCM2. a, Differentially expressed genes between tumor samples and normal samples from the GSE75970 dataset. The x-axis represents - log10 p-value and the y-axis represents logFC value. Each dot on the way represents a gene, the red dots represent upregulated genes and the green dots represent downregulated genes. b, Prediction of target genes of miR-497-5p and miR-195-5p. The three circles in the figure represent the predicted results of two miRs and the upregulated genes expressed in the GSE75970 dataset, respectively. The middle part represents the intersection of the three sets of data. c, Interaction and correlation analysis of potential target genes. Each circle in the map represents a gene. Darker color of the circle reflects higher core level of the gene in the whole network map. d, The expression of MCM2 gene in the TCGA colon cancer database. The blue box chart on the left indicates normal samples and the red box chart on the right indicates tumor samples (p < 0.001). e, Specific binding sites of miR-497-5p and miR-195-5p to MCM2 predicted online. f, Luciferase activity at the MCM2 promoter region detected by dual-luciferase reporter gene assay. g, The expression of MCM2, miR-497-5p and miR-195-5p in CCSCs as detected by RT-qPCR. h, The protein expression of MCM 2 in colon cancer cells and CCSCs s detected by Western blot analysis. i, The protein expression of MCM2 in colon cancer and adjacent tissues as detected by Western blot analysis. j, The expression of miR-497-5p, miR-195-5p and MCM2 in colon cancer tissues as detected by RT-qPCR and the corresponding correlation analysis scatter plots (n = 35). Measurement data were expressed as mean ± s.d. Data between two groups were compared using unpaired t-test. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. NC mimic or adjacent tissues. # p < 0.05 vs. NC-inhibitor Based on the results from the starBase, the specific binding sites of miR-195-5p/497–5p to MCM2 were predicted (Fig. 6e) using dual-luciferase reporter gene assay. The results showed that the fluorescence intensity in the presence of miR-497-5p/miR-195-5p mimic + MCM2 3’UTR-WT co-transfection was significantly lower than that in the presence of mimic-NC + MCM2 3’UTR-WT co-transfection. Compared with NC-mimic + MCM2 3’UTR-MUT co-transfection, miR-497-5-5p/miR-195-5p mimic + MCM2 3’UTR-MUT co-transfection does not show any significant changes in fluorescence intensity (Fig. 6f). In addition, the expression of miR-497-5p and miR-195-5p was overexpressed or knocked down in CCSCs. The results from RT-qPCR revealed that compared with NC-mimic, the overexpressed miR-195-5p/ miR-497-5p significantly increased the expression of miR-195-5p and miR-497-5p, as well as significantly decreased the expression of MCM2. Relative to NC-inhibitor, the overexpressed miR-195-5p/497–5p significantly decreased the expression of miR-195-5p and miR-497-5p, as well as significantly increased the expression of MCM2 (Fig. 6g). Relative to that in colon cancer cells, MCM2 was highly expressed in CCSCs (Fig. 6h). At the same time, results from Western blot analysis demonstrated that MCM2 was highly expressed in colon cancer tissues when compared to that in adjacent tissues, which was consistent with the predicted results (Fig. 6i). In addition, we also found that the expression of miR-497-5p and miR-195-5p was negatively correlated with the expression of MCM2 in colon cancer tissues (Fig. 6j). These results indicated that miR-195-5p/497–5p could directly target MCM2 in CCSCs.

miR-195-5p/497–5p could inhibit viability and promote apoptosis of CCSCs by negatively regulating MCM2

In order to further investigate whether miR-195-5p/497–5p could inhibit the stem-like properties of CCSCs by targeting MCM2, knockdown or overexpression of MCM2 was performed in CCSCs (SW620 CSCs and LoVo CSCs), as well as the overexpression of miR-195-5p/497–5p. The results from RT-qPCR showed that the expression of MCM2 was significantly decreased in response to MCM2 knockdown compared to that in the control, while there were no significant changes detected in the expression of miR-195-5p and miR-497-5p. In contrast, the expression of MCM2 was significantly increased by overexpression of MCM2, while the expression of miR-195-5p and miR-497-5p does not show any significant changes by overexpression of MCM2. Compared with overexpression of MCM2, co-overexpression of MCM2 and miR-195-5p/497–5p resulted in a notable decrease in the expression of MCM2, as well as increase in the expression of miR-195-5p and miR-497-5p (Fig. 7a).
Fig. 7

miR-195-5p/497–5p could inhibit viability and promote apoptosis of CCSCs by targeting MCM2. a, MCM2 were knocked down or overexpressed in CCSCs (SW620 CSCs and LoVo CSCs), with miR-195-5p and miR-497-5p also being overexpressed. Next, the expression of miR-195-5p and miR-497-5p in response to different treatments was detected by RT-qPCR. b, Cell viability as detected by CCK-8 assay. c, Quantitation for CCSCs apoptosis as detected by flow cytometry. d, The protein expression of apoptosis-related proteins (Bcl-2 and Bax) as detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. si-NC. # p < 0.05 vs. pcDNA-MCM2 + miR-NC

miR-195-5p/497–5p could inhibit viability and promote apoptosis of CCSCs by targeting MCM2. a, MCM2 were knocked down or overexpressed in CCSCs (SW620 CSCs and LoVo CSCs), with miR-195-5p and miR-497-5p also being overexpressed. Next, the expression of miR-195-5p and miR-497-5p in response to different treatments was detected by RT-qPCR. b, Cell viability as detected by CCK-8 assay. c, Quantitation for CCSCs apoptosis as detected by flow cytometry. d, The protein expression of apoptosis-related proteins (Bcl-2 and Bax) as detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. si-NC. # p < 0.05 vs. pcDNA-MCM2 + miR-NC Subsequently, the effects of miR-195-5p/497–5p on the growth and apoptosis of CCSCs by targeting MCM2 was further validated. Compared with those of the control cells, cell viability was decreased while cell apoptosis was strengthened in the presence of MCM2 knockdown, along with increased level of Bax and decreased level of Bcl-2. However, after overexpression of MCM2, cell viability was increased, while cell apoptosis was significantly decreased. Meanwhile, Bcl-2 level was upregulated yet Bax level was downregulated. Cell viability was markedly decreased while apoptosis was increased by co-overexpression of MCM2 and miR-195-5p/497–5p, relative to the overexpression of MCM2 alone, with the increased level of Bax and decreased level of Bcl-2 (Fig. 7b-d). Therefore, overexpression of miR-195-5p/497–5p inhibited viability and promoted apoptosis of CCSCs by targeting MCM2.

miR-195-5p/497–5p could suppress the stem-like properties of CCSCs by negatively regulating MCM2

Furthermore, effects of miR-195-5p/497–5p targeting MCM2 on stem-like properties of CCSCs were investigated. Results exhibited that when compared to the control, the volume of microsphere, colony formation ability, and expression of CD133, EpCAM, Nanog, Oct-4 and Sox-2 were reduced in the presence of knockdown of MCM2, while after overexpression of MCM2, the volume of microsphere, colony formation ability, and expression of CD133, EpCAM, Nanog, Oct-4 and Sox-2 were increased. Relative to overexpression of MCM2 alone, simultaneous overexpression of MCM2 and miR-195-5p/497–5p reduced sphere formation and colony formation abilities, accompanied by a decline in the expression of CD133, EpCAM, Nanog, Oct-4 and Sox-2 (Fig. 8a-d, Supplementary Fig. 2A-B). In conclusion, miR-195-5p/497–5p could inhibit the stem-like properties of CCSCs by targeting MCM2.
Fig. 8

Stem-like properties of CCSCs were inhibited by miR-195-5p/497–5p through negative regulation of MCM2. a, Quantitation for the formation ability of tumor microspheres of CCSCs as detected by tumor sphere self-renewal assay. b, Quantitation for colony formation ability of cells as tested by soft agar colony formation assay. c, Protein expression of stem-like properties-related proteins (CD133 and EpCAM) as detected by Western blot analysis. d, Protein expression of stem cell markers (Nanog, Oct-4 and Sox-2) as detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. si-NC. # p < 0.05 vs. pcDNA-MCM2 + miR-NC

Stem-like properties of CCSCs were inhibited by miR-195-5p/497–5p through negative regulation of MCM2. a, Quantitation for the formation ability of tumor microspheres of CCSCs as detected by tumor sphere self-renewal assay. b, Quantitation for colony formation ability of cells as tested by soft agar colony formation assay. c, Protein expression of stem-like properties-related proteins (CD133 and EpCAM) as detected by Western blot analysis. d, Protein expression of stem cell markers (Nanog, Oct-4 and Sox-2) as detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. si-NC. # p < 0.05 vs. pcDNA-MCM2 + miR-NC

miR-195-5p/497–5p could restrict tumorigenesis and stem-like properties of CCSCs in vivo by targeting MCM2

To further verify whether miR-195-5p/497–5p could affect the tumorigenesis and stem-like properties of CCSCs through negative regulation of MCM2 in vivo, CCSCs (SW620 CSCs and LoVo CSCs) were transfected and subcutaneously injected into nude mice to establish xenografted tumor models. The volume and weight of xenografted tumors treated with overexpressed miR-497-5p/195-5p were significantly lower than those in the control tumors. Compared with those over-expressed xenografted tumors treated with overexpressed miR-195-5p/497–5p, the volume and weight of xenografted tumors showed a significant increase in response to co-treatment of overexpressed miR-195-5p/497–5p and overexpressed MCM2 (Fig. 9 a-b).
Fig. 9

miR-195-5p/497–5p could suppress the tumorigenesis and stem-like properties of CCSCs in vivo by targeting MCM2. CCSCs (SW620 CSCs and LoVo CSCs) with overexpressed miR-195-5p/497–5p and/or MCM2 were subcutaneously injected into nude mice to establish a subcutaneous xenograft tumor model. a & b, The volume and weight of xenografted tumors were observed and recorded. c, The expression of MCM2, miR-195-5p and miR-497-5p detected by RT-qPCR. d, The protein expression of MCM2, CD133, and EpCAM in tumor tissues as detected by Western blot analysis. e, The protein expression of apoptosis-related proteins (Bcl-2 and Bax) in tumor tissues as detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Repeated measures analysis of variance was used for comparing data among multiple groups at different time points, followed by Bonferroni post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. miR-NC. # p < 0.05 vs. miR-195-5p/497–5p agomir + pcDNA-3.1

miR-195-5p/497–5p could suppress the tumorigenesis and stem-like properties of CCSCs in vivo by targeting MCM2. CCSCs (SW620 CSCs and LoVo CSCs) with overexpressed miR-195-5p/497–5p and/or MCM2 were subcutaneously injected into nude mice to establish a subcutaneous xenograft tumor model. a & b, The volume and weight of xenografted tumors were observed and recorded. c, The expression of MCM2, miR-195-5p and miR-497-5p detected by RT-qPCR. d, The protein expression of MCM2, CD133, and EpCAM in tumor tissues as detected by Western blot analysis. e, The protein expression of apoptosis-related proteins (Bcl-2 and Bax) in tumor tissues as detected by Western blot analysis. Measurement data were expressed as mean ± s.d. Data among multiple groups were compared using one-way analysis of variance and then analyzed with Tukey’s post-hoc test. Repeated measures analysis of variance was used for comparing data among multiple groups at different time points, followed by Bonferroni post-hoc test. Cell experiment was repeated three times. * p < 0.05 vs. miR-NC. # p < 0.05 vs. miR-195-5p/497–5p agomir + pcDNA-3.1 Furthermore, RT-qPCR showed that the expression of miR-195-5p and miR-497-5p was increased and the expression of MCM2 was decreased in the tumor tissues with the presence of overexpressed miR-497-5p/195-5p when compared to those in the control. In comparison to the overexpressed miR-195-5p/497–5p, co-treatment of overexpressed miR-195-5p/497–5p and overexpressed MCM2 does not lead to any significant changes in the expression of miR-195-5p and miR-497-5p, but resulted in an elevated MCM2 expression (Fig. 9c). At the same time, the results from Western blot analysis showed that the protein expression of MCM2, CD133, EpCAM, and Bcl-2 was lower in response to overexpressed miR-497-5p/195-5p than that in the control tumor tissues, while the protein expression of Bax was significantly higher. Moreover, relative to overexpressed miR-195-5p/497–5p, co-treatment of overexpressed miR-195-5p/497–5p and overexpressed MCM2 have contributed to a notable increase in protein expression of MCM2, CD133, EpCAM, and Bcl-2, accompanied by markedly decreased in protein expression of Bax (Fig. 9d-e). These results suggested that miR-195-5p/497–5p could inhibit the in vivo tumorigenesis and stem-like properties of CCSCs by targeting MCM2.

Discussion

Colon cancer is one of the common malignancies that occur in the human digestive system with a high mortality rate worldwide [25]. MicroRNAs (miRs) have been reported to overcome chemoresistance in CSCs in colorectal cancer [26]. In the present study, the major objective was to explore the role of NF-κB and miR-195-5p/497–5p in the stem-like properties of CCSCs, with the involvement of MCM2. The obtained findings from the present study demonstrated that NF-κB was capable of downregulating miR-195-5p/497–5p expression, thereby upregulating the expression of MCM2, which resulted in the enhancement of stem-like properties of CCSCs. Initially, the current study found that miR-195-5p and miR-497-5p were poorly expressed in CCSCs, while MCM2 was highly expressed in primary colon cancer tissues. Consistent with our findings, a previous study demonstrated that miR-195-5p could regulate NOTCH2-mediated EMT of tumor cells in colorectal cancer tissues using integrated analysis [27]. Downregulation of miR-497 was also found in colorectal cells, which was closely associated with amplified insulin-like growth factor 1 receptor-involved DNA copy number reduction [28]. Intriguingly, as reported by another previous study, the expression of both miR-497 and miR-195 displayed a significant decline in colorectal cancer cells [29]. Moreover, MCM2 showed a higher mRNA expression in patients with colonic adenomas with high-grade dysplasia, suggesting that MCM2 could be a potential biomarker for early diagnosis of colorectal cancer [30]. In addition, similar to our findings, high expression of MCM2 was also found in CSCs marker-positive breast cancer cells [31]. Another important finding obtained in the present study was that NF-κB could negatively regulate miR-195-5p/497–5p expression, thus promoting stem-like properties of CCSCs, as well as facilitating tumorigenesis and stem-like properties of CCSCs in vivo. This finding was validated not only by the decreased in protein expression of Bax and increased in protein expression of CD133, EpCAM, and Bcl-2, but also by the promoted cell viability, volume of microspheres, cell invasion and migration, and colony formation ability, as well as decreased cell apoptosis. In line with our finding, Moreover, a previous study has reported that miR-195-5p could downregulate YAP1 in a mouse colorectal cancer xenograft model, thereby notably decreases the tumor development in vivo [32]. Besides, increased miR-497-5p has been reported to able to suppress proliferation as well as invasion of colorectal cancer cells by targeting PTPN3 [33]. In addition, NF-κB-mediated signaling pathways displayed direct participation in the maintenance of properties of CSCs which closely related to tumor development, including colon cancer [13]. Moreover, compound 19-inactivated NF-κB pathway was found to aid in the suppressive role of compound 19 in the progression of colorectal CSCs, which resulted in promoted cell apoptosis [34]. Besides, it has been revealed that a novel signaling pathway, NF-κB/miR-497/SALL4 axis, is involved with inflammation and stemness properties in hepatocellular carcinoma cells [35]. All the aforementioned results support the functions of overexpression of miR-195-5p/497–5p and that of NF-κB in colon cancer or CSCs, as demonstrated in the present study. Furthermore, results from RT-qPCR demonstrated that the overexpression of p65, a subunit of NF-κB, could significantly reduce the expression of miR-497-5p and miR-195-5p, indicating the negative regulation of miR-195-5p/497–5p by NF-κB in CCSCs, which was consistent with some existing reports. For instance, NF-κB inhibition by oxytocin could induce the up-regulation of miR-195 which promotes apoptosis and inhibits proliferation of breast cancer cells [36]. In addition, miR-497 has been identified as a regulatory miR by NF-κB in a previous study [37]. Furthermore, our results revealed that miR-195-5p/497–5p could target and downregulate the expression of MCM2, thereby contributing to the enhancement in stem-like properties of CCSCs both in vitro and in vivo. Consistent with our findings, the downregulation of MCM2 by siRNA has led to cell cycle arrest and apoptosis in colon cancer cells [38]. Moreover, inhibition of MCM2 was also found to be able to reduce the foci forming of RAD51 in colon cancer cells [39]. It was previously pointed out and demonstrated that MCM2 was presented in stem/progenitor cells of the subventricular zone within the brain and MCM2 could enhance green fluorescent protein expression which was specific to stem/progenitor cells [40]. Additionally, cells that were positive in regard to MCM2, which serves as neural stem marker, showed a higher percentage in the retinoblastoma tumors that were invasive [41]. The above-mentioned reports support the stimulatory role of MCM2 in CCSCs properties. In the current study, based on the starBase database, MCM2 was found to be a downstream target gene of miR-497-5p and miR-195-5p, and there were specific binding sites existed between miR-195-5p/497–5p and MCM2. This targeting relationship was further verified by dual-luciferase reporter gene assay. Moreover, the results from RT-qPCR demonstrated that the overexpressed miR-195-5p/497–5p could significantly decrease the expression of MCM2. A negative correlation was also detected between the expression of miR-497-5p/miR-195-5p and the expression of MCM2 in colon cancer tissues. Therefore, it can be concluded that miR-195-5p/497–5p could affect stem-like properties of CCSCs through the negative regulation of MCM2.

Conclusion

To conclude, the key findings of the present study revealed that NF-κB could negatively regulate the expression of miR-195-5p/497–5p, which contributes to the upregulation of MCM2 and thereby promotes stem-like properties of CCSCs (Fig. 10). These results also suggested that the inhibition of NF-κB or overexpression of miR-195-5p/497–5p may provide a promising therapeutic approach for colon cancer treatment. However, the specific molecular mechanism underlying negative regulation of miR-195-5p/497–5p by NF-κB in colon cancer still remains unclear and further exploration is needed.
Fig. 10

Schematic molecular mechanism illustrating the role of NF-κB in CCSCs by regulating miR-497-5p and miR-195-5p with the involvement of MCM2. In CCSCs, NF-κB promotes the expression of MCM2 by negatively regulating the expression of miR-497-5p and miR-195-5p, resulting in increased cell viability and decreased cell apoptosis of CCSCs, thus eventually enhancing the stem-like properties of CCSCs

Schematic molecular mechanism illustrating the role of NF-κB in CCSCs by regulating miR-497-5p and miR-195-5p with the involvement of MCM2. In CCSCs, NF-κB promotes the expression of MCM2 by negatively regulating the expression of miR-497-5p and miR-195-5p, resulting in increased cell viability and decreased cell apoptosis of CCSCs, thus eventually enhancing the stem-like properties of CCSCs Additional file 1 Supplementary Fig. S1. Inhibition of miR-195-5p/497–5p by NF-κB activation maintained the stemness of CCSCs. A, Representative views of sphere formation assay (× 200) showing sphere formation ability manifested with volume of tumor microspheres. B, Representative images of soft agar colony formation assay showing colony formation ability. Additional file 2 Supplementary Fig. S2. Stem-like properties of CCSCs were inhibited by miR-195-5p/497–5p through negative regulation of MCM2. A, Representative views of sphere formation assay (× 200) showing sphere formation ability manifested with volume of tumor microspheres. B, Representative images of soft agar colony formation assay showing colony formation ability.
  41 in total

1.  Cancer stem cell characteristics in retinoblastoma.

Authors:  Gail M Seigel; Lorrie M Campbell; Malathi Narayan; Federico Gonzalez-Fernandez
Journal:  Mol Vis       Date:  2005-09-12       Impact factor: 2.367

2.  Interaction between RAD51 and MCM Complex Is Essential for RAD51 Foci Forming in Colon Cancer HCT116 Cells.

Authors:  Jun Huang; Hong-Liang Luo; Hua Pan; Cheng Qiu; Teng-Fei Hao; Zheng-Ming Zhu
Journal:  Biochemistry (Mosc)       Date:  2018-01       Impact factor: 2.487

3.  Localised perforation of locally advanced transverse colon cancer with spontaneous colocutaneous fistula formation: a clinical challenge.

Authors:  Nikita Wadhwani; Deepak Kumar Diwakar
Journal:  BMJ Case Rep       Date:  2018-04-19

4.  A novel HIF-1α/VMP1-autophagic pathway induces resistance to photodynamic therapy in colon cancer cells.

Authors:  M E Rodríguez; C Catrinacio; A Ropolo; V A Rivarola; M I Vaccaro
Journal:  Photochem Photobiol Sci       Date:  2017-11-08       Impact factor: 3.982

5.  Structural insight into how the human helicase subunit MCM2 may act as a histone chaperone together with ASF1 at the replication fork.

Authors:  Nicolas Richet; Danni Liu; Pierre Legrand; Christophe Velours; Armelle Corpet; Albane Gaubert; May Bakail; Gwenaelle Moal-Raisin; Raphael Guerois; Christel Compper; Arthur Besle; Berengère Guichard; Genevieve Almouzni; Françoise Ochsenbein
Journal:  Nucleic Acids Res       Date:  2015-01-23       Impact factor: 16.971

6.  Stem cell markers: ABCG2 and MCM2 expression in retinoblastoma.

Authors:  A Mohan; M Kandalam; H L Ramkumar; L Gopal; S Krishnakumar
Journal:  Br J Ophthalmol       Date:  2006-03-23       Impact factor: 4.638

7.  miR-195-5p/NOTCH2-mediated EMT modulates IL-4 secretion in colorectal cancer to affect M2-like TAM polarization.

Authors:  Xiaobin Lin; Shuyi Wang; Min Sun; Chunxiao Zhang; Chen Wei; Chaogang Yang; Rongzhang Dou; Qing Liu; Bin Xiong
Journal:  J Hematol Oncol       Date:  2019-02-26       Impact factor: 17.388

8.  A novel curcumin analog inhibits canonical and non-canonical functions of telomerase through STAT3 and NF-κB inactivation in colorectal cancer cells.

Authors:  Seyung S Chung; Pranabananda Dutta; Nathaniel Chard; Yong Wu; Qiao-Hong Chen; Guanglin Chen; Jaydutt Vadgama
Journal:  Oncotarget       Date:  2019-07-16

9.  Up-regulation of microRNA-497 inhibits the proliferation, migration and invasion but increases the apoptosis of multiple myeloma cells through the MAPK/ERK signaling pathway by targeting Raf-1.

Authors:  Cheng-Yu Ye; Cui-Ping Zheng; Wei-Wei Ying; Shan-Shan Weng
Journal:  Cell Cycle       Date:  2018-12-11       Impact factor: 4.534

10.  Inflammatory Micro-environment Contributes to Stemness Properties and Metastatic Potential of HCC via the NF-κB/miR-497/SALL4 Axis.

Authors:  Bixing Zhao; Yingchao Wang; Xionghong Tan; Kun Ke; Xiaoyuan Zheng; Fei Wang; Shubing Lan; Naishun Liao; Zhixiong Cai; Yingjun Shi; Youshi Zheng; Yongping Lai; Lili Wang; Qin Li; Jingfeng Liu; Aimin Huang; Xiaolong Liu
Journal:  Mol Ther Oncolytics       Date:  2019-09-10       Impact factor: 7.200

View more
  7 in total

1.  Multi-Omics Analysis of MCM2 as a Promising Biomarker in Pan-Cancer.

Authors:  Jing Yuan; Hua Lan; Dongqing Huang; Xiaohui Guo; Chu Liu; Shuping Liu; Peng Zhang; Yan Cheng; Songshu Xiao
Journal:  Front Cell Dev Biol       Date:  2022-05-25

2.  Mulberry Leaf Flavonoids Inhibit Liver Inflammation in Type 2 Diabetes Rats by Regulating TLR4/MyD88/NF-κB Signaling Pathway.

Authors:  Yuhui Duan; Hongyu Dai; Yongcheng An; Long Cheng; Lu Shi; Yinglan Lv; Huimin Li; Chen Wang; Changhao He; Huilin Zhang; Yan Huang; Wanxin Fu; Yanyan Meng; Baosheng Zhao
Journal:  Evid Based Complement Alternat Med       Date:  2022-07-06       Impact factor: 2.650

3.  MicroRNA-497-5p Is Downregulated in Hepatocellular Carcinoma and Associated with Tumorigenesis and Poor Prognosis in Patients.

Authors:  Lin-Lin Tian; Bin Qian; Xiao-Hui Jiang; Yu-Shan Liu; Tong Chen; Cheng-You Jia; Ya-Li Zhou; Ji-Bin Liu; Yu-Shui Ma; Da Fu; Sen-Tai Ding
Journal:  Int J Genomics       Date:  2021-03-16       Impact factor: 2.326

4.  MiR-195-5p Ameliorates Cerebral Ischemia-Reperfusion Injury by Regulating the PTEN-AKT Signaling Pathway.

Authors:  Xiaoli Ren; Zhiyun Wang; Congfang Guo
Journal:  Neuropsychiatr Dis Treat       Date:  2021-04-29       Impact factor: 2.570

Review 5.  Emerging agents that target signaling pathways to eradicate colorectal cancer stem cells.

Authors:  Valdenizia R Silva; Luciano de S Santos; Rosane B Dias; Claudio A Quadros; Daniel P Bezerra
Journal:  Cancer Commun (Lond)       Date:  2021-11-17

6.  Common Pathogenetic Mechanisms Underlying Aging and Tumor and Means of Interventions.

Authors:  Weiyi Shen; Jiamin He; Tongyao Hou; Jianmin Si; Shujie Chen
Journal:  Aging Dis       Date:  2022-07-11       Impact factor: 9.968

7.  Systematic analysis of MCM3 in pediatric medulloblastoma via multi-omics analysis.

Authors:  Liangliang Cao; Yang Zhao; Zhuangzhuag Liang; Jian Yang; Jiajia Wang; Shuangwei Tian; Qinhua Wang; Baocheng Wang; Heng Zhao; Feng Jiang; Jie Ma
Journal:  Front Mol Biosci       Date:  2022-09-05
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.