Synergistic apoptotic effects in cancer cells by the combination of CLK and Bcl-2 family inhibitors.

Emerging evidence indicates that alternative splicing plays a critical role in cancer progression through abnormal expression or mutation of splicing factors. Small-molecule splicing modulators have recently attracted considerable attention as a novel class of cancer therapeutics. CDC-like kinases (CLKs) are central to exon recognition in mRNA splicing and CLK inhibitors exhibit anti-tumour activities. Most importantly, molecular mechanism-based combination strategies for cancer therapy must be considered. However, it remains unclear whether CLK inhibitors modulate expression and splicing of apoptosis-related genes, and whether CLK inhibitors enhance cytotoxicity in combination with apoptosis inducers. Here we report an appropriate mechanism-based drug combination approach. Unexpectedly, we found that the CLK inhibitor T3 rapidly induced apoptosis in A2780 cells and G2/M cell cycle arrest in HCT116 cells. Regardless of the different phenotypes of the two cancer cell types, T3 decreased the levels of anti-apoptotic proteins (cIAP1, cIAP2, XIAP, cFLIP and Mcl-1) for a short period of exposure and altered the splicing of the anti-apoptotic MCL1L and CFLAR isoform in A2780 and HCT116 cells. In contrast, other members of the Bcl-2 family (i.e., Bcl-xL and Bcl-2) were resistant to T3-induced expression and splicing modulation. T3 and a Bcl-xL/Bcl-2 inhibitor synergistically induced apoptosis. Taken together, the use of a CLK inhibitor is a novel therapeutic approach to sensitise cancer cells to Bcl-xL/Bcl-2 inhibitors.

Introduction

Alternative pre-mRNA splicing is a fundamental mechanism that generates multiple mRNAs from a single gene via a mechanism that is tightly regulated to generate proteomic diversity sufficient to maintain physiological homeostasis and processes [1-4]. Dysregulation of alternative splicing leads to the generation of aberrant protein isoforms that contribute to various diseases, including neurodegenerative diseases, muscular dystrophies and various cancers [5]. Especially, specific aberrant splicing of various transcripts, such as Bcl-xL, Cyclin D1, CD44, and VEGF, is known to promote tumour survival and growth, as well as resistance to apoptosis as a consequence of the abnormal expression or mutation of splicing factors [6-10]. Recent whole genome and RNA sequence analyses across multiple haematologic and solid tumour types have identified mutually exclusive somatic mutations that affect key components of the splicing machinery, such as SF3B1, U2AF1, SRSF2 and U2AF35 [8-10].

Compounds targeting the spliceosome machinery have been identified as potential targets in cancer therapy. H3B-8800 is an orally administered modulator of the SF3b complex that has potent anti-tumour activity against spliceosome-mutant tumour cells [11]. In addition, the oncogenic roles of CDC-like kinases (CLKs) have been identified in cancers of the breast and kidney [12,13]. CLK inhibitors also have anti-tumour activities that occur through the modulation of factors involved in cancer-associated splicing that are aberrantly expressed by cancer cells [14,15]. T3 is highly selective to CLKs and the potent small molecule compounds using kinase panel and comprehensive RNA-seq analysis between silencing of CLKs and T3 treatment [15].

The results of some clinical trials have shown that various splicing modulators have potential value as a novel class of anti-tumour agents. It is crucial to consider the molecular mechanisms underlying therapeutic strategies for cancer treatment. Especially, the use of a combination of cancer drugs is particularly beneficial due to the utilisation of a mechanism-based approach, since the efficacy of a single anticancer agent is currently limited.

The SF3B1 inhibitor E7107 in combination with Bcl-xL/Bcl-2 inhibitors enhances cytotoxicity to cancer cells based on the evidence that E7107 alters splicing of MCL1, but not that of BCL2L1 [16]. Furthermore, silencing of the splicing factor SF3B1 or SRSF1 has been shown to induce splicing alteration of MCL1, which subsequently reduces Mcl-1L protein expression by chronic lymphocytic leukaemia cells [17-19]. Although recent evidence suggests that Myc-amplified cancer cells are sensitive to the CLK inhibitor T-025 [20], little is known about whether CLK inhibitors are involved in the expression and splicing modulation of apoptosis-related genes to inhibit cell growth and induce apoptosis.

The results of the present study clarified that the CLK inhibitor T3 led to decreased levels of anti-apoptotic proteins, IAP family (cIAP1, cIAP2, XIAP), cFLIP, and Mcl-1for a short period of exposure, while Bcl-xL and Bcl-2 proteins were resistant. T3 altered the splicing of anti-apoptotic MCL1L and CFLAR isoform, while BCL2L1 and BCL2 were resistant to T3-induced splicing modulation. Thus, the combination of Bcl-xL/Bcl-2 inhibitors and T3 enhanced apoptosis of cancer cells. These data suggest that the splicing modulator T3 in combination with Bcl-xL/Bcl-2 inhibitors may be valuable to induce synergistic apoptosis as a novel cancer therapeutic strategy.

Materials and methods

Cell culture

Human colorectal cancer HCT116 cells and human ovarian cancer A2780 cells were obtained from the American Type Culture Collection (Manassas, VA, USA). HCT116 cells were maintained in McCoy’s 5a growth medium (Thermo Fisher Scientific, Waltham, MA, USA) and A2780 cells were maintained in RPMI-1640 growth medium (Thermo Fisher Scientific). Both media were supplemented with 10% fetal bovine serum (Thermo Fisher Scientific), penicillin (10,000 U/mL; Thermo Fisher Scientific) and streptomycin (10,000 U/mL; Thermo Fisher Scientific). All cells were maintained in a humidified 37°C incubator with 5% CO2 and were routinely tested for the absence of mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).

Compounds

[4-(2-methyl-1-(4-methylpiperazin-1-yl)-1-oxopropan-2-yl)-N-(6-(pyridin-4-yl)imidazo [1,2-a]pyridin-2-yl)benzamide] (T3) was synthesised and purified as described previously [15]. [N-(8-fluoro-6-(pyridin-4-yl)imidazo[1,2-a]pyridin-2-yl)-4-(2-methyl-1-(4- methylpiperazin-1-yl)-1-oxopropan-2-yl)benzamide trihydrochloride] (T3-1) was synthesised and purified as shown in Supporting Information (S1 File). The Bcl-2 family protein inhibitor ABT-263 was purchased from MedChemExpress (HY-10087; Monmouth Junction, NJ, USA). The pan-caspase inhibitor Z-VAD-FMK was purchased from R&D Systems (FMK001; Minneapolis, MN, USA) and used at 25 μM in all the experiments described in the present study.

Cell growth assay

A2780 and HCT116 cells (each 3.0 × 103 per well) were seeded into the wells of 96-well plates and incubated overnight under the conditions described above. The following day, the diluted compounds or dimethyl sulfoxide (DMSO) as a control were added to the culture media. After 72 h of incubation, the cells were assessed using the CellTiter-GloLuminescent Cell Viability Assay (Promega Corporation, Madison, WI, USA), in accordance with the manufacturer’s instructions. The chemiluminescence of each well was measured using an ARVO X3 Microplate Reader (PerkinElmer, Inc., Waltham, MA, USA). GI50 values (the drug concentration that inhibits cell growth by 50%) were calculated according to a sigmoid dose–response curve using GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA).

Time-lapse imaging and analysis

A2780 and HCT116 cells (each, 5.0 × 104 per well) were cultured in the wells of 24-well culture plates and treated with T3 or DMSO. The treated cells were incubated for 3 h at 37°C under an atmosphere of 5% CO2/95% air in a microscope stage-mounted humidified chamber (Incubator XL S1; Carl Zeiss AG, Oberkochen, Germany). Serial phase-contrast images were captured every 10 min using an Axiovert 200M microscope (Carl Zeiss AG) equipped with an EC Plan NeoFluar 20× lens (Carl Zeiss AG) and processed using AxioVision 4.5 software (Carl Zeiss AG), then compiled in JPEG format and exported to Adobe Photoshop for processing.

Cell cycle analysis

A2780 and HCT116 cells (each 2.0 × 105 per well) were cultured in the wells of 6-well plates for specified periods of time, harvested, washed twice with ice-cold phosphate-buffered saline (PBS) and fixed in ice-cold 70% ethanol/30% distilled water (v/v), then washed twice in PBS and resuspended in Guava Cell Cycle reagent (Merck Millipore, Burlington, MA, USA) in accordance with the manufacturer's instructions. The DNA contents were determined using a FACScan™ automated flow cytometer with FlowJo software (BD Biosciences, Franklin Lakes, NJ, USA).

Apoptosis analysis by staining with Annexin V and propidium iodide

A2780 and HCT116 cells (each 2.0 × 105 per well) were seeded into the wells of 6-well plates and incubated overnight with culture medium. The next day, diluted compounds were added to the culture media. At 24–48 h after incubation, the cells were harvested and stained with propidium iodide (PI) and FITC-conjugated Annexin V using the MEBCYTO® Apoptosis Kit (Medical & Biological Laboratories Co., Ltd., Nagoya, Japan) in accordance with the manufacturer's instructions. Annexin V binding and PI staining were analysed using the BD LSRFortessa™ cell analyser with FlowJo software (BD Biosciences).

Caspase assay

A2780 (8.0 × 103 per well) and HCT116 cells (8.0 × 103 per well for 24-h treatment and 2.5 × 103 per well for 48-h treatment) were seeded into the wells 96-well plates and incubated in culture medium. After overnight incubation, diluted compounds were added to the culture media. After 24–48 h of incubation, caspase-3/7 activity was measured using the Caspase-Glo 3/7 Assay System (Promega Corporation) in accordance with the manufacturer's instructions.

Reverse transcriptase polymerase chain reaction (RT-PCR)

Total RNA was extracted using the RNeasy Plus Mini Kit (QIAGEN, Hilden, Germany) in accordance with the manufacturer's instructions. Reverse transcription was performed using the High-Capacity cDNA Reverse Transcription kit and AmpliTaq Gold 360 Master Mix (both were obtained from Thermo Fisher Scientific). The PCR conditions were as follows: MCL1: an initial denaturing step at 95°C for 5 min, followed by 35 cycles at 94°C for 30 s, 70°C for 30 s and 72°C for 45 s, and a final elongation step at 72°C for 10 min; BCL2L1: 95°C for 5 min, 35 cycles at 94°C for 30 s, 67°C for 30 s, 72°C for 45 s and 72°C for 10 min; and ACTB: 95°C for 5 min, 35 cycles at 94°C for 30 s, 60°C for 30 s, 72°C for 1 min and 72°C for 10 min. The following primers were used for amplification (all 5’ to 3’): MCL1-F: CTCGGTACCTTCGGGAGCAGGC; MCL1-R: CCAGCAGCACATTCCTGATGCC; BCL2L1-F: GAGGCAGGCGACGAGTTTGAA; BCL2L1-R: TGGGAGGGTAGAGTGGATGGT; cFLIPS-F: TAAGCTGTCTGTCGGGGACT; cFLIPS-R: ATCAGGACAATGGGCATAGG; cFLIPL-F: GGACCTTGTGGTTGAGTTGG; cFLIPL-R: CATAGCCCAGGGAAGTGAAG; ACTB-F: CCAGCTCACCATGGATGATGATATCG; and ACTB-R: GGAGTTGAAGGTAGTTTCGTGGATGC. The PCR products were separated by capillary electrophoresis and the signal intensity was measured using the LabChip GX Touch Nucleic Acid analyser (PerkinElmer, Inc.).

Immunoblot analysis

Cells were harvested and lysed in Pierce IP Lysis Buffer (Thermo Fisher Scientific) supplemented with Halt Protease Inhibitor Cocktail (Thermo Fisher Scientific). After centrifugation of the lysates, the protein concentrations of the supernatants were determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). The lysates were boiled for 5 min with Sample Buffer Solution with 3-mercapto-1, 2-propanediol (FUJIFILM Wako Pure Chemical Corporation, Tokyo, Japan). The samples were subjected to 5%–20% gradient sodium dodecyl sulphate-polyacrylamide gel electrophoresis. Once separated, the proteins were electrophoretically transferred to polyvinylidene fluoride polymer membranes, which were incubated with primary antibodies against Rictor (#2114), Raptor (#2280), Mcl-1 (#5453), Bcl-xL (#2762), Bcl-2 (#2870), XIAP (#2042), cFLIP (#56343), cIAP1 (#7065), cIAP2 (#3130), AKT (#9272) (Cell Signalling Technology, Danvers, MA, USA) and anti-vinculin (#CP74; Merck Millipore), and then incubated with species-specific HRP-conjugated secondary antibodies. SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) or Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare, Chicago, IL, USA) was used for protein detection and images were captured digitally using the ImageQuant LAS4000 camera system (GE Healthcare).

Statististical analysis

The number of biological replicates and statistical significance are noted in the figures, figure legends, and manuscript. Data are shown as mean ± standard deviation (SD). Statistical analysis and graph generation for cell growth assay and caspase assay were calculated using GraphPad Prism 5 software. Students’s t test was used to determine the statistical significance for the caspase assay. Statistical significance was defined as p < 0.05.

Results

T3 induced apoptosis of A2780 cells and G2/M phase cell cycle arrest in HCT116 cells

Two representative human cancer cell lines (i.e., ovarian carcinoma A2780 and colorectal carcinoma HCT116 cells) were used to investigate the detailed mechanisms underlying the inhibition of cell growth and apoptosis induced by the splicing modulator T3 and its inactive analog T3-1. T3-1, with a fluoro group at 8-position, did not inhibit CLK1 or CLK2 (S1 Fig). The previous docking model of T3 [15], suggests that T3-1 might not be able to bind to the hinge region of CLK2. As shown in Fig 1A, T3 inhibited the growth of both A2780 and HCT116 cells (GI50 = 345 and 122 nM, respectively), but T3-1 did not inhibit cell growth even at 10 μM (S1 Fig). Interestingly, T3 treatment induced apparently different morphological changes to A2780 and HCT116 cells (Fig 1B). A2780 cells began to shrink as early as 16–24 h of T3 treatment, whereas the cytoplasm content of HCT116 cells had increased for approximately 24 h. Cell cycle analysis revealed that T3 induced G2/M phase cell cycle arrest of HCT116 cells and apoptosis of A2780 cells after 16–24 h of treatment (Fig 1C). To examine the mechanism of apoptosis induction in more detail, Annexin V/PI and caspase-3/7 analyses were performed. The percentages of early apoptotic A2780 and HCT116 cells [Annexin V (+), PI (-)] after 24 h of treatment with 3 μM T3 were 29.1% and 3.2% (Fig 1D). After 48 h of treatment, 42.6% of the HCT116 cells were apoptotic. Next, caspase 3/7 activity was measured following T3 treatment. Caspase 3/7 activity was approximately five-fold greater in A2780 cells, as compared to HCT116 cells, which was consistent with the cell cycle and Annexin V data (Fig 1E). Additional treatment with the pan-caspase inhibitor Z-VAD-FMK (carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]- fluoromethylketone) suppressed up-regulation of caspase 3/7, suggesting that T3-induced apoptosis is caspase-dependent (Fig 1E). These results suggest that T3-induced apoptosis of A2780 and HCT116 cells was caspase-dependent and the mechanisms underlying cell growth inhibition and apoptosis induction differed between two types of cells.

Fig 1

T3 inhibits growth of HCT116 and A2780 cells via different mechanisms.

(A) Viabilities of A2780 and HCT116 cells normalized to the DMSO control after 72 h of T3 treatment. The x axis shows the compound concentration (logM). The y axis shows the percent inhibition of adenosine triphosphate contents, as compared to the DMSO control. Data are presented as the mean ± standard deviation (SD) of three independent experiments. (B) Time-lapse microscopic images of A2780 and HCT116 cells treated with DMSO or 1 μM T3 for 6 or 24 h. The yellow arrowheads show shrunken cells in A2780 and enlarged cytoplasm in HCT116 cells after treatment with T3 for 6 h or 24 h. Scale bar = 100 μm. (C) Flow cytometric analysis of the cell cycle distribution of HCT116 and A2780 cells treated with DMSO or 1 μM T3 for 16 and 24 h. Data are representative of two independent experiments. (D) Flow cytometric analysis of apoptosis of A2780 and HCT116 cells stained with Annexin V/PI. Cells were incubated with T3 for 24 h (A2780 and HCT116 cells) or 48 h (HCT116 cells). Apoptosis was analysed by Annexin V/PI staining and flow cytometry. The percentage of cells within each quadrant are indicated. Q1: Annexin V (-)/PI (+), Q2: Annexin V (+)/PI (+), Q3: Annexin V (+)/PI (-) and Q4: Annexin V (-)/PI (-). Data are representative of two independent experiments. (E) Caspase 3/7 activity was measured in the presence or absence of Z-VAD-FMK and is presented as the fold change, as compared to the DMSO control samples. Data are presented at the mean ± SD of three independent experiments. Statistical analyses were performed using an unpaired Student’s t-test (*P < 0.05; **P < 0.01; ***P < 0.001).

T3 repressed anti-apoptotic proteins IAP family proteins, cFLIP, and Mcl-1

Next, A2780 and HCT116 cells were used for examining whether T3 affected the expression of anti-apoptotic molecules. Bcl-2 was specifically expressed in A2780, whereas Bcl-xL and cIAP2 were specifically expressed in HCT116 (Fig 2). Mcl-1L and cFLIPL were highly expressed in A2780 compared with that in HCT116. T3 treatment for 16 h did not affect the protein levels of Bcl-2, Bcl-xL and AKT, but T3 decreased IAP family proteins (cIAP1, cIAP2 and XIAP) and Mcl-1L in a dose-dependent manner. Pro-apoptotic Mcl-1S was slightly expressed in A2780 and HCT116 cells. T3 modestly led to decrease of Mcl-1S, but the decreasing level was not remarkable compared to Mcl-1L. Mcl-1L was completely deleted after treatment with 3 μM T3 in HCT116 cells, whereas Mcl-1S was expressed in the same condition. In addition, T3 repressed two isoforms cFLIPL (55 kDa) and cFLIPS (25 kDa), whereas T3 induced a different size of cFLIPL and cFLIPS (Fig 2), suggesting that T3 altered the splicing of cFLIP. Taken together, these results indicated that T3 caused reduction of the levels of several anti-apoptotic proteins; however, no change was noted in Bcl-xL and Bcl-2 protein levels.

Fig 2

T3-induced reduction of anti-apoptotic proteins expression in A2780 and HCT116 cells.

Immunoblot analyses were performed using protein lysates from A2780 and HCT116 cells treated with T3 for 16 h at the indicated concentrations. The positions of Mcl-1L, Mcl-1S, cFLIPL, and cFLIPS are indicated on the right. Uncropped blot images are shown in S2 File.

T3 induced splicing alterations to the apoptosis-related gene MCL1 and CFLAR

Since each long and short isoform of Mcl-1 and Bcl-X have anti- apoptotic/pro-apoptotic function in cancer cells, A2780 and HCT116 cells were used to determine whether T3 altered splicing to the apoptosis-related MCL1 and BCL2L1 genes. As shown in Fig 3A, the pro-apoptotic MCL1S isoform was dose-dependently induced by T3 treatment for 6 h and 16 h in both cell types, and the anti-apoptotic MCL1L isoform was downregulated by T3. The pro-apoptotic short isoform of BCL2L1 (BCL2L1S) was induced by T3 at concentrations in the range of 0.1–1 μM for 16 h treatment in both cells; however, dose-dependent change was not observed. The “percent spliced in” value for the splicing of the MCL1 and BCl2L1 genes was calculated after T3 treatment. As shown in Fig 3B, T3 altered splicing of the anti-apoptotic isoform MCL1L to the pro-apoptotic isoform MCL1S at 6 and 16 h in a dose-dependent manner, but had no effect on splicing of BCL2L1 in either cell type, regardless of the treatment duration. T3 and Z-VAD-FMK co-treatment induced the MCL1S isoform in both cell types, indicating that the up-regulation of MCL1S was not due to the indirect effect of caspase cleavage. In addition, we examined splicing of CFLAR long and short isoform (CFLAR-L and -S) after treatment with T3, since T3 induced a different size of cFLIPL and cFLIPS proteins as shown in Fig 2. RT-PCR analysis to detect CFLAR-L and CFLAR-S revealed that T3 decreased endogenously expressed CFLAR-L and CFLAR-S at 6 and 16 h in a dose-dependent manner, and T3 alternatively induced multiple smaller size of transcripts of CFLAR-L and CFLAR-S (Fig 4). These results suggest that T3 altered the splicing of MCL1L and CFLAR that has anti-apoptotic functions, but had no effect on splicing of the BCL2L1 gene.

Fig 3

Alteration of MCL1 pre-mRNA splicing induced by T3 in A2780 and HCT116 cells.

(A) Cells were treated with T3 for 6 or 16 h at the indicated concentrations in the presence or absence of Z-VAD-FMK. Expression of MCL1 and BCL2L1 splice isoforms were analysed by RT-PCR, and PCR products were analysed by capillary electrophoresis. The quantitative expression for the long and short forms of MCL1 and BCL2L1, respectively, are shown. ACTB mRNA expression was evaluated as an internal control. Data are representative of three independent experiments. (B) Signal intensity was quantified and the percent spliced in (PSI) values for Mcl-1 and BCL2L1 alternative exons after T3 treatment for 6 or 16 h in the presence or absence of Z-VAD-FMK are shown. Data are presented as the mean ± SD of three independent experiments.

Fig 4

Alteration of CFLAR pre-mRNA splicing induced by T3 in A2780 and HCT116 cells.

Cells were treated with T3 for 6 or 16 h at the indicated concentrations. Expression of CFLAR long and short splice isoforms (CFLAR-L and CFLAR-S) were analysed by RT-PCR, and PCR products were analysed by capillary electrophoresis. Closed triangles indicate the long and short forms of CFLAR-L, respectively. ACTB mRNA expression was evaluated as an internal control. Data are representative of three independent experiments. Raw electropherogram images are shown in the S3 File.

T3 reduced the mammalian target of rapamycin (mTOR) component 2 (mTORC2) pathway

The Mcl-1 protein is stabilised by mTOR and rictor (mTORC2) via proteasomes and the ubiquitin pathway. Hence, inhibition of mTORC2 pathway leads to decreased Mcl-1 protein expression [21]. To examine whether the T3-induced reduction of Mcl-1 protein expression is regulated by splicing alterations or proteasome degradation, we examined mTORC2 pathway and proteasome regulation by treatment with T3. T3 treatment decreased Rictor expression more effectively than Raptor in A2780 and HCT116 cells (Fig 5A). Next, we investigated the possibility for the proteasome degradation with the use of the proteasome inhibitor MG-132. As shown in Fig 5B, MG-132 treatment without T3 induced Mcl-1L, not MCL1-S, protein production via blocking the proteasome pathway, while co-treatment with MG-132 and T3 decreased Mcl-1L and Mcl-1S protein levels in a T3-dose dependent manner. Additionally, MG-132 induced Mcl-1L and slightly induced Mcl-1S protein production even in the presence of 3 μM T3 (Fig 5B). These results imply that T3 degraded Mcl-1 through two independent pathways, splicing alterations of Mcl-1 and the mTORC2 proteasome pathway.

Fig 5

T3-induced reduction of mTORC2 and involvement of proteasome pathway in A2780 and HCT116 cells.

(A) Immunoblot analyses were performed using protein lysates from A2780 and HCT116 cells treated with T3 for 16 h at the indicated concentrations. (B) HCT116 cells were pre-treated with T3 for 16 h at the indicated concentrations and then co-treated with 2.5 or 10 μM of MG132 for 6 h. Data are representative of two independent experiments. (A) (B) Uncropped blot images are shown in S2 File.

T3 in combination with Bcl-2 inhibition synergistically induced apoptosis

Since alternative splicing and protein analysis revealed that T3-induced apoptosis was independent of Bcl-2 and Bcl-xL, the combined effect of T3 and the Bcl-xL/Bcl-2 inhibitor ABT-263 was analysed [22,23]. The results showed that co-treatment with T3 and ABT-263 synergistically induced caspase 3/7 activation in A2780 and HCT116 cells (Fig 6). A synergistic effect was observed even with the combination of low-dose T3 and ABT-263 in A2780 cells, as compared to HCT116 cells. These results are consistent with our previous data from cell cycle and apoptosis induction analyses. In addition, caspase 3/7 activity was up-regulated by approximately six-fold after 16 h of co-treatment with 0.3 μM T3 and ABT-263 in A2780 cells (Fig 6). Single treatment with 0.3 μM T3 induced caspase 3/7 production by approximately three-fold at 16 h and six-fold at 24 h (Figs 1E and 6). Also, in HCT116 cells, caspase 3/7 was up-regulated to a similar level with T3 and ABT-263 co-treatment at 24 h and single T3 treatment at 48 h. T3-1, the inactive analog of T3, did not show synergistic effects with ABT-263 (Fig 6). These results suggest that T3 and ABT-263 co-treatment rapidly induced apoptosis, as compared to T3 treatment alone. Taken together, these results demonstrate that the combination of T3 and the Bcl-xL/Bcl-2 inhibitor promoted the death of cancer cells.

Fig 6

Synergistic effects on apoptosis induction were observed by T3 in combination with Bcl-2 inhibitor in HCT116 and A2780 cells.

HCT116 and A2780 cells were treated with T3 or T3-1 and ABT-263 at the indicated concentrations for 16 h or 24 h, respectively. Caspase 3/7 activities were measured. Combination index (CI) values [24] are shown above the bar. A CI value of < 1 indicates synergism. Data are presented as the mean ± SD of two independent experiments.

Discussion

The use of splicing modulators targeting CLK or SF3b has recently gaining attention as a cancer treatment option since genetic mutations to spliceosome-related genes and splicing dysregulation have been found to inhibit cancer progression. It is of particular importance to clarify the molecular pathways involved in this drug combination strategy. The results of the present study showed that T3 led to decreased levels of several anti-apoptotic proteins for a short period of exposure and altered splicing of Mcl-1 and cFLIP, but not Bcl-xL. Consistent results were obtained from the co-treatment analysis, indicating that the combination of T3 with the Bcl-xL/Bcl-2 inhibitor synergistically induced apoptosis. These data provide convincing evidence that the combination of T3 and the Bcl-xL inhibitor is an appropriate molecular-based combination for cancer treatment. The SF3b inhibitor in combination with Bcl-xL inhibitors also has a synergistic effect [15,25]. The molecular mechanisms underlying splicing alterations presumably differ, although the use of CLK and SF3b inhibitors induced splicing alterations to multiple genes. CLKs recognise exons via phosphorylation of serine/arginine-rich proteins and mainly induces exon skipping [14,15]. On the contrary, SF3b complex inhibitors preferentially induced splicing within the introns [26,27]. It is conceivable that crosstalk between CLK and the SF3b pathway occur in alternative splicing of several genes, including MCL1.

T3 switched from the splicing of MCL1L isoform to MCL1S in mRNA levels. However, T3 reduced Mcl-1S as well as Mcl-1L in protein levels, though decreasing level of Mcl-1S was not significant compared to Mcl-1L. It is conceivable that T3 degrades Mcl-1 proteins including long and short form via mTORC2-proteosome pathway.

Mcl-1 up-regulation is a hallmark of cancers and causes drug resistance to some cancer therapies [28,29]. For instance, treatment of tumours with the multi-tyrosine kinase inhibitor sunitinib enhances the stability of Mcl-1 and induces activation of the mTORC pathway, which leads to sunitinib resistance [28]. Since CLK inhibitor decreases the expression levels of Mcl-1 and S6K [14], CLK inhibitors are viable therapeutic options for the treatment of sunitinib-resistant cancers. The study results also showed that T3 induced apoptosis of A2780 cells and cell cycle arrest at the G2/M phase in HCT116 cells. Mcl-1 is highly expressed in A2780 cells, as compared to that in HCT116 cells. Additionally, the depletion of Mcl-1 induced apoptosis of A2780 cells, whereas apoptosis of HCT116 cells required the depletion of all Bcl-2 family members (i.e., Mcl-1, BCL2 and Bcl-xL) [30,31]. These findings suggest that higher Mcl-1 expression can be induced by the combination treatment with CLK and Bcl-xL/Bcl-2 inhibitors, although further studies with additional cell types are needed to confirm these results.

In addition to Mcl-1, the levels of other members of anti-apoptotic proteins, IAP family proteins (cIAP1, cIAP2 XIAP) and cFLIP were decreased by T3 treatment in both A2780 and HCT116 cells. Gene ontology analysis of T3-responsive comprehensive alternative splicing events revealed that the apoptotic pathways were enriched by 0.05–10 μM of T3 exposure in HCT116 cells [15]. However, the splicing alterations of IAP family were not observed in this RNA-seq data set. It is conceivable that the T3-responsive reductions of IAP family proteins were induced by unknown RNA processing machinery, such as transcriptional control and nuclear-cytoplasmic mRNA transport, and not splicing modification. As shown in Figs 2 and 4, T3 resulted in splicing alterations of CFLAR-L and CFLAR-S, and subsequent reduction of canonical cFLIP-L and cFLIP-S proteins. Spliced isoforms with premature termination codons induced by CLK inhibitor are degraded by stimulation of nonsense-mediated mRNA decay [14,15]. Presumably, T3-induced novel isoform proteins were detected using anti-cFLIP antibody in this study, although further sequence-based analysis is required.

MYC amplification and high CLK2 expression in cancer cells are considered predictive of the response to a CLK inhibitor [20]. Drug combination strategies with CLK and Bcl-xL inhibitors might be effective in combination with these predictive biomarkers. Taken together, the results of this study showed that the reductions of anti-apoptotic proteins and alterations to MCL1 splicing is an important mechanism of CLK-induced cell death and the use of CLK inhibitors in combination with Bcl-xL/Bcl-2 inhibitors presents an option for cancer therapy.

Structures of T3 and T3-1, and cell growth inhibitory activity of T3-1.

(A) Chemical structures of T3 and T3-1. (B) Viabilities of A2780 and HCT116 cells normalized to the DMSO control after 72 h of T3 treatment. The x-axis shows compound concentration (logM). The y-axis shows percent inhibition of adenosine triphosphate content, compared to the DMSO control. Data are presented as mean ± standard deviation (SD) of three independent experiments.

(PDF)

Click here for additional data file.

Synthesis of T3-1.

(PDF)

Click here for additional data file.

Uncropped blot images for Figs 2, 5A and 5B.

(PDF)

Click here for additional data file.

Raw electropherogram images using the capillary electrophoresis LabChip for Fig 4.

(PDF)

Click here for additional data file.

4 Mar 2020

PONE-D-20-00375

Synergistic apoptotic effects in cancer cells by the combination of CLK and Bcl-2 family inhibitors

PLOS ONE

Dear Dr. Araki,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Additional experimental data are required to confirm the hypothesis. The specificity of T3 should be confirmed. More data are required to prove that the phenotypes observed upon treatment are CLK- or mRNA splicing-dependent. Non-cancerous cells should be tested.

We would appreciate receiving your revised manuscript by Apr 18 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Irina V. Lebedeva, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please provide additional information about each of the cell lines used in this work, including any quality control testing procedures (authentication, characterisation, and mycoplasma testing). For more information, please see http://journals.plos.org/plosone/s/submission-guidelines#loc-cell-lines.

3. Thank you for providing the following Funding Statement:

"Takeda Pharmaceutical Company Limited provided support in the form of salaries for authors but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.".

We note that one or more of the authors is affiliated with the funding organization, indicating the funder may have had some role in the design, data collection, analysis or preparation of your manuscript for publication; in other words, the funder played an indirect role through the participation of the co-authors.

* If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study in the Author Contributions section of the online submission form. Please make any necessary amendments directly within this section of the online submission form.  Please also update your Funding Statement to include the following statement: “The funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.”

If the funding organization did have an additional role, please state and explain that role within your Funding Statement.

* Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.

* Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If this adherence statement is not accurate and  there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

* In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript of Murai and co-authors examined the combined effects of a splicing inhibitor with an inhibitor of apoptosis for synergy in cell models of ovarian (A2780) and colorectal cancer (HCT116). In this study they present evidence that the putative CLK3 inhibitor T3 results in inhibition of splicing of anti-apoptotic proteins. Combined with an BCL-2 inhibitor (ABT-263), the authors provide evidence for synergistic increases in cell death as determined by caspase 3 assays. The authors provide further evidence that, in part, these effects are mediated through reduction of mTor signaling.

Critique

Overall these are carefully performed studies that provide initial evidence for a combinatorial approach to improve induction of cell death in cancer cells. However, there are a number of issues that need to be addressed before the manuscript is acceptable for publication.

1. Only one CLK inhibitor was examined and the specificity of T3 was not discussed. The authors need to add additional experiments with another CLK inhibitor to determine if this is a drug, or target specific response. Evidence of the selectivity of T3, with respect to other kinases, needs to be provided. These studies would be more convincing if synergy was observed with other CLK inhibitors as well.

2. The inhibition of mTOR signaling is suggested as a key part of the response although this is not well validated. Additional data demonstrating this (i.e. inhibition of S6 phos, EIF4EBP phos, or other) should be provided. At present the authors discuss the loss of S6- but no data is actually shown.

3. The explanation for the loss of MCL1 is not clear (Fig. 3C). In particular, the effects of MG132 are quite minor. Based on the PCR data shown, its possible that T3 is blocking total MCL1 expression. While the one splice (splice in) is shown, the total MCL1 message should also be presented. The potential effects of T3 on pTEF/transcriptional regulation of MCL1 have not been ruled out.

Reviewer #2: Authors showed that the small molecule splicing modulator T3, a CDC-like kinase (CLK) inhibitor, induced cell cycle changes and apoptosis in tumor cell lines A2780 and HCT116. T3 also showed synergistic pro-apoptotic effect with ABT-263. Authors also observed changes at protein levels for several apoptotic proteins following T3 treatment. This is an interesting study and has a potential in advancing cancer therapy. However, in the current version of this manuscript, there is a lack of direct evidence showing that the phenotypes are indeed CLK- or mRNA splicing-dependent. Limited studies on the changes in protein levels and the gene expression of only selected isoforms are not sufficient to reach the conclusion that the alternative splicing plays a critical role. Therefore, further studies are warranted before publication.

1. Authors need to directly show that the phenotypes induced by T3 are CLK- or mRNA splicing-dependent. For example, cells with mutant CLK (unable to bind to T3, or splicing function deficient), or CLK knockout, or through any other means to show that T3-induced cell cycle changes, apoptosis, and synergy with ABT-263 are CLK- or mRNA splicing-dependent. Comparing inactive T3 analog-induced vs T3–induced phenotypic changes would further help understanding the underlying mechanism.

2. Direct evidence at mRNA levels by such as RT-PCR showing alteration of splicing events after T3 treatment should be provided for each of the splicing variants, including cFLIP-L, cFLIP-S, Mcl-1L, and Mcl-1S. Whether the mRNA splicing of those apoptotic proteins is CLK dependent also needs to be investigated.

3. Authors claimed that some of the Bcl-2 family members such as Bcl-XL and Bcl-2 were resistant to T3-induced splicing modulation. Have authors investigated other isoforms of those proteins such as Bcl-xS, Bcl2L2, etc, to support the claim?

4. In Figure 3A, authors claimed “T3 altered splicing of the anti-apoptotic isoform MCL1L to the pro-apoptotic isoform MCL1S at 6 and 16 h in a dose-dependent manner”, however, no data for MCL-1S has been shown. PSI for both MCL-1L and MCL-1S need to be showed.

5. In Figure 3C, both western blot and RT-PCR for total MCl-1 and its isoforms Mcl-1L and Mcl-1S should be shown, in order to enable the comparison and delineate the effect of T3 on splicing alteration.

6. A section of statistical analysis should be included.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: The manuscript of Murai and co.docx

Click here for additional data file.

22 Apr 2020

We thank the academic editor and the reviewers for their constructive comments and suggestions. Following the requests from the editor and reviewers, we have performed additional experiments and included descriptions of these experiments in the Introduction, Results, and Discussion sections. We believe that the manuscript has been strengthened through this process. We have responded to each of the reviewers’ comments on the 'Response to reviewer' file.

We hope that the attached responses and the changes we have made are sufficient to make our manuscript suitable for publication in PLOS ONE. Please do not hesitate to contact me if you have any further queries, or to let me know if I can be of further assistance.

Submitted filename: Response_to_reviewer_plosone_rev_f.pdf

Click here for additional data file.

24 Jun 2020

PONE-D-20-00375R1

Synergistic apoptotic effects in cancer cells by the combination of CLK and Bcl-2 family inhibitors

PLOS ONE

Dear Dr. Araki,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please address the Reviewer 2 concerns

Please submit your revised manuscript by Aug 08 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Irina V. Lebedeva, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Please revise sentence on p.4 line 1-does not currently make sense.

The digitized blots in Figs 3 and 4 are unacceptable.

Reviewer #2: Authors did not directly and experimentally address many major concerns the reviewer has raised. One major point is the specificity aspect. Even though T3 has been reported to be potent, the off-target binding is still a possibility unless proven otherwise. Both the reviewers have specifically indicated that additional experiments with pharmacological and/or genetic approaches should be performed in order to show that the effect is CLK- or splicing-dependent. Unfortunately, authors did not attempt to address this point experimentally.

Figure 3A showed that the lower molecular weight BCL2L1 isoform Bcl-xS increased dose-dependently upon T3 treatment up to 1 uM, which is especially apparent after 16h treatment in both cell lines, and the amount of change is similar to MCL1 but with a different kinetics. However, authors described T3 “had no effect on splicing of the BCL2L1 gene”. This causes confusion.

There is also a considerable confusion regarding cFLIP. Authors stated that “T3 induced smaller size of cFLIPL and larger size of cFLIPL”, and then “T3 induced the smaller sized cFLIPL and cFLIPS”, and also stated “T3 alternatively induced multiple smaller sized transcripts of CFLAR-L and CFLAR-S”. In fact, the Fig 2 showed that T3 induced LARGER size of cFLIPs protein, but in Fig 4 there is NO LARGER size of cFLAR-S RNA but only SMALLER size cFLAR-S RNA. Would authors be able to consolidate?

Upon T3 treatment, Mcl-1S increased at RNA level (Fig 3A) but decreased at protein level (Fig 2). Reviewer’s Point 5 suggested to study the MCl-1 isoforms in Fig 3C (the original version), with using MG132 to investigate if the discrepancy in RNA and protein levels is at least due to proteasome degradation. Would the levels of Mcl-1S RNA become consistent with its protein levels if MG132 is present? Unfortunately, authors did not address this point experimentally.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

14 Sep 2020

We thank the academic editor and reviewers for their constructive comments and suggestions. According to the suggestions provided by the editor and reviewers, we performed additional experiments and included descriptions of these experiments in the Introduction, Results, and Discussion sections. The reviewers’ comments and our responses are listed in the attached file"Responses to reviewers".

Submitted filename: Responses_to_reviewers_rev2_f.pdf

Click here for additional data file.

2 Oct 2020

Synergistic apoptotic effects in cancer cells by the combination of CLK and Bcl-2 family inhibitors

PONE-D-20-00375R2

Dear Dr. Araki,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Irina V. Lebedeva, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: No further changes necessary- although I am still not pleased with Figure 4. Otherwise the authors have done a good job responding to my critiques.

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

6 Oct 2020

PONE-D-20-00375R2

Synergistic apoptotic effects in cancer cells by the combination of CLK and Bcl-2 family inhibitors

Dear Dr. Araki:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Irina V. Lebedeva

Academic Editor

PLOS ONE