Literature DB >> 33102592

CDKN2A Polymorphism in Melanoma Patients in Colombian Population: A Case-Control Study.

Jose D Tovar-Parra1, Luz D Gutiérrez-Castañeda1, Sebastián R Gil-Quiñones1, Jhon A Nova1, Leonardo Pulido1.   

Abstract

INTRODUCTION: Melanoma is the most aggressive type of skin cancer, with poor prognosis in advanced stages. The incidence and mortality rates have increased in recent years. Single nucleotide polymorphisms p.R24P, p.M53I, p.G101W, p.V126D, and p.A148T in the CDKN2A (HGNC ID: 1787) gene have been associated with the development of melanoma in different populations; however, this association has not been studied in Colombia.
METHODS: Cutaneous melanoma patients and healthy controls (85 cases and 166 controls) were included in this study. These subjects were screened through HRM-qPCR assay and detected variants in exon 1 and 2 of CDKN2A gene and confirmed with Sanger sequencing. Chi-square test was used to compare allele and genotype distributions between cases and controls. Odds ratio (OR) with 95% confidence interval (CI) was calculated to determine the association between polymorphisms and haplotypes with melanoma susceptibility. Statistical and haplotype analyses were performed using Stata® and R-Studio®.
RESULTS: Fifty-four percent of women were identified both in cases and controls. The frequencies of melanoma subtypes were 36,47% lentigo maligna, 24,71% acral lentiginous, 23,53% superficial extension, and 15,29% nodular. Variants in the CDKN2A gene were 11.76% in cases and 8.43% in controls. The most frequent was p.A148T in 5.88% of cases and in 4.82% of controls. GGTTG haplotype showed statistically significant differences between cases and controls (p value = 0.04).
CONCLUSION: CDKN2A polymorphisms p.G101W, p.R24P, p.M53I, and A148T are not associated with melanoma susceptibility in the Colombian population; further studies regarding genetic interaction and additive effects between more variants are required.
Copyright © 2020 Jose D. Tovar-Parra et al.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33102592      PMCID: PMC7576359          DOI: 10.1155/2020/7458917

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Melanoma is the most aggressive type of skin cancer and has a poor prognosis in advanced stages [1]. The incidence and mortality rate has increased in recent years, with 26% in the mortality rates as reported by Globocan [2, 3]. The etiology of melanoma is driven by the interaction between environmental factors (UV radiation) [4]; phenotypic features (red or blond hair, blue or green eyes, light skin phototypes, freckles, multiple melanocytic nevi, and the presence of nevus clinically atypical) [5]; and genotypic features such as mutations, single nucleotide polymorphisms (SNPs), and family history of melanoma [6]. SNPs have been used as markers to identify genetic susceptibility to develop any disease [7]. Currently, more than 280 genes and approximately 1,140 polymorphisms or variants related to the development of melanoma have been described in individuals of different populations [8]. The relation between the development of melanoma and the presence of certain variants depends on the population analyzed. It has been shown that the presence of variants in certain genes leads to the development of melanoma. CDKN2A gene is one of the most frequent tumor suppressors genes altered between 50 and 80% of melanomas [9]; it encodes p16 and p14ARF proteins, which act as negative regulators in the transition of the G1/S and G2 phase of the cell cycle [10]. SNPs in this gene have been associated with melanoma susceptibility [7, 9–11]. Germline mutations frequencies vary across populations between 5 and 72% [12]. For the familiar melanoma CDKN2A gene, 22 variants have been described, 8 of these as likely pathogenic and 10 as uncertain significance [13]. Computational analysis and laboratory data coincide that the p.A148T variant is a low risk one, while variants such as p.R24P, p.M53I, p.G101W, and p.V126D are considered as pathogenic. The presence of the variants p.G101W, p.R24P, p.M53I, and p.A148T affects the function of the CDKN2A gene, causing the loss of interaction of p16 or p14 with client proteins such as CDK4 and CDK6. p.M53I and p.R24P variants decrease protein binding to CDK4, while the p.G101W variant decreases protein binding to CDK4 and CDK6. Also, p.M53I and p.V126D variants interaction with CDK6 is still unknown [13-16]. These variants have been associated with the development of melanoma in different populations like in Australian, Italian, Spanish, North American, English, Polish, and French [17-21]. As the aforementioned polymorphisms are associated with the risk of melanoma, the objective of this study is to identify the association between CDKN2A variants and the susceptibility to melanoma development in the Colombian population, by means of case-control design.

2. Materials and Methods

2.1. Study Design and Patients

An analytical, observational, case-control study was performed in Hospital Universitario Centro Dermatologico Federico Lleras Acosta E.S.E in Bogotá D.C, Colombia, during the years 2018-2019. Eighty-five cases with a biopsy-confirmed diagnosis of cutaneous melanoma and 170 healthy controls (matched 1 : 2 by age, sex, and Fitzpatrick Skin Phototypes) with no prior personal or familial history of melanoma were identified. Four control samples were excluded due to poor quality. Potential controls with any suspicious pigmented skin lesion were not included. The study protocol was approved by the Research Ethics Committee of the University Hospital-CDFLLA and follows international research standards of the declaration of Helsinki. Each patient signed an informed consent form for the use of their clinical information and molecular analysis from blood samples.

2.2. DNA Preparation and Mutation Screening

Genomic DNA was extracted from total blood using a QIAamp® DNA Mini, and Blood Mini Handbook kit (cat. #69506 Qiagen, Hilden, Germany) was used according to the manufacturer's protocol. DNA was eluted in nuclease-free water (cat. #7732-18-5 Amresco); then, it was quantified by the use of NanoDrop® (Thermo Fisher Scientific). To detect variants, we amplified exon 1 and 2 of the CDKN2A gene by PCR in at least 2 separate preparations of genomic DNA. The primers sequences were used as shown in Table 1. PCR conditions were as follows: initial denaturation for 3 min at 95°C; 40 cycles of denaturation for 30 sec at 95°C, hybridization for 30 sec (between 53°C and 65°C depending on the exon), and 30 sec extension at 72°C; and a final extension for 3 min at 72°C. The PCR products were purified using a QIAquick PCR purification kit (cat. #28104 Qiagen®). Sequencing was performed with the Sanger method using a BigDye Terminator V1.1 Cycle Sequencing Kit and an ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems ®). Sequence analysis was performed using Chromas (free version) and NovoSNP version 3.0 (free version from the internet, http://www.molgen.ua.ac.be/bioinfo/novosnp/index.html) software. All sequences were confirmed by a second reviewer.

2.3. Melting Curve Acquisition and Analysis

All CDKN2A primers are listed in Table 1. Calibration of CFX96 Touch tm Real-Time PCR (BIO-RAD) equipment was done with Melt Calibration Kit (cat. # 184-5020 BIO-RAD) according to the manufacturer's protocol. The samples were processed with Precision Melt Supermix (cat. #172-5112 BIO-RAD). Each reaction mix contained 4 μl DNA (10 ng/μl), hot-start iTaqTM DNA polymerase, dNTPs, MgCl2, and EvaGreen. The Real-Time PCR (qPCR) conditions were as follows: initial denaturation for 2 min at 95°C; 45 cycles of denaturation for 10 sec at 95°C, annealing for 30 sec (between 53°C and 65°C depending on the exon), and 30 sec extension at 72°C. The High-Resolution Melting Analysis (HRM) was immediately performed from heteroduplex formation 30 sec at 95°C, 1 min at 60°C, and High-Resolution Melting cycle 10 sec/step at 65-95°C with 0.2°C increments. The differences between normalized melting curves of cases and controls and wild-type sequence control curves were determined by comparison using the Precision Melt Analysis™ v1.1 Software Upgrade, and samples were assigned to different groups according to the positive and negative controls. DNA samples from 10 patients were sequenced randomly for each amplificated in order to be used as a control in HRM-qPCR genotyping. From the sequencing results, the samples presenting the variants (p.R24P, p.M53I, p.G101W, p.V126D, and p.A148T) were taken as positive controls, the rest of the samples as negative controls (Figure 1).
Figure 1

Exon 2 of CDKN2A gene. Left side: HRM curves with the mutations c.442G>A-p.A148T (rs3731249) in normalized and temp-shift melting curve and difference plot. Right side: chromatograms for negative control (WT DNA) and positive case (heterozygous).

2.4. Statistical Analysis

Statistical analysis was performed using a licensed version of Stata 16®. The normal distribution of variables was determined for both groups using Shapiro-Wilk test. Genotyping results were compiled, and genotype, allele, and haplotype frequencies were calculated manually in Microsoft Excel®. Hardy Weinberg Equilibrium for the control group was determined by Chi-square test (χ2). Genotype and Allele distribution of p.R24P, p.M53I, p.G101W, p.V126D, and p.A148T were compared using a χ2 test. Odds ratio (OR) with a 95% confidence interval (CI) was used to determine genetic association. Statistical significance was defined as p value < 0.05. R-Studio was used to confirm Haplotypes, with the Haplo.Stats package version 1.7.7 (Haplotype Score Tests or Regression Models).

3. Results

Eighty-five cases and 166 controls were included; the mean age was 59, 41 ± 15.6 years for cases and 57, 91 ± 14.92 for controls. Women accounted for 54,12% in cases and 53,61% in controls. 81.18% of cases and 91.57% of controls were born in the central region of Colombia (Cundinamarca). According to the phenotypic and clinical characteristics, both cases and controls suit in the phototypes 2 (19%), 3 (70%), and 4 (11%). There were fair-haired and fair-eyed patients in the group of cases, but the dark features were the most prevalent in both groups (Table 2). History of familial melanoma was seen in 8,24% of cases and 1,2% in controls (1,2%). In terms of the number of nevus, no control displayed more than 100; however, 3,52% was reported in cases. On the other hand, controls displayed a count of 50-100 nevus in a 3,01% proportion, compared with a 12,94% in cases.
Table 2

The demographic and clinical characteristics of melanoma cases and controls.

FeatureCasesControls
n = 85 n = 166
N % N %
Age
 Mean59,41 (24-92)±15.657,91 (20-88)±14.92
Sex
 Women4654,12%8953,61%
 Men3945,88%7746,39%
Melanoma subtype
 Superficial spread2023,53%
 Nodular1315,29%
 Acral lentiginous2124,71%
 Lentigo maligna3136,47%
Variant
p.R24P
 Presence33,52%42,40%
 Absence8293,78%16297,60%
p.M53i
 Presence0000
 Absence85100%166100%
p.G101W
 Presence22,35%00
 Absence8397,65%166100%
p.V126D
 Presence22,35%21,20%
 Absence8397,65%16498,80%
p.A148T
 Presence55,88%84,82%
 Absence8094,12%15895,18%
Clark level
 Negative3338,82%
 I22,355
 II89,41%
 III22,35%
 IV3541,18%
 V55,88%
Breslow scale
 Nonreported3237,65%
 ≤1,0 mm1112,94%
 >1,0-2,0 mm910,59%
 >2,0-4,0 mm1214,12%
 >4,0 mm2124,71%
Mitoses
 Nonreported3237,65%
 Negative910,59%
 ≤1,0 mm21720%
 >1,0 mm22731,76%
Ulceration
 Nonreported3237,65%
 Presence1821,18%
 Absence3541,18%
Location
 Trunk1214,12%
 Head and neck3743,53%
 Upper extremities55,88%
 Lower extremities910,59%
 Hands and feet2124,70%
Phototype
 21618,82%3118,79%
 35969,41%11770,91%
 41011,76%1710,30%
Eye color
 Black or dark brown4451,76%12374,10%
 Light brown3035,29%2716,27%
 Green910,59%95,42%
 Blue22,35%74,22%
Hair color
 Black or dark brown5564,71%13681,93%
 Light brown2934,122816,87%
 Red or blond11,18%21,20%
Personal history of cancer
 Yes33,52%95,42%
 No8296,48%15794,58%
Family history of cancer
 Yes4856,47%7846,99%
 No3743,53%8853,01%
Personal history of melanoma
 Si67,05%0
 No7992,95%166100%
Family history of melanoma
 Si78,24%21,20%
 No7891,76%16498,80%
Nevus
 ≤507183,53%16196,99%
 50-1001112,94%53,01%
 >10033,53%00%
In the cases (n = 85), melanoma subtypes were displayed as following: 36,47% (n = 31) lentigo maligna melanoma (LMM), 23,53% (n = 20) superficial spreading melanoma (SSM), 24,71% (n = 21) acral lentiginous melanoma (ALM), and 15,29% (n = 13) nodular melanoma (NM). Pathologic studies revealed a Clark level of IV in 41,18% of the cases and a Breslow thickness >1 in 24,71%. Mitoses were present in 51,76% and ulceration in 21,18% of the patients (Table 2).

3.1. CDKN2A Variant Analysis

Frequencies of CDKN2A variants found between cases and controls were 11.76% and 8.43%, respectively. Frequencies of variants are shown as following: p.R24P (3,52% vs. 2,40%), p.M53I (0% vs. 0%), p.G101W (2,35% vs. 0%), p.V126D (2,35% vs. 4,82%) and p.A148T (5,88% vs. 4,82%) in cases and controls, respectively. According to the genotype, all variants were heterozygous, and there was no association between the analyzed variants and the risk of developing the melanoma (Table 3).
Table 3

Genotype and allele distributions of variants CDKN2A gene in cases and controls groups.

Genotype/alleleCases n = 85 (%)Control n = 166 (%) χ 2 p valueOR (95% CI)
p.R24P
 G/G82 (96.47%)162 (97.59%)0.2600.6101.48 (0.32-6.77)
 G/C3 (3.53%)4 (2.41%)
 G1673280.2560.6131.47 (0.32-6.65)
 C34
p.M53I
 G/G85 (100%)166 (100%)0.1150.7351,94 (0.03-99.00)
 G/C00
 G1703320.1150.7351.94 (0.03-98.57)
 C00
p.G101W
 G/G83 (97.65%)166 (100%)3.2940.0709.97 (0.47-210.05)
 G/T2 (2.35%)0
 G1683323.2800.0709.85 (0.47-206.38)
 T20
p.V126D
 T/T83 (97.65%)164 (98.80%)0.4730.4921.97 (0.27-14.27)
 T/A2 (2.35%)2 (1.20%)
 A220.4690.4941.96 (0.27-14.06)
 T168330
p.A148T
 G/G80 (94.12%)158 (95.18%)0.1290.7191.23 (0.39-3.89)
 G/A5 (5.88%)8 (4.82%)
 G1653240.1260.7231.22 (0.39-3.81)
 A58
Overall, 26 variants were identified in total, 10 cases had 12 variants distributed as follows: 3 variants were p.R24P, 2 were p.G101W, 2 were p.V126D, and 5 were p.A148T. Two cases present 2 variants simultaneously. According to the subtype melanoma, 4/10 were SSM, 3/10 ALM, 2/10 LMM, and 1/10 NM. According to the phototypes, 1/10 were phototype 2, 7/10 phototype 3, and 2/10 phototype 4. Ten percent of the cases had European ancestry (most frequently German Ancestry), and 80% had a familiar history of cancer. While 14 controls had 14 variants distributed as follows: 4 variants were p.R24P, 2 p.V126D, and 8 p.A148T.

3.2. CDKN2A Haplotype Frequencies

We estimated the haplotype frequencies in melanoma patients and healthy controls (Table 4). This analysis shows that haplotypes (1 and 4) were the most common in both the melanoma patients haplotype 1 freq: 0.94, and haplotype 4 freq: 0.023 and the healthy controls haplotype 1 freq: 0.95 and haplotype 4 freq 0.024. According to this result, it is shown that both groups have similar frequencies. However, we confirmed that there are differences between cases and controls in three haplotypes (5, 6, and 7). The frequencies were as follows: haplotype 5 = 0.00584, haplotype 6 = 0.00573, and haplotype 7= 0.01176 (Table 4).
Table 4

Haplotype effect model: additive.

Global score statistics
Global − stat = 8.91587, df = 6, p value = 0.17836
Haplotype-specific scores
#R24PM53IG101WV126DA148THap-FreqHap-Freq caseHap-Freq control p value
1G/GG/GG/GT/TG/G0.951860.940990.957830.37088
2G/CG/GG/GT/TG/G0.010290.006070.012050.57164
3G/GG/GG/GT/AG/G0.006040.005920.006020.99435
4G/GG/GG/GT/TG/A0.024170.023680.024100.98849
5G/CG/GG/GT/AG/G0.001930.00584NA0.15458
6G/CG/GG/GT/TG/A0.001730.00573NA0.13008
7G/GG/GG/TT/TG/G0.003980.01176NA0.04723∗
Finally, we found that the haplotype 7 (GGTTG) had significant differences between case and control groups (p value = 0.04). Also, we found similar p values when we estimated the association between sex and the presence of this haplotype (p value = 0,04).

4. Discussion

The incidence of cutaneous melanoma (CM) has increased in recent decades [22]. However, it varies according to ethnic group and geographic location, with a clear predilection in countries with a predominantly light-skinned population such as the United States, which report an incidence of 19,7/100.000 inhabitants according to the “SEER” database of the National Cancer Institute [23]. Other populations such as European report incidences of 9,9-14,6/100.000 cases per year [22, 23]. Less frequently, non-Caucasian populations such as South America, Central America, The Pacific, Africa, and Asia show incidences of less than 4/100.000 inhabitants per year [2, 23]. However, the incidence in the Colombian population has increased in recent years. For this reason, it is important to know about the variant that generates susceptibility or risk for the development of melanoma in the Colombian population. In our study, we analyzed 85 melanoma patients and 166 healthy control. Controls were chosen based on the paring of age, sex, and phototype with cases. Regarding the age, the average in the case and control groups was 59.41 and 57.91, respectively. These data are in accordance with the presentation age of disease in other populations, which are found between 55 and 65 years [24]. The analyzed population in this research resides in a mountainous Colombian region (Andean Mountain areas), which is located over 2600 m above sea level and where UV radiation indexes are higher than 10 throughout the year. Solar exposition is one of the risk factors related to the development of specific subtypes of melanoma [25]. However, melanoma incidence is lower than in other regions of the world [2]. Like many other countries in Latin America, Colombia is marked by ancestral diversity as a result of the mixture [26] of three major ethnic groups: Amerindians (descendants of indigenous people), European immigrants (mostly Spanish), and Africans [27]. This may be one of the reasons behind the dissimilar epidemiological pattern shown in our study, in which LMM and ALM were the most common cutaneous melanoma subtypes, comprising 36,46% and 24,71%, respectively. These data are in concordance with data of a different patient cohort previously studied in the same geographical region and with data reported in a different geographical region of Colombia (1285 m above sea level) [28]. Contrary to what was reported by Pozzobon et al., in which predominate SSM (42,7%), LMM (33,7%), and ALM (18.3%) subtypes [29]. On the other hand, worldwide the most frequencies subtypes of melanoma are SSM between 50 and 70% followed by NM [29, 30]. Although the presentation pattern in our study was different from the one reported worldwide, within the clinical-pathological characteristics of our study, 47.06% presented a Clark level ≥ III and 38.83% a Breslow index ≥2.0 mm, 21.18% had ulcer lesion, and 43,53% tumor was located on the head and neck. This is the first study in the Colombian population that sought to determine the frequencies of the polymorphic variants of the CDKN2A gene and their implication in the susceptibility of melanoma. Some studies have reported frequencies of some variants in this gene, such as Brazilian, Uruguayan, and other populations [18, 19, 31, 32]. Approximately 20-40% of melanomas occur in patients with a family history of melanoma [12, 33], and 45% of these are the due inheritance of a mutation or a predisposition gene [34]. Within familial melanoma syndromes, germline mutations of CKDN2A and CDK4 genes remain the most common [34]. In this study, we found that 8.42% had a family history of melanoma and 7,05% of melanoma patients had recurrence. Ten percent out of patients with variants had present European ancestry. These data are similar as the one reported by Borges et al. in the Uruguay population, who described the presence of the p.G101W variant in 3/6 Uruguayan families, which were associated with familial melanoma, and these families presented ancestors of southern Europe (Italy) [31]. On the other hand, a study carried out with 127 patients and 128 controls in the south of Brazil found the relation between the presence of the p.A148T variant and the development of melanoma (12,6% vs. 3,9% controls). Patients with the variant reported European ancestry (Germany) [32]. In this study, we genotyped 5 CDKN2A variants which have been identified as pathological: p.R24P, p.M53I, p.G101W, p.V126D, and p.A148T. Ten cases and 14 controls presented these variants, and 2 cases presented two variants simultaneously. Ten percent of the cases presented European ancestry (Germany), concordant with other variants in the CDKN2A gene in other Latin American populations such as Uruguay (p.G101W) [31], Brazil (p.A148T) [32], and Chile (p. M53I) [12]. Otherwise, we did not find associations between variants and the development of melanoma. The haplotype analysis was performed including all variants; our analysis yielded a statistically significant value for GGTTG haplotype segregation (p = 0.047). However, this haplotype has not been previously analyzed in another population. In both cases and controls, we detected the p.R24P variant, which was previously identified in the Australian and British population [19, 35]. We did not identify the p.M53I variant, but it has been reported in the Chilean population [12]. Contrary to this, we detected the p.G101W variant in two cases, which has been previously reported in the Austrian [36], Uruguayan [31], Ligurian [37], French [19], Australian, Spanish, and British population [21, 38]. p.V126D variant has been previously detected in North American patients with familiar history of melanoma; however, in this study, the variant was detected in patients and healthy controls without familiar history of melanoma [39]. Similarly, the p.A148T variant was detected in patients and controls; this variant has been reported in the different population as Brazilian [40], Australian [18], Israeli [41], and Greek [5]. Alanine by threonine, substitution (p.A148T) has been considered one of the most common variants in cutaneous melanoma and has been identified in familial melanoma cases. A study performed in Polish population with 471 cases, and 1271 controls identified an increased risk (OR 3.5) for patients diagnosed under 50 years; thus, this variant has been shown to increase susceptibility to melanoma [42]. Although, different reports indicate that the p.A148T variant does not alter protein function; other studies show that the p.A148T is in strong linkage disequilibrium with a change in the promoter region at the c.-493 position, which reduces its expression and affects the p16 protein function [1, 42]. p.A148T significance is controversial, since several studies have not shown evidence in its role as a melanoma susceptibility allele, but others have [43-45]. The p.V126D variant was detected both in cases and controls, this variant has been found in populations as Italian, French, North American, and Swiss as a high-risk variant for melanoma [46]. The presence of this variant among cases and controls in our population may be due to admixture between Native Americans, European, and Africans [47]. The p.G101W variant was detected only in cases but not in controls, which correlates with previously reported populations from Argentina, Uruguay, Brazil, Spain, Italy, and France at different frequencies [12]. These data are like to findings in this study regarding the p.R24P variant. According to reports in other studies with Austrian population, this variant has been considered as a pathogenic variant such as p.G101W and p.V126D, conversely p.A148T as benign variant [36]. We found that the prevalence of pathogenic variants in CDKN2A was 5,88% for cases without a family history of CM, but other studies have reported a prevalence of approximately 1% [21]. Our results showed the frequencies of the CDKN2A variants in the Colombian population are consistent with data reported in other populations. As the possibility of biological bias exists in the present study, it is likely that our differences are merely ethnical, environmental, or due to modifying genetic variants that may interact with the polymorphisms studied. Further studies regarding Latin American populations are indispensable in order to establish more precise associations between genetic polymorphisms and susceptibility to melanoma.

5. Conclusion

In conclusion, the variants analyzed in this study allowed us to elucidate the frequencies between both melanoma patients and healthy people. p.G101W variant was only displayed in melanoma patients, and the haplotype analysis revealed the significance of this variant in genetic segregation. Additionally, the most frequent variant in cases and controls was the p.A148T variant with 5.88% and 4.82%, respectively. Variant p.M53I was not found neither in cases nor in controls. To avoid biases related to this type of analysis, matching by sex, age, and phototype was performed. This allowed us to generate knowledge at a national level of the behaviour of the variants in the Colombian population.
(a)
Conventional PCR
ExonPrimers 5′-3′Product size (pb)Melting temp. (°C)Nucleotide sequence 5′-3′
1F39961.0CTGCAAACTTCGTCCTCCAGA
RCCCTTGCCTGGAAAGATACC
2F47961.0GGTGAGGGGGCTCTACACAA
RGGTCTCCCGGGCTGAACTTT
(b)
HRM–qPCR assay
RSSNPProtein changePrimers 5′-3′Product size (pb)Melting temp. (°C)Nucleotide sequence 5′-3′
rs104894097c.71G>Cp.R24PF7963.3CCGCCTCCAGCAGCG
RATGGAGCCTTCGGCTGACT
rs104894095c.159G>Cp.M53IF12159.0GGGCTCTACACAAGCTTCCTT
RGTGGAGCAGCAGCAGCT
rs104894094c.301G>Tp.G101WF9961.0GAGGGCTTCCTGGACACG
RCTCCTCAGCCAGGTCCAC
rs104894098c.377T>Ap.V126DF8861.0CGTGGACCTGGCTGAGGA
RGGCATGGTTACTGCCTCTGG
rs3731249c.442G>Ap.A148TF10061.0GGGCACCAGAGGCAGTAAC
RGCTTTGGAAGCTCTCAGGGTA
  42 in total

1.  Characterization of melanoma susceptibility genes in high-risk patients from Central Italy.

Authors:  Cristina Pellegrini; Maria Giovanna Maturo; Claudia Martorelli; Mariano Suppa; Ambra Antonini; Dimitra Kostaki; Lucilla Verna; Maria Teresa Landi; Ketty Peris; Maria Concetta Fargnoli
Journal:  Melanoma Res       Date:  2017-06       Impact factor: 3.599

2.  CDKN2A germline mutations in individuals with cutaneous malignant melanoma.

Authors:  Irene Orlow; Colin B Begg; Javier Cotignola; Pampa Roy; Amanda J Hummer; Brian A Clas; Urvi Mujumdar; Rebecca Canchola; Bruce K Armstrong; Anne Kricker; Loraine D Marrett; Robert C Millikan; Stephen B Gruber; Hoda Anton-Culver; Roberto Zanetti; Richard P Gallagher; Terence Dwyer; Timothy R Rebbeck; Peter A Kanetsky; Homer Wilcox; Klaus Busam; Lynn From; Marianne Berwick
Journal:  J Invest Dermatol       Date:  2007-01-11       Impact factor: 8.551

3.  Association of Phenotypic Characteristics and UV Radiation Exposure With Risk of Melanoma on Different Body Sites.

Authors:  Reza Ghiasvand; Trude E Robsahm; Adele C Green; Corina S Rueegg; Elisabete Weiderpass; Eiliv Lund; Marit B Veierød
Journal:  JAMA Dermatol       Date:  2019-01-01       Impact factor: 10.282

4.  CDKN2A common variants and their association with melanoma risk: a population-based study.

Authors:  Tadeusz Debniak; Rodney J Scott; Tomasz Huzarski; Tomasz Byrski; Andrzej Rozmiarek; Bogusław Debniak; Elzbieta Załuga; Romuald Maleszka; Józef Kładny; Bohdan Górski; Cezary Cybulski; Jacek Gronwald; Grzegorz Kurzawski; Jan Lubinski
Journal:  Cancer Res       Date:  2005-02-01       Impact factor: 12.701

5.  Early onset may predict G101W CDKN2A founder mutation carrier status in Ligurian melanoma patients.

Authors:  Michela Mantelli; Lorenza Pastorino; Paola Ghiorzo; Monica Barile; William Bruno; Sara Gargiulo; Maria Pia Sormani; Sara Gliori; Stefania Vecchio; Paola Ciotti; Mario Roberto Sertoli; Paola Queirolo; Alisa M Goldstein; Giovanna Bianchi-Scarrà
Journal:  Melanoma Res       Date:  2004-12       Impact factor: 3.599

6.  Epidemiological profile of primary cutaneous melanoma over a 15-year period at a private skin cancer center in Colombia.

Authors:  Flavia C Pozzobon; Alvaro Enrique Acosta
Journal:  Rev Salud Publica (Bogota)       Date:  2018 Mar-Apr

7.  Characterization of individuals at high risk of developing melanoma in Latin America: bases for genetic counseling in melanoma.

Authors:  Susana Puig; Miriam Potrony; Francisco Cuellar; Joan Anton Puig-Butille; Cristina Carrera; Paula Aguilera; Eduardo Nagore; Zaida Garcia-Casado; Celia Requena; Rajiv Kumar; Gilles Landman; Bianca Costa Soares de Sá; Gisele Gargantini Rezze; Luciana Facure; Alexandre Leon Ribeiro de Avila; Maria Isabel Achatz; Dirce Maria Carraro; João Pedreira Duprat Neto; Thais C Grazziotin; Renan R Bonamigo; Maria Carolina W Rey; Claudia Balestrini; Enrique Morales; Montserrat Molgo; Renato Marchiori Bakos; Patricia Ashton-Prolla; Roberto Giugliani; Alejandra Larre Borges; Virginia Barquet; Javiera Pérez; Miguel Martínez; Horacio Cabo; Emilia Cohen Sabban; Clara Latorre; Blanca Carlos-Ortega; Julio C Salas-Alanis; Roger Gonzalez; Zulema Olazaran; Josep Malvehy; Celia Badenas
Journal:  Genet Med       Date:  2015-12-17       Impact factor: 8.822

8.  Socioeconomic Status Is Not Related with Facial Fluctuating Asymmetry: Evidence from Latin-American Populations.

Authors:  Mirsha Quinto-Sánchez; Celia Cintas; Caio Cesar Silva de Cerqueira; Virginia Ramallo; Victor Acuña-Alonzo; Kaustubh Adhikari; Lucía Castillo; Jorge Gomez-Valdés; Paola Everardo; Francisco De Avila; Tábita Hünemeier; Claudia Jaramillo; Williams Arias; Macarena Fuentes; Carla Gallo; Giovani Poletti; Lavinia Schuler-Faccini; Maria Cátira Bortolini; Samuel Canizales-Quinteros; Francisco Rothhammer; Gabriel Bedoya; Javier Rosique; Andrés Ruiz-Linares; Rolando González-José
Journal:  PLoS One       Date:  2017-01-06       Impact factor: 3.240

9.  Genes involved in cell cycle G1 checkpoint control are frequently mutated in human melanoma metastases.

Authors:  A Platz; P Sevigny; T Norberg; P Ring; B Lagerlöf; U Ringborg
Journal:  Br J Cancer       Date:  1996-09       Impact factor: 7.640

10.  CDKN2A/CDK4 Status in Greek Patients with Familial Melanoma and Association with Clinico-epidemiological Parameters.

Authors:  Fani Karagianni; Ching-Ni Njauw; Katerina P Kypreou; Aravela Stergiopoulou; Michaela Plaka; Dorothea Polydorou; Vasiliki Chasapi; Leontios Pappas; Ioannis A Stratigos; Gregory Champsas; Peter Panagiotou; Helen Gogas; Evangelos Evangelou; Hensin Tsao; Alexander J Stratigos; Irene Stefanaki
Journal:  Acta Derm Venereol       Date:  2018-10-10       Impact factor: 4.437

View more
  1 in total

1.  3'UTR-CDKN2A and CDK4 Germline Variants Are Associated With Susceptibility to Cutaneous Melanoma.

Authors:  David Tovar-Parra; Sebastián Ramiro Gil-Quiñones; John Nova; Luz D Gutiérrez-Castañeda
Journal:  In Vivo       Date:  2021 May-Jun       Impact factor: 2.155

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.