Literature DB >> 33108406

Brucella suppress STING expression via miR-24 to enhance infection.

Mike Khan1, Jerome S Harms2, Yiping Liu2, Jens Eickhoff3, Jin Wen Tan2, Tony Hu2, Fengwei Cai2, Erika Guimaraes4,5, Sergio Costa Oliveira4, Richard Dahl6,7, Yong Cheng7, Delia Gutman8, Glen N Barber8, Gary A Splitter9, Judith A Smith2,10.   

Abstract

Brucellosis, caused by a number of Brucella species, remains the most prevalent zoonotic disease worldwide. Brucella establish chronic infections within host macrophages despite triggering cytosolic innate immune sensors, including Stimulator of Interferon Genes (STING), which potentially limit infection. In this study, STING was required for control of chronic Brucella infection in vivo. However, early during infection, Brucella down-regulated STING mRNA and protein. Down-regulation occurred post-transcriptionally, required live bacteria, the Brucella type IV secretion system, and was independent of host IRE1-RNase activity. STING suppression occurred in MyD88-/- macrophages and was not induced by Toll-like receptor agonists or purified Brucella lipopolysaccharide (LPS). Rather, Brucella induced a STING-targeting microRNA, miR-24-2, in a type IV secretion system-dependent manner. Furthermore, STING downregulation was inhibited by miR-24 anti-miRs and in Mirn23a locus-deficient macrophages. Failure to suppress STING expression in Mirn23a-/- macrophages correlated with diminished Brucella replication, and was rescued by exogenous miR-24. Mirn23a-/- mice were also more resistant to splenic colonization one week post infection. Anti-miR-24 potently suppressed replication in wild type, but much less in STING-/- macrophages, suggesting most of the impact of miR-24 induction on replication occurred via STING suppression. In summary, Brucella sabotages cytosolic surveillance by miR-24-dependent suppression of STING expression; post-STING activation "damage control" via targeted STING destruction may enable establishment of chronic infection.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33108406      PMCID: PMC7647118          DOI: 10.1371/journal.ppat.1009020

Source DB:  PubMed          Journal:  PLoS Pathog        ISSN: 1553-7366            Impact factor:   6.823


Introduction

Brucella spp. are Gram-negative, facultative intracellular α-proteobacteria which cause the zoonotic disease brucellosis [1,2]. Human brucellosis is characterized by an acute undulating fever accompanied by flu-like myalgias before developing into a chronic disease, with long-term pathologies such as sacroiliitis, arthritis, liver damage, meningitis, and endocarditis [3]. Brucellosis in animals often causes orchitis and sterility in males and spontaneous abortions in females, leading to profound economic loss worldwide [4]. During chronic infection, Brucella live and replicate within macrophages and other phagocytes. This intracellular localization renders the organism refractory to even prolonged multiple antibiotic treatments, and relapses occur in 5–10% of cases [3]. In the U.S., brucellosis has been largely controlled through vaccination of livestock with live attenuated strains, though outbreaks still occur [5-7]. Currently, no safe and effective human vaccine exists. The mechanism(s) involved in supporting the intracellular persistence of Brucella remain unclear. Innate immune responses form the first line of defense against bacterial pathogens. However, Brucella express multiple ‘atypical’ virulence factors, which stymie innate defenses. For example, Brucella spp. resist complement activation and express a weakly endotoxic “smooth” lipopolysaccharide that is a poor agonist for the innate immune sensor Toll-like receptor 4 [8]. Despite sequestration in membranous compartments, Brucella trigger cytosolic innate immune sensors including various inflammasomes and the Stimulator of Interferon Genes (STING) [9-12]. STING resides in the endoplasmic reticulum membrane and upon activation by bacterial cyclic-di-nucleotides or cyclic GMP-AMP (c-GAMP), STING translocates to peri-nuclear clusters where it co-localizes with and activates TANK binding kinase I (TBK1), which in turn phosphorylates the IFN-β regulatory transcription factor IRF3 [13,14]. In addition to Type I interferon induction, STING is essential for optimal induction of NF-κB-dependent pro-inflammatory cytokines and other host defense genes, and regulates autophagy [15]. Evidence from the cancer literature also suggests STING critically supports effective CD8+ T cell adaptive immune responses [16]. Previously, we have shown that STING is required for Type I interferon production in response to infection with Brucella abortus, and that STING contributes to control of B. abortus infection at 72 hours in vitro [9,17]. Here, we report that STING is critical for the control of acute and chronic Brucella infection in vivo. However, early during infection, Brucella down-regulate STING (Tmem173) mRNA expression and protein. Concurrently with STING suppression, Brucella induce a STING-targeting microRNA miR-24. Inhibition by anti-miR-24 or genetic deficiency of miR-24-2 leads to a significant increase in STING expression as well as augmented IFN-β production in macrophages. Inability to induce miR-24 and downregulate STING compromised Brucella survival in macrophages and in mice. These results suggest that Brucella mitigates the cost of innate immune activation by miR-24-dependent targeting of STING expression.

Results

STING is required for chronic control of Brucella in vivo

In previous studies, we showed that STING is required for control of Brucella replication in vitro from 24–72 hours [17,18]. We confirmed that by 24h, STING (Tmem173)-/- macrophages displayed significantly increased Brucella infection (). Recently, we had also shown that STING is required for control of Brucella infection in mice at 1 and 3 weeks [18]. To confirm these results and evaluate the role of STING in longer-term chronic Brucella infection [19], wild type C57BL/6 and STING-/- mice were infected with wild-type S2308 Brucella abortus for 1, 3 and 6 weeks. Splenic colony forming units (CFU) showed an approximately two-log difference between STING-/- mice and age-matched control C57BL/6 mice at 3 weeks and ~1.5 log difference at 6 weeks (). These data indicate that STING critically participates in the control of chronic Brucella infection in vivo.

STING is required for control of acute Brucella infection in vitro, and acute and chronic infection in vivo.

A) Bone marrow derived macrophages from wild type C57BL/6 control (WT) or STING-/- mice were infected with 10 multiplicity of infection (MOI) B. abortus for 24h prior to enumeration of colony forming units (CFU). Error bars denote triplicate determinations. B) Wild-type C57BL/6 (black circles, +/+) and STING-/- mice (open circles, -/-) were infected for 1, 3 or 6 weeks with 106 CFU Brucella abortus 2308 and splenocyte CFUs determined. Circles represent individual mice with 5 mice per group except the STING-/- from week 6 (4 mice). Bars denote median CFU/group. Results in (A) and (B) are representative of 3 independent experiments.

Brucella infection suppresses STING expression independently of IRE1 endonuclease activity and requires live bacteria and Type IV secretion

Given the requirement for STING in the control of chronic infection, it was surprising to note significant STING (Tmem173) mRNA down-regulation in bone marrow-derived macrophages (BMDMs) infected with wild type 16M Brucella melitensis at 24h (published RNAseq data set in [17]). To confirm the RNAseq data, and determine whether other Brucella species down-regulate STING, v-raf/v-myc immortalized murine bone marrow-derived macrophages [20] were uninfected or infected with different Brucella species for 24 hours and STING (Tmem173) mRNA levels assessed via RT-qPCR (). B. melitensis, B. abortus and B. suis are human pathogens and primarily infect ruminants, cattle and swine, respectively. B. neotomae has been isolated from wood rats and voles but also has been isolated in human neurobrucellosis [21]. The four species of Brucella significantly down-regulated STING mRNA compared to uninfected macrophages. STING protein levels also decreased in cells infected for 24 hours with Brucella (). In macrophages infected with B. melitensis, Tmem173 mRNA down-regulation was evident by 4h post-infection ().

Brucella suppresses STING expression.

A) Immortalized murine bone marrow derived macrophages were not infected (NI) or infected with B. melitensis 16M (black bars), B. abortus (light gray), B. neotomae (medium gray) or B. suis (dark gray) as indicated at 100 MOI for 24h. Cells were lysed, RNA isolated and reverse transcribed, and relative Tmem173 (STING) mRNA levels determined by quantitative PCR (qPCR) with normalization to 18S rRNA and uninfected controls (NI, set = 1). Results are from 25, 7, 5, and 5 independent experiments respectively, with error bars denoting SEM. P-values are vs. NI control. B) Protein expression of STING: cells were infected with 100 MOI of B. melitensis for 24h, and lysates resolved using SDS PAGE. STING and β-actin proteins were detected by western blot. Band fluorescence was quantitated and results are means +/- SEM of 5 independent experiments. An example western blot is below the graph with the ratio of β-actin normalized STING fluorescence for B. melitensis vs. NI. C) Time course: Cells were infected with 100 MOI B. melitensis for the times indicated and processed for RNA quantitation as in (A). Results are means +/- SEM of 9 independent experiments and for all times tested, p<0.001 for NI vs. infected samples. Tmem173 down-regulation required live bacteria, consistent with an active bacteria-driven process (). B. melitensis with mutations in the type IV secretion system (deletion of the critical VirB2 subunit [22]) displayed an intermediate phenotype with only modest downregulation of Tmem173, suggesting an intact type IV secretion system (T4SS) is required for full STING suppression (). Regarding the mechanism of suppression, one straightforward possibility was that Brucella infection suppresses the activity of transcription factors required for Tmem173 promoter activity. To address this possibility, we utilized a murine STING-promoter driven luciferase reporter (). Brucella infection increased the activity of the STING promoter-driven construct (at least 1.5-fold in 3 experiments and a 4-fold increase in one experiment). Heat-killed Brucella treatment also increased promoter-driven luciferase activity. This result suggested Brucella suppressed Tmem173 expression downstream of promoter activation.

Brucella down-regulation of STING requires live bacteria and Type IV secretion, and is RIDD-independent.

Macrophages were not infected (NI) or infected with 100 MOI B. melitensis 16M (B. mel), heat-killed B. melitensis (HK) in (A), or 2 clones of the ΔvirB2 mutant B. melitensis (C1 and C2) in (B) for 24 hours prior to harvesting for RNA processing. Relative Tmem173 mRNA levels were determined by qPCR with normalization to 18S rRNA and uninfected controls (NI set = 1); p-values are vs. NI. Results are from 21 experiments for HK and 3 independent experiments for the VirB2 mutants. C) Macrophages were transfected with a murine Tmem173 promoter luciferase reporter. Cells were then infected with 100 MOI live (B. mel) or heat-killed B. melitensis (HK). Lysates were analyzed by dual luciferase assay. Results are from 4 and 7 experiments respectively. P-values are vs. NI. D) Macrophages pre-treated with vehicle (veh.) or with the IRE1 endonuclease inhibitor 4μ8c one hour prior to infection with B. melitensis (N = 3 experiments). Levels of spliced XBP1 (XBP1(s)) or Tmem173 mRNA were determined by qPCR. Vehicle treated mRNA expression was set = 100%. Our group and others have previously shown that Brucella infection induces the Unfolded Protein Response (UPR) in macrophages [23,24]. An important effector of the UPR is the transmembrane protein Inositol-requiring enzyme 1 (IRE1), which functions as both a kinase and an endonuclease. Both B. abortus and B. melitensis infections activate the IRE1 pathway [23,25]. Following activation and oligomerization, the IRE1 endonuclease cleaves 26bp from the XBP1 transcription factor mRNA, thus removing a premature stop codon in the “spliced” product [26]. With prolonged endoplasmic reticulum (ER) stress, the IRE1 endonuclease changes activity to a process termed RIDD (Regulated IRE1 Dependent Decay), whereby it non-specifically degrades ER-proximal mRNAs in the secretory pathways, thus decreasing ER client load [27]. To determine if RIDD degrades Tmem173 mRNA, macrophages were pre-treated with the IRE1 endonuclease inhibitor 4μ8c [28] before infection with B. melitensis. As a positive control for 4μ8c efficacy, we assessed inhibition of XBP1 splicing during B. melitensis infection via RT-qPCR (). Tmem173 levels were unaffected by 4μ8c pre-treatment, indicating that STING mRNA down-regulation does not occur via IRE1-dependent endonuclease activity.

Brucella infection upregulates miR-24, a STING-targeting microRNA

Another hypothesis for the reduction in STING mRNA is that its mRNA is a target of microRNA (miRNA). miRNA are endogenous, small non-coding RNAs 18–25 nucleotides in length that post-transcriptionally regulate gene expression via translational inhibition and mRNA destruction [29]. To search for possible miRNAs that target STING, we used the online tool TargetScanMouse to identify possible candidates. A top hit was a conserved micro-RNA miR-24, which has been shown to post-transcriptionally regulate endogenous STING in Rattus norvegicus epithelium cells [30]. More recently, a study of liver ischemia reperfusion injury reported critical downregulation of STING via miR-24-3p [31]. MiR-24-2 (encoded by the Mirn23a locus) was also increased in our RNAseq data set from Brucella-infected macrophages [17]. To confirm the effect of infection on miR-24 levels, macrophages were infected for 24 hours with B. melitensis (). Infected macrophages significantly and reliably increased miR-24 levels compared to uninfected cells, although the degree of induction was variable (50% up to 8-fold). MiR-24 induction was also observed in vivo, 24h post-infection in mouse spleen. To confirm the biologic relevance of this miR-24 increase, we examined expression of another predicted mRNA target BCL2-like 11 (Bim), an apoptosis facilitator [32]. Bcl2l11 mRNA levels were also significantly decreased in B. melitensis infected macrophages compared to uninfected cells (). Tmem173 levels decreased over time as miR-24 increased (). Fold induction of miR-24 significantly correlated with the extent of Tmem173 suppression (). Just as heat-killed Brucella failed to suppress STING, the killed Brucella did not induce miR-24 expression (). Brucella ΔvirB2 mutants also displayed a marked defect in miR-24 induction, consistent with the failure to fully suppress Tmem173 expression (). These defects in miR-24 induction and Tmem173 suppression were evident by 4 and 8h post infection, respectively () and occurred in primary BMDM (). In the absence of VirB2, Tmem173 expression decreased slightly at 4h, but then did not diminish further. One explanation for the lesser effects on host gene expression could be impaired survival of the ΔvirB2 mutants. However, the defects in miR-24 induction and STING suppression were evident well before the ΔvirB2 mutant diverged from wild type in replication (). Host gene modulation defects at 8h were complemented with exogenous virB2 (), confirming the gene specificity of the phenotype.

Brucella induces a STING-targeting microRNA miR-24.

A) Left panel: Macrophages were not infected (NI) or infected with 100 MOI Brucella melitensis (B. mel) for 24 hours before harvesting for RNA. Right: Mice were infected with 106 B. abortus 2308 (B. abort) for 24 hours prior to processing of spleen for microRNA. Micro RNA levels were determined by qPCR with normalization toRNU6 and uninfected controls (NI set = 1). In vitro results are from 17 experiments, with error bars denoting SEM. In vivo, results are representative of 2 independent experiments. N = 3 uninfected and 4 infected mice, with SD error bars. B) Macrophages were infected as in (A) and processed for mRNA. Expression was normalized to 18S rRNA. Bcl2l11 (Bim) expression is from 8 experiments. C) Time course of quantitative expression of both miR24-3p and STING (Tmem173) mRNA. P<0.001 for changes over time (N = 6). D) Correlation is from 19 experiments performed and evaluated as in (A). R2 = 0.027, p = 0.022 E) Macrophages were infected as in (A) and processed for miRNA. Comparison of live and heat killed B. melitensis (B. mel vs. HK) is from N = 9. P<0.005 for B. mel vs. NI and HK. F) Macrophages were infected with wild type B. melitensis or VirB2 deletion mutant clones C1 and C2 and analyzed as in (A). Results are from 3 experiments. P<0.005 for B. mel vs. NI and vs. ΔVirb2 clones. G) Time course comparing effects of wild type B. melitensis (filled symbols) and Δ virB2 (clone 1, open symbols) on miR-24 (black circles) and Tmem173 mRNA (gray triangles). Gene expression changes were normalized to time 0 for each Brucella genotype infection (see methods) and error bars represent standard deviations of triplicate determinations. P-values compare Brucella genotypes at each time point: #p<0.005, ##p<0.001 for Tmem173 and *p<0.05, **p<0.01, ***p<0.005, ****p<0.001 for miR-24. The requirement for live bacteria and the type IV secretion system to induce miR-24 and suppress STING expression suggested an active, bacterially driven process, rather than a passive host response to pathogen associated molecular patterns (PAMPs). Intriguingly, Ma et al. had reported that LPS suppressed STING expression via a MyD88-dependent pathway [33]. The mechanism was, and remains unknown. MyD88, a critical signaling intermediary downstream of multiple Toll-like receptors, is critical for control of Brucella infection in vivo [34,35]. To determine if MyD88 contributed to Tmem173 downregulation in Brucella-infected macrophages, we compared Tmem173 and miR-24 expression in MyD88-/- and wild type macrophages (). MyD88 was not required for Tmem173 mRNA suppression or for miR-24 induction, although both were less robust in MyD88-/- cells. Further, miR-24 induction in STING-/- macrophages is similar to wild type cells, indicating miR-24 induction does not require STING expression ( As another approach to examining whether Brucella PAMPS contribute to STING suppression, the regulation of Tmem173 expression by purified Toll-like receptor (TLR) agonists was examined. IL6 mRNA served as a control for stimulation. Brucella stimulates TLR2, TLR9 and TLR4, although Brucella LPS is 3–4 logs less endotoxic than E. coli LPS [35,36]. The ligands for TLR2 and TLR9, Pam3CSK4 and ODN 1585, respectively did not downregulate Tmem173, nor did purified Brucella LPS ().

MiR-24 induction and Tmem173 suppression do not require STING or TLR agonist PAMPs.

A) Wild type (WT) or Myd88-/- macrophages were infected with 100 MOI B. melitensis (B. mel) for 24h and then RNA levels assessed by qPCR as above. A) Tmem173 expression is from N = 20, with normalization to WT uninfected controls within each experiment (WT NI = 1). B) MiR-24 expression is from N = 10, normalized as in (A) (left panel) and normalized to uninfected MyD88-/- (right). C) WT or STING (Tmem173)-/- macrophages were infected with heat killed (HK) or live B. melitensis for 24h and analyzed for miR-24 expression by qPCR, with normalization to uninfected controls (NI = 1), N = 8. White bars: uninfected or HK-infected wild type; black bars: infected wild type; dotted bars: uninfected Myd88-/-; striped bars: infected Myd88-/-; light gray: HK infected STING-/-; dark gray: live Brucella infected STING-/-. D) Macrophages were treated for 24h with media (not treated, NT), 1 μM ODN 1585 (ODN, TLR9 agonist), 10ng/mL Pam3CSK4 (Pam3, TLR2 agonist), 100ng/mL E. coli LPS (E-LPS, TLR4 agonist) or 10μg/mL Brucella LPS (B LPS), and analyzed for Tmem173 and IL6 expression. E. coli LPS is from 3 independent experiments, and ODN 1585, Pam3CSK4, and Brucella LPS data from 2 experiments. P-values are vs. NT. To confirm that miR-24 is required for the down-regulation of STING and Bim, we utilized anti-miR-24 miRNA inhibitors (). The restoration of Tmem173 and Bcl2l11 expression with anti-miR-24 treatment () was consistent with the idea that miR-24 contributes to the down-regulation of these mRNAs during Brucella infection. STING is required for optimal Brucella-dependent IFN-β production in macrophages [9,18]. To determine if failure to suppress STING correlated with increased STING activity, we assessed the impact of the anti-miR-24 on IFN-β production. As shown in , IFN-β was significantly up-regulated in macrophages transfected with the miR-24 inhibitor compared to mock transfected control cells, consistent with increased STING activity. Together, these data support the idea that Brucella infection induces miR-24 to down-regulate STING.

STING suppression requires miR-24 induction.

A) Macrophage cells were transfected with an anti-miR24 inhibitor or control anti-miR, then infected with 100 MOI B. melitensis (B. mel) for 24h. Relative gene expression of Tmem173 (left) and Bcl2l11 (right) were determined via qPCR with normalization to 18S rRNA and non-infected control (NI set = 1). N = 5 (Tmem173) and 3 experiments (Bcl2l11). P-values are vs. NI (*) or vs. anti-miR24 (#). (A and B) White bars are NI; black B. mel; light gray anti-miR-24 + B. mel; and dark gray scrambled anti-miR control + B. mel. B) IFN-β production in culture supernatant after 24h of infection was determined by ELISA. Data are from 4 experiments. C) And (D) Wild type (WT) or Mirn23a-/- macrophage cells were infected with 100 MOI B. melitensis for 24h and expression of miR-24 (C) Tmem173 mRNA (D) determined as above. Results were normalized to uninfected wild type (NI = 1) within each experiment. Data are from 5 and 8 experiments respectively. E) WT or Mirn23a-/- macrophages were infected with B. melitensis for the times indicated prior to lysis for RNA extraction. Tmem173 levels were determined using qPCR with each genotype normalized to its own NI values (set = 1). 24h data is from 9 experiments with the other time points assessed in 5 experiments. STING protein 24h following infection was detected using western blot with normalization to β-actin and genotype-respective uninfected controls. N = 3. In E, p-values are for B. mel infected vs NI WT cells (*) and for WT vs Mirn23a-/- infected cells (#). F) Ifnb1 mRNA expression at 24h, normalized to uninfected control cells for each genotype. N = 3, #p-value is for WT vs Mirn23a-/-. For C-F, dotted bars are uninfected Mirn23a-/- and striped bars are infected Mirn23a-/- cells. To further evaluate the requirement for miR-24, we utilized a genetic model of miR-24 deficiency. MiR-24-3p is 100% homologous between mouse, rat and human and is expressed from two genetic loci: Mirn23a encodes miR-23a, miR-24-2 and miR-27a and Mirn23b encodes miR-23b, miR-24-1 and miR-27b. Our previous RNAseq data suggested bone marrow macrophages induced miR-24-2 but not miR-24-1 [17]. Mirn23a is the predominant source of miR-24 in blood [37]. Mirn23a-/- macrophages showed decreased levels of miR-24 compared to wild type prior to infection and were deficient at miR-24 upregulation in response to Brucella infection (). As noted above, heat-killed Brucella did not induce miR-24 in either genotype. Mirn23a-/- macrophages were unable to suppress Tmem173 expression at 24h in relation to their uninfected state, although overall levels of Tmem173 mRNA were decreased compared to uninfected wild type macrophages, suggesting a balance between static miR-24 and Tmem173 levels ( STING protein suppression was also impaired. The defect in Tmem173 suppression in the Mirn23a-/- macrophages, more evident over time (), correlated with greatly increased Ifnb1 induction by 24h post-infection, consistent with increased STING activity ().

Decreased Brucella replication in miR23 locus-/- macrophages

Although the data in suggested that STING regulates Brucella infection, the biologic consequences of miR-24 induction and STING suppression were not clear. To determine the role of the Mirn23a locus in infection, we compared replication (CFU) in wild type vs. Mirn23a macrophages (). Initial uptake of Brucella was similar between genotypes, but diverged by 8h, with lower Brucella CFU recovered in the Mirn23a macrophages. This divergence maintained or increased over the course of infection through 48–72 hours. These results were consistent with a role for the miRs encoded by this locus in supporting intracellular infection. We further confirmed that the observations in vitro were relevant in vivo by infecting Mirn23a-/- mice with Brucella. As predicted by the in vitro data, Mirn23a-/- mice were more resistant to B. neotomae, with greater than 1 log less splenic CFU one week post-infection. For gene expression in these splenocytes, see . To confirm the specificity of the Mirn23a-/- phenotype for miR-24, anti-miR24 and miR-24 mimics () were introduced. Anti-miR24 greatly decreased the capacity of wild type but not Mirn23a-/- macrophages to control intracellular B. melitensis replication. In the converse experiment, addition of miR-24 mimics significantly enhanced B. melitensis replication in the Mirn23a-/- but not always in wild type macrophages. These data were consistent with the hypothesis that miR-24 is responsible for the decreased replication in Mirn23a-/- cells. Finally, to determine what proportion of the miR-24 effect was due to STING (vs. other miR-24 targets), STING-/- macrophages were transfected with anti-miR24 or mimics prior to infection. Whereas anti-miR24 suppressed Brucella replication in wild type macrophages, neither mimics nor anti-miRs exerted a significant magnitude of effect on replication in STING-/- cells (, anti-miRs: 5-40-fold in wild type vs <1.5-fold difference in STING-/-). These epistasis results suggested STING accounts for the majority of the miR-24 effect on replication during infection. Together, these data are consistent with the hypothesis that Brucella induction of miR-24 suppresses STING expression to increase infectious success.

Failure to induce miR-24 inhibits Brucella replication.

A) Wild type (WT, blue symbols) or Mirn23a-/- macrophages (orange symbols) were infected with 100 MOI B. melitensis for the times indicated, lysed, and then CFU were enumerated. Error bars are standard deviations of 8 replicates and results are representative of 3 independent experiments. B) C57BL/6 or Mirn23a-/- mice were infected with 106 B. neotomae (N = 7 mice per group). After 7 days, spleens were harvested for analysis of CFU. Bars are mean values. C) WT or Mirn23a-/- macrophages were transfected with anti-miR24 (left panel) or miR-24-3p mimic (right) or miR control then infected with B. melitensis for 24h. Cells were then lysed and CFU enumerated. Error bars are standard deviations of 8 replicates and representative of 4–5 experiments for the anti-miRs and miR-24-3p mimics respectively. Paler bars represent transfection of anti-miR24, whereas darker bars represent addition of the mimic. D) WT or STING-/- macrophages were transfected with anti-miR24 or miR-24-3p mimics and then infected with 100 MOI B. melitensis for 24h prior to enumeration of CFU. Results are representative of 4 experiments.

Discussion

The cytosolic DNA sensor STING plays a key role in innate immune defense via transcription of host defense genes including Type I interferons, induction of NF-κB-dependent responses and autophagy [15]. B. abortus DNA and cyclic-di-GMP activate STING, triggering IFN-β production [9,18]. In this report, at one, 3 and 6 weeks post infection, STING-/- mice had a 1-2-log higher burden of Brucella compared to age-matched wild-type counterparts, confirming that STING is ultimately required for control of Brucella infection. Although STING protects against Brucella, the striking suppression of STING mRNA expression early following infection suggests Brucella actively sabotages this innate immune sensor to gain a foothold inside macrophages. STING suppression occurred post-transcriptionally, independently of UPR-mediated RNA decay, via upregulation of the microRNA miR-24. MiR-24 induction and STING suppression required live bacteria, and full suppression required the VirB-encoded Type IV secretion system, suggesting an active bacterial driven process rather than a simple host response to Brucella PAMPs. The independence of miR-24 upregulation from STING signaling and lack of STING suppression by purified TLR agonists supports this model. MiR-24 upregulation and STING downregulation were slightly less robust in the MyD88-/- macrophages, consistent with a minor role for MyD88 signaling. Divergence of the ΔvirB2 mutant and wild type Brucella <8h post-infection suggests the requirement for the type IV secretion system does not simply reflect its effect on replication. Rather, the type IV secretion system may contribute to miR-24 upregulation through secretion of a specific Brucella substrate or by enabling appropriate intracellular trafficking. The early divergence (4h) of STING expression between Mirn23a-/- and wild type macrophages supports the idea that the effect of miR-24 precedes intracellular Brucella replication. Induction of the Mirn23a gene locus during infection comes at potential cost for Brucella infection. In NK cells, deletion of this locus (also known as Mirc11) resulted in decreased ability to contain Listeria infection, related to diminished IFN-γ and pro-inflammatory cytokine production [38]. Both IFN-γ and TNF-α have long been known to be critical for control of Brucella infection. However, effects of miR-24 on cytokine production may be cell-type specific. In CD4+ T cells, miR-24 was reported to target IFN-γ mRNA [39]. Over-expression of miR-24 in a Staphylococcus aureus infection model decreased “M1” inflammatory mediator production in macrophages and enhanced “M2” marker expression, which would benefit Brucella [40,41]. An earlier study had also suggested miR-24 modulates macrophage polarization towards an “alternative” M2 phenotype [42]. Manipulation of miR-24 levels had minimal effects on Brucella replication in STING-/- cells, suggesting that STING is the dominant or primary target of miR-24 induction during Brucella infection of macrophages that impacts intracellular replication. Recently, the ability of another chronic intracellular pathogen, Mycobacterium tuberculosis, to manipulate host innate responses, autophagy, and apoptosis via host miRNA has garnered much interest [43-46]. In contrast, there is much less information regarding miRNA in the context of Brucella infection [47-49]. Budak et al. investigated the miRNA expression patterns in CD4+ and CD8+ T cells from patients, and reported discrete changes with acute vs. chronic brucellosis [50,51]. Another study reported the up-regulation of miR-1981 in RAW264.7 infected macrophages and showed the interaction of that microRNA with the 3’-UTR of Bcl-2, an apoptosis regulator [52]. Recently, Corsetti et al revealed several miRNA-dependent mechanisms of immune manipulation during B. abortus infection: upregulation of mmu-miR-181a-5p suppressed TNF-α and miR-21a-5p downregulation decreased IL10 and elevated GBP5 [49]. Here, we show that Brucella significantly induce miR-24. Additionally, another predicted target of miR-24, Bim, a key apoptosis-regulator induced by PERK signaling and C/EBP homologous protein (CHOP) transcriptional activity, was significantly down regulated during infection with B. melitensis. MiR-24 inhibition resulted in a significant recovery in both Bim and STING, indicating that miR-24 is targeting both these mRNAs during B. melitensis infection. Our previous RNAseq data set [17] revealed upregulation of miR-24-2, encoded at the Mirn23a locus, but not miR-24-1 from the Mirn23b locus. Furthermore, although Mirn23a-/- cells expressed some miR-24, they were unable to upregulate its expression in response to infection. Throughout these experiments, fold-induction of miR-24 correlated with STING mRNA suppression. These results suggest that upsetting the balance between miR-24 and Tmem173 levels is the critical component. The strong effects of miR-24 manipulation through mimics and anti-miRs, as well as the defects in replication in the Mirn23a-/- macrophages together support the idea that upregulation of miR-24 is important for replication early during infection. In vivo, the inability to upregulate miR-24 correlated with decreased splenic CFU in the Mirn23a-/- mice one week post-infection, also suggesting that miR-24 supports acute infection. The greater replication in the Mirn23a-/- cells vs the anti-miR24 treated wild type macrophages () may reflect contributions from miR-23a and miR-27a encoded by that locus. In addition to the increased STING mRNA, miR-24 inhibition or genetic deficiency resulted in a significantly increased IFN-β response compared to uninhibited macrophages. Although initially identified in its role in viral protection, Type I interferons have recently become a topic of interest in response to many bacterial pathogens [53]. During infections, the effect of Type I interferons can be protective or detrimental depending on the bacterial species. For example, Type I interferon protects mice against Salmonella typhimurium infection whereas Interferon-alpha/beta receptor (IFNAR)-mediated Type I interferon responses to Francisella tularensis and Listeria monocytogenes are harmful to the host [54-56]. The role of Type I interferon in response to Brucella is currently unclear; a study in 2007 showed no difference in splenic and liver CFUs in wild type versus IFNAR-/- mice [57]. However, a more recent study has shown a higher burden of Brucella in wild type mice compared to IFNAR-/- mice, indicating that Type I interferon response is detrimental to the host [9]. Resistance to B. abortus in the IFNAR-/- mice was accompanied by elevated production of IFN-γ and NO, and decreased apoptosis compared to wild-type mice. Although type I IFN served as a useful indicator for STING activity in our study, ultimately, the experience with the IFNAR-/- mice suggest STING is controlling infection through Type I IFN-independent mechanisms. Brucella potently inhibits apoptosis, contributing to chronic infection; however, the mechanisms behind this process are unknown [34,58]. By down-regulating STING and subsequent IFN-β production, Brucella could be actively inhibiting apoptosis that is dependent upon Type I IFN signaling. Further, by up-regulating miR-24, which in turn down-regulates Bim, Brucella could be avoiding UPR-mediated apoptosis, which is partially dependent upon Bim in other experimental systems [59]. B. melitensis infection robustly induces CHOP, which is an upstream activator of Bim [23,60]. We did not detect a reliable effect of the anti-miR-24 on host cell apoptosis or cell death. One likely explanation is that there are unidentified miR-24-independent mechanisms that inhibit apoptosis independently of STING and Bim down-regulation. Indeed, our previous RNAseq data [17] suggested that Brucella suppresses the expression of multiple pro-apoptotic molecules. In summary, our findings document the evasion of full STING activation during infection by an intracellular bacteria pathogen via miR-24-mediated suppression of STING expression. It is noteworthy that a single miRNA species should have such a profound impact on a major cytosolic innate immune sensor and consequent Brucella replication. Our data may have implications for other important pathogens. For instance, miR-24 was up-regulated and cited as one of 7 significantly altered microRNAs controlling the transcriptional response to M. tuberculosis in macrophages [61]. In a separate report, in transcriptomic data, Tmem173 was suppressed by more than 50% at 4 hours and >75% decreased 12 hours following M. tuberculosis infection [62]. Widely considered a “stealth” pathogen, Brucella can evade immune surveillance and persist chronically in macrophages [63]. In contrast to this idea of Brucella as “flying under the radar”, previous reports have described Brucella subversion of toll-like receptor signaling via Btp1/TcpB [64-66]. The data presented here elucidate a critical mechanism by which Brucella actively sabotages cytosolic surveillance by the innate immune sensor STING to establish its intracellular niche.

Methods

Ethics statement

Mouse care, handling and experimental procedures were approved by the Institutional Animal Care and Use Committees (IACUC) of the institutions involved in this project and performed with strict adherence. Reagents, resources and associated sources and identifiers are listed below in Table 1 and primers in Table 2.
Table 1

Reagents and resources used in this study and their associated sources and identifiers.

REAGENT or RESOURCESOURCEIDENTIFIER
Antibodies
Rabbit monoclonal anti-STINGCell Signaling TechnologyCat# 13647
Mouse monoclonal anti-β-actinSanta Cruzsc-47778
Bacterial Strains
Brucella melitensis 16MUW-Madison archiveN/A
Brucella abortus 2308UW-Madison archiveN/A
Brucella neotomae Stoenner and Lackman 1957ATC 23459N/A
Brucella suis 1330UW-Madison archiveN/A
Escherichia coli DH5aUW-Madison archiveN/A
Chemicals
4μ8cEMD MilliporeCat#412512-25MG
ODN 1585InvivogenTlrl-1585
Pam3CSK4InvivogenTlrl-pms
Critical Commercial Assays
RNAzol RTMolecular Research Center, Inc.RN 190
PowerUp SYBR Green Master MixAppliedBiosystemsCat# A25742
B-PER Bacterial Protein Extraction ReagentThermoFisher ScientificCat# 78248
M-PER Mammalian Protein Extraction ReagentThermoFisher ScientificCat# 78501
Halt Protease and Phosphatase InhibitorThermoFisher ScientificCat# 78440
Dual-Glo Luciferase assay systemPromegaCat# E2490
Cell Line Nucleofector kit VLonzaVVCA-1003
Lipofectamine RNAiMAX Transfection ReagentThermoFisher ScientificCat# 13778030
Opti-MEMThermoFisher ScientificCat# 31985070
LEGEND MAX Mouse IFN-β ELISA Kit with Pre-coated PlatesBioLegendCat# 439407
qScript microRNA cDNA Synthesis KitQuanta BiosciencesCat# 95107–025
SuperScript IV VILO Master MixThermoFisher ScientificCat# 11756050
LPS Extraction KitiNtRON BiotechnologyCat# 17141
Experimental Models: Cell Lines
iMACs (immortalized macrophages)John-Demian SauerN/A
LADMAC (for CSF-1)ATCCCRL-2420
Experimental Models: Organisms/Strains
Mus musculus C57BL/6Federal University of Minas Gerais; IUSM South BendN/A
Mus musculus C57BL/6 STING-/-Ishikawa and Barber, 2008N/A
Mus musculus mirn23a-/-(on C57BL/6 background)Richard Dahl; IUSM South BendN/A
Mus musculus MyD88-/-(on C57BL/6 background)Bruce KleinN/A
Oligonucleotides and plasmids
mirVana miRNA inhibitor hsa-miR-24-3pThermoFisher ScientificCat# 4464084
Anti-miR miRNA Inhibitor Negative Control #1ThermoFisher ScientificCat# AM17010
miRNA Neg ControlSIGMAMISSION miRNA Control
miRNA hsa-mir-24SIGMAMISSION miRNA Mimic
miRNA inhibitor mmu-mir-24-3pSIGMAMISSION miRNA Inhibitor
VirB2 knock-out vector, pAV2.2Renee M. TsolisDen Hartigh et al., 2004 [22]
pBBR1-MCS4Lab ArchiveN/A
pBBR1-VirB2This workN/A
pSTING-254 murine STING promoter luciferase plasmidHua-Guo XuXu et al., 2017 [67]
Software and Algorithms
GraphPad Prism 7Graphpad SoftwareN/A
Table 2

Primers used in this study.

Primers used in this work
PrimerSequenceSource
18S FAGGGGAGAGCGGGTAAGAGAIDT
18S RGGACAGGACTAGGCGGAACAIDT
Bim FTGTCTGACTCTGATTCTCGGAIDT
Bim RTGCAATTGTCCACCTTCTCTGIDT
hsa-miR-24-3pNASIGMA; MIRAP00056
IFN-β FGGCATCAACTGACAGGTCTTIDT
IFN-β RACTCATGAAGTACAACAGCTACGIDT
RNU6GCAAATTCGTGAAGCGTTCCIDT
STING FAAGTCTCTGCAGTCTGTGAAGIDT
STING RTGTAGCTGATTGAACATTCGGAIDT
Xbp-1(t) FTCCGCAGCACTCAGACTATGTIDT
Xbp-1(t) RATGCCCAAAAGGATATCAGACTCIDT
Xbp-1(s) FGAGTCCGCAGCAGGTGIDT
Xbp-1(s) RGTGTCAGAGTCCATGGGAIDT
virB2 FCCAGACCGATAAGAGAACGATGIDT
virB2 RCCGATCAGGCACGCATATAAIDT
virB2-988 FCTCGAGGCTGCCCCAGTAAAAAAAACGACIDT
VIRB2-1562 RATCGATTCGGTCTGCTTGCTCAATGTCTATIDT
PerfeCTa Universal PCR PrimerNAQuanta Biosciences; 95109–500

Primers used for qPCR determination of gene expression and their sources are listed.

Primers used for qPCR determination of gene expression and their sources are listed.

Experimental model and method details

Mice

In vivo infections in mice were performed via intraperitoneal injection of 106 CFU/0.2ml of PBS diluent of Brucella abortus 2308 or Brucella neotomae Stoenner and Lackman 1957 or 0.2ml PBS (uninfected vehicle control). At indicated time points post infection, mice were euthanized following IACUC approved procedures. In Brazil, wild type C57BL/6 mice were purchased from the Federal University of Minas Gerais (UFMG). STING (Tmem173)-/-, mice were described previously [13]. Mice were maintained at UFMG and used at six weeks of age. To count Brucella colony forming units (CFU), individual spleens were macerated in 10 ml saline, serially diluted, and plated in duplicate on Brucella Broth agar. After 3 days of incubation at 37°C, the number of CFU was determined as described previously [34]. At the University of Notre Dame, seven wild-type C57/BL6 and Mirn23a-/- mice (mixed gender; 6 wks) were infected with B. neotomae, and one per genotype injected with PBS control, and euthanized at 7 days post-infection. Spleens were processed and assayed for CFU and RNA as follows: Single cell suspensions of mouse spleens were prepared using a gentleMACS dissociator (Miltenyi Biotec) following the manufacturer’s protocol. Splenocytes from each mouse were processed for either CFU determination (as described below) or RNA preparation.

Mammalian cell lines

V-raf/v-myc immortalized murine bone marrow derived macrophages (BMDM) were a generous gift from Dr. John-Demian Sauer at the University of Wisconsin-Madison. These macrophages (iMacs) were from C57BL/6 mice. V-raf/V-myc immortalized BMDM were generated in our lab from leg bones of MyD88-/-, STING-/-, and Mirn23a-/- mice obtained from researchers listed in Table 1 above. These mice were all on a C57BL/6 background. For the Mirn23a-/- experiments, wild type C57BL/6 bones were obtained from Dr. Dahl’s colony. All immortalized macrophage cell lines were cultured at 37°C with 5% CO2 in RPMI supplemented with 1mM Na pyruvate, 0.05mM 2-mercaptoethanol, and 10% FBS. Apart from Figs 1 and , immortalized macrophages were used for in vitro experiments.
Fig 1

STING is required for control of acute Brucella infection in vitro, and acute and chronic infection in vivo.

A) Bone marrow derived macrophages from wild type C57BL/6 control (WT) or STING-/- mice were infected with 10 multiplicity of infection (MOI) B. abortus for 24h prior to enumeration of colony forming units (CFU). Error bars denote triplicate determinations. B) Wild-type C57BL/6 (black circles, +/+) and STING-/- mice (open circles, -/-) were infected for 1, 3 or 6 weeks with 106 CFU Brucella abortus 2308 and splenocyte CFUs determined. Circles represent individual mice with 5 mice per group except the STING-/- from week 6 (4 mice). Bars denote median CFU/group. Results in (A) and (B) are representative of 3 independent experiments.

Bone marrow derived macrophages (BMDM)

To generate CSF-1 containing media, LADMAC cells were grown to confluency and then pelleted. The supernatant was filtered (0.45 μm) prior to use. Mouse femur and tibia bones were cleaned of tissue. The ends of the bones were snipped aseptically using surgical scissors, and bone marrow was flushed using a PBS-filled syringe with a 27G needle. The flushed cells were then pulled and ejected through a syringe with an 18G needle to generate a single cell suspension. The suspension was filtered through a 70 μm cell strainer to remove solid fragments, pelleted (300 x g; 5 min), and resuspended in 35% LADMAC conditioned media. Bone marrow cells were differentiated into macrophages over 7 days.

Brucella strains

Brucella strains B. melitensis, B. abortus, B. suis, and B. neotomae were from archived stock of the University of Wisconsin-Madison and the University of Minas Gerais (B. abortus used in Figs 1 and 4). Brucella were cultured using Brain Heart Infusion broth or agar (Difco) at 37°C. All experiments with select agent Brucella strains were performed in a Biosafety Level 3 facility in compliance with the CDC Division of Select Agents and Toxins regulations according to standard operating procedures approved by the University of Wisconsin-Madison and UFMG Institutional Biosafety Committees. B. neotomae in vivo experiments were approved by the University of Notre Dame Institutional Biosafety Committee.
Fig 4

Brucella induces a STING-targeting microRNA miR-24.

A) Left panel: Macrophages were not infected (NI) or infected with 100 MOI Brucella melitensis (B. mel) for 24 hours before harvesting for RNA. Right: Mice were infected with 106 B. abortus 2308 (B. abort) for 24 hours prior to processing of spleen for microRNA. Micro RNA levels were determined by qPCR with normalization toRNU6 and uninfected controls (NI set = 1). In vitro results are from 17 experiments, with error bars denoting SEM. In vivo, results are representative of 2 independent experiments. N = 3 uninfected and 4 infected mice, with SD error bars. B) Macrophages were infected as in (A) and processed for mRNA. Expression was normalized to 18S rRNA. Bcl2l11 (Bim) expression is from 8 experiments. C) Time course of quantitative expression of both miR24-3p and STING (Tmem173) mRNA. P<0.001 for changes over time (N = 6). D) Correlation is from 19 experiments performed and evaluated as in (A). R2 = 0.027, p = 0.022 E) Macrophages were infected as in (A) and processed for miRNA. Comparison of live and heat killed B. melitensis (B. mel vs. HK) is from N = 9. P<0.005 for B. mel vs. NI and HK. F) Macrophages were infected with wild type B. melitensis or VirB2 deletion mutant clones C1 and C2 and analyzed as in (A). Results are from 3 experiments. P<0.005 for B. mel vs. NI and vs. ΔVirb2 clones. G) Time course comparing effects of wild type B. melitensis (filled symbols) and Δ virB2 (clone 1, open symbols) on miR-24 (black circles) and Tmem173 mRNA (gray triangles). Gene expression changes were normalized to time 0 for each Brucella genotype infection (see methods) and error bars represent standard deviations of triplicate determinations. P-values compare Brucella genotypes at each time point: #p<0.005, ##p<0.001 for Tmem173 and *p<0.05, **p<0.01, ***p<0.005, ****p<0.001 for miR-24.

VirB2 deletion mutants of Brucella were derived through homologous recombination following the methods described by den Hartigh et. al., 2004 using the plasmid pAV2.2 (generous gift from R.M. Tsolis). Briefly, exponentially growing Brucella were made electrocompetent following standard microbiological methods. Electrocompetent Brucella were then electroporated with pAV2.2 and VirB2 deletion mutants were selected for kanamycin resistance and carbenicillin sensitivity. VirB2 deletion was confirmed in these clones using PCR. Where not otherwise specified, “clone 1” was used in experiments. The complementation plasmid for VirB2 was engineered through PCR amplification of the VirB2 ORF plus the ribosome binding site but lacking the promoter sequences. Primers virB2-988 F and virB2-1562 R also encoded appropriate restriction sites to aid cloning (Xho I/Cla I). VirB2 was then cloned into pBBR1-MCS4 containing a constitutive lac promoter shown in previous studies to be effective for complementation analysis in B. melitensis [68]. The PCR product was digested and ligated with similarly digested pBBR1-MCS4 to generate the complementation plasmid. The VirB2 amplified product was directionally cloned into pBBR1-MCS4 to ensure that these genes were transcribed from the lac promoter present in the plasmid. The resulting complementation plasmid, pBBR1-VirB2, was transformed into the VirB2 deletion mutant and selected for ampicillin resistance. In experiments using heat-killed (HK) Brucella as a control, inactivation of Brucella was as follows. After growing Brucella in culture, the sample was quantitated using spectrophotometry. Brucella was then aliquoted in microcentrifuge tubes and placed in a 56°C waterbath for 1 h. Brucella lipopolysaccharide (LPS) along with E. coli LPS was used as an agonist for TLR studies and was extracted as follows: Brucella melitensis was cultured in BHI broth for 3 days in a 37°C shaking incubator to an OD600 of approximately 1.2. Bacteria was pelleted and LPS extracted using an LPS extraction kit (iNtRon Biotechnology) following the manufacturer’s protocol. E. coli DH5a LPS was extracted using the same method after 1 day of culture.

Infections, treatments, transfections and CFU assays

Immortalized macrophage cell lines were plated on 6-well tissue culture plates at 0.4 x 106 cells per well in 2 ml culture media. Primary BMDM were plated on 6-well tissue culture plates at 1.2 x 106 cells per well in 2 ml culture media. The next day, the media was replaced, and cells were infected with 100 MOI Brucella determined by spectrophotometry (OD at 600 nm) through a formula established by a Brucella growth curve. Cells were then centrifuged (300 x g; 5 min) to synchronize infection and were incubated at 37°C with 5% CO2. One hour later, cells were washed 3x with 2 ml/well warm PBS and fresh media containing 10 μg/ml gentamycin was added. This one-hour point was considered “Time 0” post infection for the time courses. Cell treatments: 4μ8c (IRE1 endonuclease inhibitor) was dissolved at 10mM in DMSO and then diluted to 1mM (100x) in media. 4μ8c was added to the cultures 1 hour prior to infection. For TLR agonist treatment, cells were plated in 12 well plates at 0.5x106/well in 1 mL growth media. ODN 1585 and Pam3CSK4 were dissolved in media and used at concentrations of 1 μM and 10ng/mL respectively. Extracted E. coli LPS was used at 100ng/mL and Brucella LPS at 10μg/mL. Luciferase assay: 2 μg STING promoter driven luciferase reporter plasmid and 0.5μg Renilla TK were transfected into 1x106 cells suspended in solution V by AMAXA Nucleofection (Lonza), then cells were plated in 12 well plates. The following day, the cells were given fresh media and infected with Brucella melitensis (100 MOI) or stimulated with heat-killed Brucella melitensis (100 MOI). Twenty-four hours later, the cells were washed with 1ml PBS 3x, resuspended in 150 μL kit lysis buffer and assayed according to the manufacturer’s instructions. Assays were performed in triplicate using a Veritas microplate luminometer (Turner Biosystems). For microRNA transfections, immortalized macrophages were seeded on 6-well tissue culture plates at 0.4 x 106 cells/well. MiRNA mimics (miR-24-3p), miRNA control, and miRNA inhibitors for miR-24-3p were diluted to 0.28 μM using Opti-MEM and the cells were transfected using using RNAiMAX reagent following the manufacturer’s protocol. One day after transfection, cells were infected as described above, then processed for RNA or CFU. For CFU assays, cells were washed 3x in PBS to remove extracellular bacteria, then 1 ml of cell lysis buffer (dH2O + 0.1% Triton X-100) was added per well. CFU were determined by serial dilution plating with 8 replicates on BHI agar after 3–4 days.

Quantitative polymerase chain reaction (qPCR)

Total cellular RNA was processed using RNAzol RT reagent (Molecular Research Center, Inc.) following the manufacturer’s protocol. Then cDNA was prepared from either mRNA, using the Superscript IV VILO system (Invitrogen) or microRNA using the qScript system (Quanta biosciences). Samples for Quantitative PCRs were analyzed via SYBR Green and the delta-delta Ct method to calculate relative fold gene expression using a StepOnePlus thermocycler (ABI). Endogenous housekeeping genes used for comparative expression were either 18S (rRNA) or RNU6 (microRNA). The primers used in this study were designed using IDT’s online primer design tool or purchased.

Quantification of IFN-β by ELISA

Culture supernatants from cells were collected and frozen at -80°C until assayed. A mouse IFN-β ELISA was performed following the kit manufacturer’s protocol. Absorbance at 450 nm and 570 nm were determined utilizing a BioTek microplate reader. Mouse IFN-β was quantified by standard curve.

Western blot assays

Cell lines (infected or control) were washed with PBS, scraped off the well, then transferred to a microcentrofuge tube and pelleted (4k RPM, 5 min). The supernatant was removed and cells lysed with M-PER reagent (ThermoFisher Scientific) according to the manufacturer’s protocol. Whole-cell lysates were resolved by 12% SDS-PAGE. Samples were then transferred to polyvinyldene difluoride (PVD) membrane and immunoblotted with anti-STING primary antibody (ThermoFisher Scientific) and anti-β-actin primary antibody (Santa Cruz), followed by a fluorescence-conjugated secondary antibody (LI-COR). Proteins were visualized and quantitated with the Odyssey system (LI-COR).

Quantification and statistical analysis

CFU values and standardized mRNA expression levels were summarized in terms of means ± standard deviations and displayed in graphical format using bar charts, stratified by experimental conditions. Comparisons between experimental groups were conducted using two-sample t-test or analysis of variance (ANOVA). Pairwise comparisons between multiple groups were conducted using Tukey’s Honestly Significance Difference (HSD) method. Residual and normal probability plots were examined to verify the model assumptions. Linear regression and Pearson’s correlation analyses were conducted to evaluate bivariate associations. Statistical significance is indicated in the figures (* p<0.05, ** p<0.01, *** p<0.005, **** p<0.001, ns not significant). Statistical analyses were conducted using SAS (SAS Institute Inc., Cary NC), version 9.4.

The type IV secretion system is required for miR-24 upregulation and complete Tmem173 downregulation.

A) Bone marrow derived macrophages were infected with 100 MOI B. melitensis or ΔvirB2 mutant and harvested for RNA at 12h and 24h post infection. Tmem173 and miR-24 expression was normalized to Time 0 for each genotype (set = 1). B) Immortalized macrophages were infected as above and CFU (8 replicates) determined over time. By 24h, the ΔvirB2 mutant was at a significant disadvantage for replication (p<0.001) vs. wild type B. mel and the complemented mutant. C) Macrophages were infected with 100 MOI of B. melitensis, ΔvirB2 mutant, or the mutant transfected with the virB2 gene for 8h prior to harvest for RNA. Error bars are triplicate standard deviations. (TIF) Click here for additional data file.

miR-24 and STING expression in anti-miR-24 and miR-24 mimic transfected cells.

A) Macrophages were not transfected (white and black bars) or transfected with anti-miR-24 inhibitor (pale gray), scrambled control nucleotide (dark gray), or miR-24 mimic (striped bars). Cells were subsequently uninfected (-) or infected with 100 MOI B. melitensis (+). After 24h, cells were harvested for RNA and miR-24 levels determined by qPCR with normalization to RNU6. N = 3 experiments. Error bars are SEM. *p<0.05, ****p<0.001. B) Macrophages were transfected as in (A). 24h following infection with Brucella, cells were lysed and whole cell lysates resolved by SDS-PAGE. STING and β-actin were detected using western blot and immunofluorescence. Blot is representative of 2 experiments. Graph bars are actin-normalized optical densities of the STING bands. (TIF) Click here for additional data file.

Mirn23a-/- mice fail to upregulate miR-24 and exhibit less Tmem173 suppression following Brucella infection.

C57BL/6 (+/+) and Mirn23a-/- (-/-) mice were infected intra-peritoneally with 106 B. neotomae (7 mice per group). After 7 days, mice were sacrificed and spleens harvested for CFU (Fig 7) and RNA. Gene expression was determined by qPCR. Results from individual infected mice were normalized to an uninfected control (set = 1) for each genotype. ****p<0.001 and **p<0.01 vs. infected C57BL/6.
Fig 7

Failure to induce miR-24 inhibits Brucella replication.

A) Wild type (WT, blue symbols) or Mirn23a-/- macrophages (orange symbols) were infected with 100 MOI B. melitensis for the times indicated, lysed, and then CFU were enumerated. Error bars are standard deviations of 8 replicates and results are representative of 3 independent experiments. B) C57BL/6 or Mirn23a-/- mice were infected with 106 B. neotomae (N = 7 mice per group). After 7 days, spleens were harvested for analysis of CFU. Bars are mean values. C) WT or Mirn23a-/- macrophages were transfected with anti-miR24 (left panel) or miR-24-3p mimic (right) or miR control then infected with B. melitensis for 24h. Cells were then lysed and CFU enumerated. Error bars are standard deviations of 8 replicates and representative of 4–5 experiments for the anti-miRs and miR-24-3p mimics respectively. Paler bars represent transfection of anti-miR24, whereas darker bars represent addition of the mimic. D) WT or STING-/- macrophages were transfected with anti-miR24 or miR-24-3p mimics and then infected with 100 MOI B. melitensis for 24h prior to enumeration of CFU. Results are representative of 4 experiments.

(TIF) Click here for additional data file. 20 Apr 2020 Dear Dr. Smith, Thank you very much for submitting your manuscript "Brucella suppress innate immunity by down-regulating STING expression in macrophages" for consideration at PLOS Pathogens. We apologize for the long time in review--many of our editors and reviewers have been pulled into the COVID-19 response and we are encountering significant delays in review. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. [2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Please prepare and submit your revised manuscript within 60 days if you are currently able to do experiments, or let us know if your university is closed and you will need longer to complete the experiments, and we will extend the time for you. Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Renée Tsolis Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************** Reviewer's Responses to Questions Part I - Summary Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship. Reviewer #1: Brucella suppress innate immunity by down-regulating STING expression in macrophages Mike Khan and colleagues have investigated the effect of the microRNA, miR-24-2, on Tmem173 expression, the gene encoding the innate immune sensor STING, during Brucella infection. Decreased STING results in decreased type I IFNs and increased bacterial numbers in macrophages. In vivo, STING-/- mice had increased bacterial burdens in the spleen at 3 and 6 weeks post infection compared to wildtype infected mice. The authors show that during infection the expression of Tmem173 is reduced, and this correlates with the increased expression of miR24-2. Inhibition of miR24 using anti miRs and mirn23a locus deficient macrophages resulted in unaltered Tmem173 expression and subsequently reduced intracellular Brucella. Altogether, the data demonstrate that Brucella actively upregulate miR-24 expression to repress Tmem173 expression, resulting in increased bacterial numbers and chronic Brucella infection. The manuscript is well written and the experiments well executed with appropriate controls. The major concern is the novelty of the data presented in this manuscript. It has been well established that miR-24 represses Tmem173 expression (PMID: 22387590 and 31735332). Furthermore, the role of STING in limiting Brucella infection has also been previously demonstrated. The innovative part of this manuscript is the active upregulation of miR-24 by Brucella which requires a functional T4SS. Adding more dating to this manuscript to investigate the mechanism of Brucella-induced upregulation of miR-24 (possibly mediated by an effector protein, or intracellular PAMPs (e.g. LPS) independent of MyD88 signaling) would greatly enhance this manuscript. Furthermore, all experiments (except Figure 1B) are performed with immortalized BMDMs and in vivo evidence (mouse infections) is lacking showing that Brucella upregulates miR-24, resulting in STING suppression and increased bacterial numbers. Mirn23a-/- mice should be available to the authors, since mirn23a-/- macrophages were used in this study. What is the effect of mirn23a deficiency on Brucella infections (chronic and/or acute) in vivo? Minor comments: Figure 3B. An intact T4SS is required for Tmem173 expression, but does deletion of the T4SS result in lower numbers of intracellular bacteria that could account for the partial rescue of Tmem173 expression? Possibly the amount of intracellular bacteria, or PAMPs, could lead to miR-24 upregulation? The authors should rephrase sentence 162/163. Statistically there was no significant increase of miR-24 in Brucella infected MyD88-/- macrophages compared to uninfected MyD88-/- macrophages, suggesting MyD88 might be required in miR-24 expression (even though there was still a small increase in miR-24 expression in MyD88-/- macrophages). Reviewer #2: This study by Khan and collaborators investigates the underlying mechanisms of STING down-modulation upon Brucella infection pinpointing to the role of a STING-targeting microRNA, miR-24-2 as a key regulator of STING expression induced by Brucella. The study is well-conducted and follows a hypothesis-driven rationale. Results are novel in the field and will serve to improve the knowledge of how this zoonotic pathogen important for human health deals with innate immunity to survive inside macrophages Anyway, some concerns are raised Reviewer #3: Khan et al present very strong and clear study showing Brucella suppresses STING expression via induction of a specific microRNA, which favors intracellular replication. The manuscript is very well written and for the most part data support the conclusions. Data are novel and of significance in the field. ********** Part II – Major Issues: Key Experiments Required for Acceptance Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions. Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject". Reviewer #1: As outlined above (Part I), the authors should 1) investigate the mechanism of Brucella-induced expression of miR-24 and 2) provide evidence of the in vivo (mouse experiments) relevance of miR-24 expression during Brucella infections. Reviewer #2: 1) Regarding the results show in Figure 1 respect to the role of STING in the control of Brucella infection in vivo and in vitro. Results seem to be mentioned as complementary of previous studies but to really know if the control of infection begins at early time points (as it seems to this reviewer, and is suggested by the authors in the discussion section, lines 273-274) or late in the chronic phase of infection; as the experiments performed in vivo in this Figure and stated in the title of Results. Thus, a kinetic should be performed in vitro (12, 24, 72 h) and in vivo (1, 3 and 6 wk) under the same experimental conditions to understand how early or late STING is controlling Brucella infection. 2) Scramble control of transfection with anti Mir-24 used to show specificity does not work properly. Levels of mir24 expression should be comparable to the ones achieved with infection in the absence of specific mir-24 inhibition, thus invalidatin the results and conclusions of Fig1 s and more important results in Figure 6. Please perform again the experiments (Fig1 S and Fig 6) using another scramble control that allows clear conclusions on the results obtained. 3) Although the use of v-raf/v105 myc immortalized murine bone marrow-derived macrophages is convenient and reliable, at least in when they need to be transfected. Some experiments would favor if primary BMDM are use. For instance, downregulation od STING expression do to Brucella species and the requirement of live bacteria and TSS4 system shoul be performed in WT BMDM to demonstrate the universality of the phenomenon. Reviewer #3: I really only have one concern. In my opinion, with the experiments that were carried out authors cannot conclude the phenotypes are dependent on the T4SS. At 24h, the virB mutant is highly attenuated so there is 1) a significant difference in number of bacteria in cells infected between the wt and mutant and 2) the mutant is in a completely different intracellular compartment. Both of these could indirectly impact the results and give the false impression that the T4SS is necessary. Authors could try to do these experiments at earlier time-points were trafficking and CFU counts are comparable between the WT and the virB mutant or simply remove these data, which are not essential for any of the conclusions presented. ********** Part III – Minor Issues: Editorial and Data Presentation Modifications Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. Reviewer #1: See above in Part I Reviewer #2: 1) Title does not reflect the results obtained in the investigation. It should refer to the role of mir24 in STING down-modulation. Indicating the role of STING in innate immunity is an overstatement. Also the role of STING in innate immune responses has been already investigated and published by Costa Franco MM et al (J Immunol. 2018 ;200(2):607) 2) Figure 2 A: why STING expression was evaluated a number of very different times depending upon the species investigated? Melitensis 25 times, Abortus 7 and the other 2 species 5 times ….Results does not seem to be variable? Please explain. 3) Figure 2B: please show a more representative WB that the one depicted. Beta-acting seems to vary in the different lanes. Since the experiment was repeated several times as referred in the Figure legend a more representative photo must be shown. Why the picture has 3 lanes when the bar graph only has 2? 4) Figure 3 C: It is not clear what the asterisks in the HK bar stand for? In the texts is stated that HK is “comparable “to WT (line 120). Please clarify 5) Overall figure legends are no easy to follow. Modify them to make them fit with what is shown in the figures 6) Figure 4 A: Why if in the text (line 147) states that mir-24 levels vary between 50% and 8 times, the dispersion shown in the figure is so small (4 +/- 1 times). What kind of replicate were included in the data show?. 7) Discussion: Lines 304-305 are an overstatement to say that “Evades full activation of innate immunity”. It should say modifies IFN beta expression and apoptosis at the most Reviewer #3: none ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at . Data Requirements: Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see 4 Aug 2020 Submitted filename: Author response073020.docx Click here for additional data file. 1 Oct 2020 Dear Dr. Smith, We are pleased to inform you that your manuscript 'Brucella suppress STING expression via miR-24 to enhance infection' has been provisionally accepted for publication in PLOS Pathogens. Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests. Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated. IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS. Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Renée M. Tsolis Section Editor PLOS Pathogens Renée Tsolis Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************************************************** Dear Judy, my sincere apologies for the long time in review. We had two different editors handling this manuscript, and it fell between the cracks--I'm very sorry. You've done a great job responding to the review and I think it has improved the paper! Reviewer Comments (if any, and for reference): 18 Oct 2020 Dear Dr. Smith, We are delighted to inform you that your manuscript, "Brucella suppress STING expression via miR-24 to enhance infection," has been formally accepted for publication in PLOS Pathogens. We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly. Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064
  67 in total

Review 1.  Brucellosis.

Authors:  Georgios Pappas; Nikolaos Akritidis; Mile Bosilkovski; Epameinondas Tsianos
Journal:  N Engl J Med       Date:  2005-06-02       Impact factor: 91.245

2.  ER stress triggers apoptosis by activating BH3-only protein Bim.

Authors:  Hamsa Puthalakath; Lorraine A O'Reilly; Priscilla Gunn; Lily Lee; Priscilla N Kelly; Nicholas D Huntington; Peter D Hughes; Ewa M Michalak; Jennifer McKimm-Breschkin; Noburo Motoyama; Tomomi Gotoh; Shizuo Akira; Philippe Bouillet; Andreas Strasser
Journal:  Cell       Date:  2007-06-29       Impact factor: 41.582

3.  Brucella abortus Cyclic Dinucleotides Trigger STING-Dependent Unfolded Protein Response That Favors Bacterial Replication.

Authors:  Erika S Guimarães; Marco Túlio R Gomes; Priscila C Campos; Daniel S Mansur; Adara A Dos Santos; Jerome Harms; Gary Splitter; Judith A Smith; Glen N Barber; Sergio C Oliveira
Journal:  J Immunol       Date:  2019-03-20       Impact factor: 5.422

Review 4.  MicroRNAs play big roles in modulating macrophages response toward mycobacteria infection.

Authors:  Abualgasim Elgaili Abdalla; Xiangke Duan; Wanyan Deng; Jie Zeng; Jianping Xie
Journal:  Infect Genet Evol       Date:  2016-09-28       Impact factor: 3.342

5.  Mirc11 Disrupts Inflammatory but Not Cytotoxic Responses of NK Cells.

Authors:  Arash Nanbakhsh; Anupallavi Srinivasamani; Sandra Holzhauer; Matthew J Riese; Yongwei Zheng; Demin Wang; Robert Burns; Michael H Reimer; Sridhar Rao; Angela Lemke; Shirng-Wern Tsaih; Michael J Flister; Shunhua Lao; Richard Dahl; Monica S Thakar; Subramaniam Malarkannan
Journal:  Cancer Immunol Res       Date:  2019-09-12       Impact factor: 11.151

6.  Critical role of ASC inflammasomes and bacterial type IV secretion system in caspase-1 activation and host innate resistance to Brucella abortus infection.

Authors:  Marco Tulio R Gomes; Priscila C Campos; Fernanda S Oliveira; Patricia P Corsetti; Karina R Bortoluci; Larissa D Cunha; Dario S Zamboni; Sergio C Oliveira
Journal:  J Immunol       Date:  2013-03-04       Impact factor: 5.422

Review 7.  Human brucellosis.

Authors:  María Pía Franco; Maximilian Mulder; Robert H Gilman; Henk L Smits
Journal:  Lancet Infect Dis       Date:  2007-12       Impact factor: 25.071

Review 8.  The mammalian unfolded protein response.

Authors:  Martin Schröder; Randal J Kaufman
Journal:  Annu Rev Biochem       Date:  2005       Impact factor: 23.643

9.  Altered Expressions of miR-1238-3p, miR-494, miR-6069, and miR-139-3p in the Formation of Chronic Brucellosis.

Authors:  Ferah Budak; Salih Haldun Bal; Gulcin Tezcan; Halis Akalın; Guher Goral; Haluk Barbaros Oral
Journal:  J Immunol Res       Date:  2016-09-19       Impact factor: 4.818

10.  Regulated Ire1-dependent decay of messenger RNAs in mammalian cells.

Authors:  Julie Hollien; Jonathan H Lin; Han Li; Nicole Stevens; Peter Walter; Jonathan S Weissman
Journal:  J Cell Biol       Date:  2009-08-03       Impact factor: 10.539

View more
  8 in total

Review 1.  Evolution of animal and human brucellosis in Algeria: a mini narrative review.

Authors:  F Tazerart; K Aliouane; G Grine
Journal:  New Microbes New Infect       Date:  2022-03-26

Review 2.  Impact of STING Inflammatory Signaling during Intracellular Bacterial Infections.

Authors:  Erika S Guimarães; Fabio V Marinho; Nina M G P de Queiroz; Maísa M Antunes; Sergio C Oliveira
Journal:  Cells       Date:  2021-12-28       Impact factor: 6.600

Review 3.  The cGAS-STING Pathway in Bacterial Infection and Bacterial Immunity.

Authors:  Nanxin Liu; Xiaoxiao Pang; Hua Zhang; Ping Ji
Journal:  Front Immunol       Date:  2022-01-13       Impact factor: 7.561

4.  Herpes simplex virus 1 evades cellular antiviral response by inducing microRNA-24, which attenuates STING synthesis.

Authors:  Nikhil Sharma; Chenyao Wang; Patricia Kessler; Ganes C Sen
Journal:  PLoS Pathog       Date:  2021-09-30       Impact factor: 7.464

5.  Cell-Free DNA Promotes Inflammation in Patients With Oral Lichen Planus via the STING Pathway.

Authors:  Jing Deng; Weiyi Pan; Ning Ji; Na Liu; Qian Chen; Jinhuan Chen; Yutong Sun; Liang Xie; Qianming Chen
Journal:  Front Immunol       Date:  2022-04-14       Impact factor: 8.786

Review 6.  Immunosuppressive Mechanisms in Brucellosis in Light of Chronic Bacterial Diseases.

Authors:  Joaquin Miguel Pellegrini; Jean-Pierre Gorvel; Sylvie Mémet
Journal:  Microorganisms       Date:  2022-06-21

7.  Galectin-3 regulates proinflammatory cytokine function and favours Brucella abortus chronic replication in macrophages and mice.

Authors:  Fernanda L Tana; Erika S Guimarães; Daiane M Cerqueira; Priscila C Campos; Marco Túlio R Gomes; Fábio V Marinho; Sergio C Oliveira
Journal:  Cell Microbiol       Date:  2021-07-02       Impact factor: 4.115

8.  Downregulation of Three Novel miRNAs in the Lymph Nodes of Sheep Immunized With the Brucella suis Strain 2 Vaccine.

Authors:  Si Chen; Chengqiang Wang; Qiaoling Chen; Dantong Zhao; Yongbin Liu; Shihua Zhao; Shaoyin Fu; Xiaolong He; Bin Yang; Qinan Zhao; Qi An; Zhenxing Zhang; Yiwen Cheng; Churiga Man; Guoying Liu; Xuefeng Wei; Wenguang Zhang; Li Du; Fengyang Wang
Journal:  Front Vet Sci       Date:  2022-02-22
  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.