Gwendolyn E Wood1, Stefanie L Iverson-Cabral1, Catherine W Gillespie2, M Sylvan Lowens3, Lisa E Manhart4,5, Patricia A Totten1,6. 1. Department of Medicine, Division of Allergy and Infectious Diseases, University of Washington, Seattle, Washington, United States of America. 2. Institute for Health Metrics and Evaluation, University of Washington, Seattle, Washington, United States of America. 3. Public Health - Seattle & King County Sexual Health Clinic, Seattle, Washington, United States of America. 4. Department of Epidemiology, University of Washington, Seattle, Washington, United States of America. 5. Department of Global Health, University of Washington, Seattle, Washington, United States of America. 6. Department of Global Health, Pathobiology Interdisciplinary Program, University of Washington, Seattle, Washington, United States of America.
Abstract
Mycoplasma genitalium is a sexually transmitted bacterial pathogen that infects men and women. Antigenic variation of MgpB and MgpC, the immunodominant adherence proteins of M. genitalium, is thought to contribute to immune evasion and chronic infection. We investigated the evolution of mgpB and mgpC sequences in men with non-gonococcal urethritis persistently infected with M. genitalium, including two men with anti-M. genitalium antibodies at enrollment and two that developed antibodies during follow-up. Each of the four patients was persistently infected with a different strain type and each patient produced antibodies targeting MgpB and MgpC. Amino acid sequence evolution in the variable regions of MgpB and MgpC occurred in all four patients with changes observed in single and multiple variable regions over time. Using the available crystal structure of MgpC of the G37 type strain we found that predicted conformational B cell epitopes localize predominantly to the variable region of MgpC, amino acids that changed during patient infection lie in these epitopes, and variant amino acids are in close proximity to the conserved sialic acid binding pocket. These findings support the hypothesis that sequence variation functions to avoid specific antibodies thereby contributing to persistence in the genital tract.
Mycoplasma genitalium is a sexually transmitted bacterial pathogen that infects men and women. Antigenic variation of MgpB and MgpC, the immunodominant adherence proteins of M. genitalium, is thought to contribute to immune evasion and chronic infection. We investigated the evolution of mgpB and mgpC sequences in men with non-gonococcal urethritis persistently infected with M. genitalium, including two men with anti-M. genitalium antibodies at enrollment and two that developed antibodies during follow-up. Each of the four patients was persistently infected with a different strain type and each patient produced antibodies targeting MgpB and MgpC. Amino acid sequence evolution in the variable regions of MgpB and MgpC occurred in all four patients with changes observed in single and multiple variable regions over time. Using the available crystal structure of MgpC of the G37 type strain we found that predicted conformational B cell epitopes localize predominantly to the variable region of MgpC, amino acids that changed during patientinfection lie in these epitopes, and variant amino acids are in close proximity to the conserved sialic acid binding pocket. These findings support the hypothesis that sequence variation functions to avoid specific antibodies thereby contributing to persistence in the genital tract.
M. genitalium is increasingly recognized as a sexually transmitted pathogen in men as a frequent cause of acute and chronic non-chlamydial, non-gonococcal urethritis (NGU) [1]. In women, M. genitalium is associated with cervicitis, pelvic inflammatory disease (PID), endometritis [2-4], tubal factor infertility [5, 6], preterm birth, and spontaneous abortion [7]. Importantly, M. genitaliuminfection increases cervical shedding of HIV [8] as well as the risk of acquiring and transmitting HIV [9, 10]. The prevalence of M. genitalium ranges from 1.3–3.9% in population-based studies, to 20.5% in high risk settings [11, 12]. Similar to Chlamydia trachomatis [13], many infectedmen and women are unaware of their M. genitalium-positive status [12, 14, 15]. Treatment is complicated by inherent resistance to cell wall targeting antibiotics, and high rates of acquired azithromycin resistance (40–100% of strains in some settings) [16]. The efficacy of moxifloxacin, used to treat azithromycin-resistant infections, is declining and dual resistance is increasingly reported [17].M. genitalium can persist for months, and potentially years, in infected individuals [10, 18, 19] despite the presence of specific antibodies in genital exudates of infectedwomen [20] and in the sera of infectedmen [21]. These data suggest that M. genitalium evades the local and systemic immune response, allowing greater opportunity for transmission to others and ascension to the upper reproductive tract in women. The MgpB and MgpC adherence proteins, also known as P140/MG191 and P110/MG192, respectively, are immunodominant targets of host antibodies [5, 20–23]. MgpB and MgpC localize to the M. genitalium terminal organelle, forming a complex [24] required for adherence to host cells and inanimate surfaces, and motility [25-28]. Recently the structure of the MgpC protein was determined and a sialic acid binding pocket was identified [29].The mgpB and mgpC genes, expressed from a single locus on the M. genitalium chromosome, consist of conserved sequences interspersed with variable regions [22, 23, 30]. MgpB and MgpC expression is affected by both antigenic and phase variation. Antigenic variants express MgpB and MgpC proteins with variant amino acids while phase variants do not express either MgpB or MgpC and are non-adherent. Antigenic variation is accomplished through segmental, reciprocal recombination between individual variable regions in mgpBC and archived variable sequences present in nine MgPars located throughout the chromosome [22, 23, 31, 32]. No MgpB or MgpC protein is expressed from the MgPars as only the variable sequences of mgpB and mgpC are present, the adjacent variable regions have different reading frames, and the variable sequences are often separated by short AT-rich regions encoding multiple stop codons. Phase variants arise in vitro by multiple mechanisms including recombination between mgpBC and the MgPars, point mutations, and deletions. [25, 33, 34]. Phase variants generated by recombination fall into at least six classes and can be reversible or irreversible depending on the number of recombination partners involved [33]. Deletion of recA results in the near-total loss of antigenic and phase variation implicating recombination as the mechanism that generates the majority of these variants [25, 33].Antigenic and phase variation may represent immune evasion strategies allowing M. genitalium to escape binding by specific host antibodies and persist in the genital tract. In order to understand the extent of antigenic variation during infection, we assessed sequence changes in both mgpB and mgpC in four men with NGU with persistent M. genitaliuminfection [35]. Among these men, two were positive for anti-M. genitalium serum antibodies specific for MgpB and MgpC at enrollment and two developed MgpB/C-specific antibodies during observation. We assessed sequence variation simultaneously in all four variable regions: region B, EF, and G of mgpB, and region KLM of mgpC, and found that variation was both rapid and extensive and was localized to conformational B cell epitopes predicted for MgpC. Our results are consistent with a model in which the immune system selects for variants in multiple regions of MgpB and MgpC simultaneously during persistent infection. Finally, by mapping these sequence changes onto the published crystal structure of MgpC [29], we found that variant amino acids are located near the sialic acid binding pocket of MgpC, suggesting that antigenic variation may protect M. genitalium from adherence-inhibiting antibodies.
Materials and methods
Patient specimens
The M. genitalium isolates in this study (Table 1) were obtained from urine specimens collected between January 2007 and July 2011 in a double-blinded, randomized trial comparing the effectiveness of azithromycin and doxycycline for men with NGU at the Public Health–Seattle & King County STD Clinic in Seattle, WA [35]. In this study, M. genitalium PCR-positive patients were randomly assigned to receive azithromycin or doxycycline upon enrollment (Visit 1). Patients returning at Visit 2 with signs or symptoms of urethritis were prescribed the alternate antibiotic and M. genitalium PCR status was again determined. Patients that were M. genitalium-positive at Visit 3, after azithromycin and doxycycline treatment, were prescribed moxifloxacin. At each time point, persistent infection was determined by PCR and M. genitalium isolates were recovered in cocultures with Vero cells (see below).
Table 1
M. genitalium clinical isolates used in this study.
Patient number
Days between Visit 1 and 3
Treatments between Visit 1 and 3
Isolatea
Strain typeb
GenBank Accession Numbers
10366
33
Doxycycline
MEGA 1166
3
Region B: MT439353 –MT439366
Region EF: MT439373 –MT439393
Region G: MT439409 –MT439410
Region KLM: MT439412 –MT439443
MEGA 1206
3
Region B: MT439376 –MT439372
Region EF: MT439394 –MT439408
Region G: MT439411
Region KLM: MT439444 –MT439455
10378
48
Doxycycline
MEGA 1199
2
Region B: MT439456
Azithromycin
Region EF: MT439458 –MT439459
Region G: MT439477
Region KLM: MT439479 –MT439484
MEGA 1261
2
Region B: MT439457
Region EF: MT439460 –MT439476
Region G: MT439478
Region KLM: MT439485 –MT439489
10467
28
Doxycycline
MEGA 1473
5
Region B: MT439490 –MT439502
Azithromycin
Region EF: MT439518 –MT439528
Region G: MT439540
Region KLM: MT439542 –MT439544
MEGA 1493
5
Region B: MT439503 –MT439517
Region EF: MT439529 –MT439539
Region G: MT439541
Region KLM: MT439545 –MT439553
10477
50
Doxycycline
MEGA 1491
4
Region B: MT439554 –MT439555
Azithromycin
Region EF: MT439560 –MT439571
Region G: MT439580 –MT439581
Region KLM: MT439583 –MT439591
MEGA 1534
4
Region B: MT439556 –MT439559
Region EF: MT439572 –MT439579
Region G: MT439582
Region KLM: MT439592 –MT439593
, M. genitalium cultured from Visit 1 and Visit 3 urine specimens for each patient.
, strain type numbering according to Jensen [37]. Strain type sequences have been deposited in GenBank (KP318822.1, KP318823.1, KP318824.1, KP318825) [27].
, M. genitalium cultured from Visit 1 and Visit 3 urine specimens for each patient., strain type numbering according to Jensen [37]. Strain type sequences have been deposited in GenBank (KP318822.1, KP318823.1, KP318824.1, KP318825) [27].Among the four patients whose cultured strains were analyzed in the current study, M. genitaliuminfection persisted after doxycycline treatment, consistent with the known poor efficacy of this antibiotic for eradication of M. genitaliuminfection [36]. Three men (Patients 10378, 10467, and 10477) were also treated with azithromycin per study protocol, however, it was later determined that each of these patients had been infected with an azithromycin resistant strain (MIC ≥ 8 μg/ml, Totten et al. in preparation) at enrollment. The M. genitalium strain that infectedPatient 10366 is sensitive to azithromycin, however, azithromycin treatment was initiated after collection of the Visit 3 specimens. For the present study, we analyzed M. genitalium isolates cultured from patient specimens obtained at Visit 1 and Visit 3.
Immunoblots
Antibody reactivity of patient sera to whole cell lysates of wild type M. genitalium strain G37 was determined as previously described [38] using a 1:1,000 dilution of patient serum, followed by a 1:7,500 dilution of peroxidase-conjugated goat anti-human IgG (whole molecule; Sigma-Aldrich, St. Louis, MO) secondary antibody and chemiluminescent detection (ECL, GE Healthcare, Chicago, IL).
Culture of M. genitalium from urine
M. genitalium isolates (Table 1) were recovered from processed patient urine by coculture with Vero cells [39]. Briefly, patient urine (2 ml) was centrifuged at 16,000 x g for 15 minutes, the supernatant was discarded, and the cell pellet was resuspended in 0.4 ml mycoplasma transport medium and frozen at -80°C. At the time of culture, 1 x 105 Vero cells (obtained from the American Type Culture Collection) were seeded in 25 cm2 flasks in 5 ml Eagle’s Minimal Essential Medium (EMEM; ATCC, Manassas, VA) supplemented with 10% fetal bovine serum and 100 U/ml penicillin. After overnight incubation at 37°C in 5% CO2, the culture medium was removed, adherent Vero cells were washed with PBS, and fresh EMEM containing 10% FBS, 6% yeast dialysate, 100 U/ml penicillin, 50 μg/ml polymyxin B, and 50 μg/ml colistin in a total volume of 8.5 ml was added. Flasks were inoculated with thawed, processed urine (100 μl) and incubated at 37°C in 5% CO2 for four weeks. Vero cells grew to form a confluent monolayer after two weeks and then detached from the plastic by week three. To confirm growth of M. genitalium from patient specimens, aliquots from these cocultures were collected weekly and DNA was isolated with the MasterPure DNA isolation kit (Lucigen, Middleton, WI). M. genitalium DNA was quantitated by qPCR as previously described [40] confirming growth by an increase in genomes over time.
PCR amplification and sequencing of mgpBC variable and strain typing regions
DNA isolated from M. genitalium strains cocultured with Vero cells for three weeks, corresponding to late log phase, served as template for amplification of the mgpB strain typing region (Fig 1) with primers ModPetF and 1415R (Table 2). PCR products amplified after 30 cycles with Platinum PCR SuperMix High Fidelity (Invitrogen, Carlsbad, CA) were cloned into pCR2.1-Topo (Invitrogen) and several plasmid clones were sequenced to determine the M. genitalium strain type sequence and verify that a single strain type was detected at Visit 1 and Visit 3 (Table 1). Variable regions in mgpB and mgpC were similarly PCR-amplified using the primers indicated in Fig 1 and Table 2, cloned, and sequenced from multiple plasmids. Each variable region was PCR-amplified twice, using a different primer pair for each reaction. Sequences were aligned using MultAlin (http://multalin.toulouse.inra.fr/multalin/) [41], Highlighter (https://www.hiv.lanl.gov/content/sequence/HIGHLIGHT/highlighter_top.html) [42], and ElimDupes (https://www.hiv.lanl.gov/content/sequence/elimdupesv2/elimdupes.html). Unique sequences have been deposited in GenBank (Accession numbers MT439353 –MT439593, Table 1). Sequences of the conserved regions of mgpB for these patient isolates have been published previously [27].
Fig 1
Strain typing and variable regions of mgpB and mgpC targeted for PCR amplification and sequencing.
Small arrows indicate the primers used to PCR amplify each region indicated by grey lines. Each variable region was amplified with two different primer pairs. PCR products were cloned and sequenced from individual plasmids to assess sequence changes over time in infected men. Strain types were determined by sequencing the region indicated by “ST”. Numbers indicate base pairs relative to the start codon of mgpB and mgpC.
Table 2
Primers used in this study.
Primer name
Primer sequence (5’-3’)
Region amplified
ModPetF
GTGATGTTGTTAGTGATTGTGTG
mgpB strain typing region and variable region B
1415R
TGGTGGTAAACATCTTAGTAGCAT
MgPa-355Fb
GAGAAATACCTTGATGGTCAGCAA
mgpB region B
1976R
TAACTGTCAAGCATACAAACCAC
1826F
TCCAAGATGAAATGGGCAGT
mgpB region EF
3028R
TCATTGATTACAACAAGATTACC
1653F
AGCAGGAACACTAACAATG
mgpB region EF
3220R
GATCTCACAGTGATTTAGG
2863F
GGGAGGTGAATGGGTTGTAT
mgpB region G
70R
CTAGTGCTAATGGTAGAAAGGG
3057F
CTTTGGGTTTCAACTTGGTG
mgpB region G
4300R
TTGTTTTACTGGAGGTTTTG
106F
AATGTTACTGCTTACACCCC
mgpC region KLM
1726R
TAGGGAACAGGGAGGTAACG
4149F
AAAGGCATTACAAGCAGGG
mgpC region KLM
1549R
TAAACCTAACGCATCAAAC
, Primers target sequences that are highly conserved among strains [27, 43].
, previously described [44].
Strain typing and variable regions of mgpB and mgpC targeted for PCR amplification and sequencing.
Small arrows indicate the primers used to PCR amplify each region indicated by grey lines. Each variable region was amplified with two different primer pairs. PCR products were cloned and sequenced from individual plasmids to assess sequence changes over time in infectedmen. Strain types were determined by sequencing the region indicated by “ST”. Numbers indicate base pairs relative to the start codon of mgpB and mgpC., Primers target sequences that are highly conserved among strains [27, 43]., previously described [44].To measure variation during Vero coculture, one strain (MEGA 1166) was subcultured twice, for a total of ten weeks of in vitro growth, then variation in mgpB region B was assessed by PCR and sequencing as described above.
Epitope analysis
Epitopes within MgpC (amino acids 23–938) of the M. genitalium type strain G37 were predicted using DiscoTope 2.0 [45] and the published crystal structure, PDB 5MZ9 [29]. For simplicity, our analyses include only those epitopes with a score greater than -1.0, corresponding to 30% sensitivity and 85% specificity. The default threshold of -3.7 corresponds to 47% sensitivity and 70% specificity. To predict epitopes in patient variants, the KLM region of G37 MgpC was replaced with sequences specific for isolates 1491 and 1534, modeled with iTasser [46], and then analyzed using DiscoTope 2.0. PyMol was used to manipulate models of predicted protein structures and generate images. Linear epitopes were predicted using Bepipred 2.0 [47].
Ethics statement
The M. genitalium cultures and sera analyzed in this study were obtained from men enrolled in our Seattle-based treatment trial [35]. This study was approved by the University of Washington Institutional Review Board and all enrollees gave written informed consent.
Results
The goal of this study was to determine the extent of sequence variation in mgpB and mgpC over time in men with NGU who were persistently infected with M. genitalium. Previous studies of antigenic variation of M. genitalium from clinical specimens have been limited to analyzing a single variable region and/or by a low number of cloned sequences analyzed [22, 23, 32, 43], which would underestimate the diversity and complexity of MgpB and MgpC variation. An appreciation of the extent of variation occurring during infection is necessary to understand how antigenic variation contributes to persistence and immune evasion. Here we analyzed sequence variation in all four variable regions (B, EF, G, and KLM) of the mgpBC expression site in M. genitalium cultured from the urine of four men with NGU during persistent infection spanning 28 to 50 days.
Identification of suitable specimens
The M. genitalium isolates sequenced in this study were cultured from men enrolled in our study comparing the efficacy of doxycycline and azithromycin for the treatment of NGU [35]. Urine specimens were collected from men at multiple time points (up to four clinic visits) spanning 28 to 50 days, and confirmed M. genitalium-positive by PCR [48]. Strain typing [37] was used to determine that a single strain was detected at all time points. Patient sera collected at Visit 1 and Visit 3 were assayed by immunoblot to identify patients with anti-MgpB and anti-MgpC antibody reactivity. Four patients were chosen for further analysis including two (patients 10378 and 10467) with increased MgpB and MgpC reactivity between clinic visits, and two others (patients 10366 and 10477) that reacted with MgpB and MgpC at both time points (Fig 2). Immunoblot reactivity is assumed to primarily reflect the binding of patient antibodies to conserved sequences in MgpB and MgpC as variable region sequences differ between patient isolates and the G37 type strain used as antigen. The paired Visit 1 and Visit 3 M. genitalium isolates cultured from these four PCR-positive men were strain typed to confirm that the Vero-cultured isolates were identical to the strain present in patient specimens (Table 1). These isolates were then analyzed for sequence variation over time.
Fig 2
Immunoblot IgG reactivity of M. genitalium positive patient sera with whole lysates of strain G37.
Sera obtained from four PCR-positive men at first and third clinic visits (V1 and V3, respectively), were diluted 1:1,000 and reacted with M. genitalium whole cell lysates separated on a 7.5% SDS-PAGE gel. “Rb”, specific rabbit sera [40] was used to identify MgpB and MgpC protein bands (arrows). Molecular weight markers (in kDa) are shown at left. The magnitude of antibody reactivity between patients cannot be compared as different film exposure times were used.
Immunoblot IgG reactivity of M. genitalium positive patient sera with whole lysates of strain G37.
Sera obtained from four PCR-positive men at first and third clinic visits (V1 and V3, respectively), were diluted 1:1,000 and reacted with M. genitalium whole cell lysates separated on a 7.5% SDS-PAGE gel. “Rb”, specific rabbit sera [40] was used to identify MgpB and MgpC protein bands (arrows). Molecular weight markers (in kDa) are shown at left. The magnitude of antibody reactivity between patients cannot be compared as different film exposure times were used.
Analysis of sequence diversity in M. genitalium infected men
To assess gene variation in M. genitalium isolates, each of the three variable regions within mgpB (regions B, EF, and G) and the single variable region within mgpC (region KLM) was PCR amplified from Visit 1 and Visit 3 cultures (Fig 1). Amplicons were cloned, and then 10 plasmids were sequenced to identify regions that varied between time points. If sequence changes were observed in a particular variable region, then an additional 25–30 plasmids were sequenced. These variable regions were then amplified with a second primer pair targeting the same region (Fig 1 and Table 2), again cloning and sequencing 35–40 plasmids. Similar sequences were obtained using both primer pairs suggesting that each reaction amplified representative sequences. For example, 18 variant sequences were identified among 78 clones of region B from Patient 10366 Visit 1. Of the 6 variant sequences found in more than two plasmid clones, all were amplified by both primer pairs, representing 83% of total sequences obtained. Using this strategy approximately 75 cloned sequences were analyzed per variable region for each time point in all four patients.The predicted amino acid sequences for each variable region were aligned to assess sequence changes between time points. Sequence variation between time points was observed in all four patients analyzed in at least one variable region. Variable region sequences were unique to the isolates from each patient (i.e., no sequence was identical between different patients), emphasizing the diversity of M. genitalium strains circulating in a single geographic area. A comparison of the Visit 1 and Visit 3 sequences revealed the loss of specific amino acid sequences over time, consistent with immune selection against specific epitopes. Figs 3 and 4 show the results of these analyses in graphic form in which each individual cloned sequence is compared to the predominant sequence present at Visit 1. M. genitalium isolates cultured from Patient 10366 varied between time points in all four regions of mgpB and mgpC (Fig 3). A mixture of variant region B, EF, and KLM sequences, with a single region G sequence, was present at Visit 1. However, by Visit 3 novel sequences predominated in all four variable regions consistent with selection against sequences present at Visit 1. In contrast, Patient 10467 varied only in Region B, Patient 10378 varied only in region EF, and Patient 10477 varied in Regions EF and KLM (Fig 4). In general, a single variant sequence predominated at Visit 3 for all four patients analyzed, although patients differed in whether they were infected with a variety of variants (eg Patient 10366 B, EF, and KLM) or a single predominant sequence (eg Patients 10378, 10467, and 10477). Interestingly, in Patient 10378, the Visit 3 culture was a mixture of the predominant Visit 1 sequence and a novel sequence (Fig 4). This may indicate “selection in process”–i.e., that effective antibodies have recently appeared and are actively selecting against an epitope formed by the amino acids that have changed between time points.
Fig 3
Evolution of MgpB regions B, EF, and G, and MgpC region KLM sequences during infection in Patient 10366.
Amino acid alignments (Multalin [41]) were submitted to Highlighter [42] to generate the output shown. Each horizontal line represents a single cloned sequence. Amino acids that differ from the predominant Visit 1 sequence (top line) are marked with vertical colored bars with different colors corresponding to particular amino acids. Visit 1 and Visit 3 sequences are indicated by grey and yellow block shading at right, respectively. Dashed boxes indicate sequences detailed in Figs 5 and 6. Variable regions not shown for Patients 10378, 10467, and 10477 did not vary substantially between time points and therefore were not analyzed further.
Fig 4
Evolution of MgpB regions B, EF, and G, and MgpC region KLM sequences during infection in Patients 10378, 10467, and 10477.
Analysis and data presentation are described in legend for Fig 3.
Evolution of MgpB regions B, EF, and G, and MgpC region KLM sequences during infection in Patient 10366.
Amino acid alignments (Multalin [41]) were submitted to Highlighter [42] to generate the output shown. Each horizontal line represents a single cloned sequence. Amino acids that differ from the predominant Visit 1 sequence (top line) are marked with vertical colored bars with different colors corresponding to particular amino acids. Visit 1 and Visit 3 sequences are indicated by grey and yellow block shading at right, respectively. Dashed boxes indicate sequences detailed in Figs 5 and 6. Variable regions not shown for Patients 10378, 10467, and 10477 did not vary substantially between time points and therefore were not analyzed further.
Fig 5
Detailed alignment of variable segments indicated in Fig 3 for Patient 10366.
The predominant sequence present at Visit 1 is shown in black at the top of each alignment. Each unique sequence is represented on a single line, variant amino acids are marked in color, dots indicate unchanged amino acids, and dashes indicate gaps.
Fig 6
Detailed alignment of variable segments indicated in Fig 4 for Patients 10378, 10467, and 10477.
The predominant sequence present at Visit 1 is shown in black at the top of each alignment. Each unique sequence is represented on a single line, variant amino acids are marked in color, dots indicate unchanged amino acids, and dashes indicate gaps.
Evolution of MgpB regions B, EF, and G, and MgpC region KLM sequences during infection in Patients 10378, 10467, and 10477.
Analysis and data presentation are described in legend for Fig 3.Close inspection of variant sequences (Figs 5 and 6) revealed that changes occurred in clusters of amino acids consistent with the well-described mechanism of segmental recombination between mgpBC and the MgPars [22, 23]. As individual variant clusters arose independently of each other (for example, amino acids “DTSG.T” appeared independently of amino acids “KSG” in region B Patient 10366, Fig 5) we assumed that they represent independent recombination events. To estimate the number of recombination events in these patients, we visually inspected the amino acid alignments shown in Figs 3 and 4 for segmental sequence changes, similar to previously described analyses [49]. For simplicity, single amino acid changes present in only one plasmid clone were omitted as these could arise via point mutations or PCR/sequencing errors. This analysis identified 68 possible recombination events among the variants infecting Patient 10366 (8 in region B, 18 in EF, 1 in region G, and 41 in region KLM); 6 recombination events in Patient 10378 (region EF only), 16 in Patient 10467 (region B only), and 26 in Patient 10477 (11 in region EF and 15 in KLM).
Detailed alignment of variable segments indicated in Fig 3 for Patient 10366.
The predominant sequence present at Visit 1 is shown in black at the top of each alignment. Each unique sequence is represented on a single line, variant amino acids are marked in color, dots indicate unchanged amino acids, and dashes indicate gaps.
Detailed alignment of variable segments indicated in Fig 4 for Patients 10378, 10467, and 10477.
The predominant sequence present at Visit 1 is shown in black at the top of each alignment. Each unique sequence is represented on a single line, variant amino acids are marked in color, dots indicate unchanged amino acids, and dashes indicate gaps.
Stability of sequences in Vero coculture
As recovery of M. genitalium from patient specimens requires three weeks of in vitro coculture with Vero cells, we considered the possibility that the gene variation we observed occurred during in vitro culture rather during patientinfection. To address this issue, we serially passaged M. genitalium from Patient 10366 at Visit 1 (MEGA 1166) for an additional seven weeks in Vero cells then compared the variants present in MgpB region B to the same unpassaged culture. As shown in Fig 7 (upper panel), we found that the number of different variants present, and the sequences of these variants, changed very little during these seven weeks of in vitro growth. Similarly, M. genitalium cultured from this patient at Visit 3 (MEGA 1206) varied little during seven weeks in vitro (Fig 7, lower panel). These results contrast with the extensive sequence evolution that occurred during 33 days of urethral infection and support our conclusion that diversification of sequences is a consequence of growth in vivo.
Fig 7
Assessment of antigenic variation during in vitro passage in Vero cell cocultures.
MgpB region B sequences were compared between Visit 1 (MEGA 1166) and Visit 3 (MEGA 1206) cultured from patient specimens after seven weeks of in vitro passage in Vero cell cocultures. Identical sequences are indicated with identical colors; 34–38 plasmids were sequenced from each culture. Results show that little variation occurred during seven weeks of in vitro growth for each culture.
Assessment of antigenic variation during in vitro passage in Vero cell cocultures.
MgpB region B sequences were compared between Visit 1 (MEGA 1166) and Visit 3 (MEGA 1206) cultured from patient specimens after seven weeks of in vitro passage in Vero cell cocultures. Identical sequences are indicated with identical colors; 34–38 plasmids were sequenced from each culture. Results show that little variation occurred during seven weeks of in vitro growth for each culture.
MgpC variant amino acids lie within predicted conformational B cell epitopes
The recent description of the MgpC crystal structure [29] afforded the opportunity to predict the location of conformational B cell epitopes. As shown in Fig 8A, DiscoTope [45] analysis predicted numerous conformational epitopes within full-length MgpC with higher scoring epitopes concentrated in variable region KLM: 152 amino acids in full-length MgpC have a DiscoTope score greater than -1.0 (corresponding to 30% sensitivity and 85% specificity), 133 (87.5%) of which are located in KLM.
Fig 8
Prediction of conformational B cell epitopes in MgpC.
(A). G37 MgpC high-scoring B cell epitopes localize to variable region KLM. DiscoTope 2.0 with a stringent cutoff of -1 (corresponding to 30% sensitivity and 85% specificity), indicated by the horizontal dashed line, was used to predict conformational B cell epitopes using the published MgpC structure (PDB 5mzb, amino acids 25–936 [29]). Variable region KLM is indicated by the purple line, this region is expanded to show detail in panel B (dashed grey lines). (B). Variant amino acids correlate with predicted B cell epitopes within variable region KLM. Red and green lines indicate sequences obtained for Patient 10366 and 10477 isolates, respectively, amino acids that varied between time points indicated by “peaks” (arbitrary units).
Prediction of conformational B cell epitopes in MgpC.
(A). G37 MgpC high-scoring B cell epitopes localize to variable region KLM. DiscoTope 2.0 with a stringent cutoff of -1 (corresponding to 30% sensitivity and 85% specificity), indicated by the horizontal dashed line, was used to predict conformational B cell epitopes using the published MgpC structure (PDB 5mzb, amino acids 25–936 [29]). Variable region KLM is indicated by the purple line, this region is expanded to show detail in panel B (dashed grey lines). (B). Variant amino acids correlate with predicted B cell epitopes within variable region KLM. Red and green lines indicate sequences obtained for Patient 10366 and 10477 isolates, respectively, amino acids that varied between time points indicated by “peaks” (arbitrary units).The locations of predicted conformational epitopes were mapped onto the crystal structure of G37 MgpC as shown in Fig 9. Epitopes predicted within the conserved region of MgpC are marked in red, while epitopes in variable region KLM that cluster together on the MgpC surface are indicated with various colors. The amino acids implicated in sialic acid binding [29] are located within, or adjacent to, predicted epitopes (magenta in Fig 9). This analysis shows that most conformational epitopes are located on the so-called “crown” of MgpC, which consists primarily of variable region KLM, as previously noted [29], and are located on the surface of the MgpC molecule where they could be targeted by host antibodies.
Fig 9
Location of predicted conformational epitopes on the G37 MgpC protein.
The MgpC transmembrane domain (not shown) is oriented downward. Colored residues indicate epitopes that group together on the surface of MgpC; epitopes in the conserved region of KLM are indicated in red. The eight amino acids required for sialic acid binding [29] are shown in magenta, five of which lie within predicted epitopes. Figure produced using Pymol.
Location of predicted conformational epitopes on the G37 MgpC protein.
The MgpC transmembrane domain (not shown) is oriented downward. Colored residues indicate epitopes that group together on the surface of MgpC; epitopes in the conserved region of KLM are indicated in red. The eight amino acids required for sialic acid binding [29] are shown in magenta, five of which lie within predicted epitopes. Figure produced using Pymol.
Variation observed during patient infection localizes to predicted epitopes
We hypothesized that if variation in MgpC region KLM represents an immune evasion mechanism then sequence changes should affect predicted epitopes. We aligned the KLM sequences obtained from two patients and identified amino acids that changed between time points (Fig 8B). In Patient 10366, 32 amino acids varied between early and late time points in region KLM, 22 (66%) of which corresponded to epitopes predicted by DiscoTope with a stringent cutoff of -1.0 (indicated as peaks in Fig 8B, red line). Similarly, 49 (67%) of the 73 amino acids that varied in Patient 10477 were located in epitopes (Fig 8B, green line).We next determined whether sequence variation in vivo changed the amino acid sequence of an existing epitope, or if a pre-existing epitope was changed to a non-epitope. For this analysis, we replaced the G37 MgpC region KLM sequence with the patient-specific variant sequences, generated structural models with iTasser, and predicted conformational epitopes with DiscoTope. For simplicity, sequences from a single patient (Patient 10477: Visit 1 MEGA 1491 vs Visit 3 MEGA 1534) were analyzed as a single, unique sequence predominated at each time point (Fig 10). The epitopes predicted using the patient-specific models were similar to G37 in score (not shown) and location (compare Figs 10 to 9) despite 17% amino acid sequence differences. Patient-specific epitopes localized predominantly to the crown of MgpC and the amino acids that changed between time points (indicated in black in Fig 10) were embedded in these epitopes. Interestingly, the variant amino acids localized to different faces of the MgpC crown suggesting that several epitopes changed during the course of infection, possibly avoiding binding by antibodies of multiple specificities.
Fig 10
Models of MgpC for Patient 10477 Visit 1 isolate (MEGA 1491, left) and Visit 3 isolate (MEGA 1534, right).
Colored residues indicate predicted epitopes that group together on the surface of MgpC, added to improve data visualization. Amino acids that changed between time points are indicated in black on the Visit 3 model. Amino acids implicated in sialic acid binding are shown in magenta. Residues indicated in red and brown are epitopes predicted in the conserved region of MgpC.
Models of MgpC for Patient 10477 Visit 1 isolate (MEGA 1491, left) and Visit 3 isolate (MEGA 1534, right).
Colored residues indicate predicted epitopes that group together on the surface of MgpC, added to improve data visualization. Amino acids that changed between time points are indicated in black on the Visit 3 model. Amino acids implicated in sialic acid binding are shown in magenta. Residues indicated in red and brown are epitopes predicted in the conserved region of MgpC.
Discussion
In this study, we assessed sequence variation in the variable regions of mgpB (regions B, EF, and G) and mgpC (region KLM) of M. genitalium cultured from longitudinal specimens (spanning 30 to 58 days) from persistently infectedmen. Strain typing confirmed that a single strain type was detected in each patient at all time points, and immunoblots indicated antibody reactivity to the MgpB and MgpC proteins in the sera of all four men. Evidence of extensive variation was observed in these patients in one or multiple mgpBC variable regions in vivo, with little variation during in vitro culture. The extent and diversity of variation was greater than previously appreciated by other studies of M. genitalium antigenic variation in patient specimens. Most variable amino acids in MgpC mapped to predicted conformational B cell epitopes supporting a role for antigenic variation as a mechanism to avoid the biologic effect of specific antibodies in order to persist in vivo.Previous studies have been instrumental in establishing that the gene variation predicted from in vitro studies occurs in vivo. For example, we previously observed mgpB and mgpC gene variation in M. genitalium-infectedwomen [22, 23] and Ma et al. [32, 43] documented variation in several M. genitalium-infectedmen and women. However, each of these previous studies assessed a limited number of sequences (5 to 18 cloned sequences per specimen) and only one or two variable regions in these patients. Fookes et al. [50] assessed changes in the entire mgpBC operon by whole genome sequencing of isolates obtained 79 days apart, however, as single colony cloned strains were sequenced, the full breadth of variation within the infecting population could not be assessed. Our study provides a comprehensive assessment of variation across all variable regions in both MgpB and MgpC in men who were each persistently infected with a single strain. This approach allows an appreciation of the extent and frequency of variation, necessary to understand how antigenic variation relates to immune evasion and pathogenesis. Interestingly, we found that some variable regions did not change between time points in three patients: few changes were observed in regions B, G, and KLM in Patient 10378, in regions EF, G, and KLM in Patient 10467, and in regions B and G in Patient 10477. Our model of antibody-mediated immune selection would predict that the sera of these patients would react poorly to these non-variant regions of MgpB and MgpC, a prediction we intend to test in future experiments.We compared the number of recombination events observed at the expression site, calculated by identifying clusters of amino acid changes between time points and assuming that a unique cluster arose via a single recombination event. In this small sample set, the number of recombination events did not correlate with the length of time between specimen collection. For example, in Patient 10378 we observed 6 recombination events over 48 days of infection, whereas 68 recombination events were detected in Patient 10366 during 33 days of infection. It is tempting to speculate that the duration of antibody response is related to the number of variants observed. For example, isolates from Patients 10366 and 10477 had the most recombination events between time points analyzed (68 and 26, respectively) and both patients had anti-MgpB and MgpC antibodies at early and late time points, providing more opportunity for antibody-mediated selection. However, it is unknown when antibodies arose in Patients 10378 (48 days between visits) and 10467 (28 days). Furthermore, patient serum antibody reactivity was measured by immunoblot against whole cell lysates of M. genitalium strain G37, thereby detecting reactivity to sequences common in all MgpB and MgpC alleles, rather than unique variants present at early time points in these patients. Finally, immunoblot reactivity does not necessarily indicate biologic activity, for example, antibodies may target epitopes that are not exposed on the surface of M. genitalium. Further experiments are needed to ascertain whether these patient antibodies bind specific variants and have biologic activity.Our results showed clearly that many more variants arise during patientinfection than during in vitro culture, probably due to a combination of immune selection and higher rates of recombination in vivo. The role of selection by immune factors is supported by the presence of antibodies to MgpB and MgpC, the known immunogenicity of these proteins in humans and animals, and the prediction of many high scoring conformational B cell epitopes in the variable region of MgpC. Furthermore, the fact that a single variant predominates at a given time point suggests that immune selection drives variation (ie, by selecting against one sequence followed by proliferation of a novel variant that escapes antibody selection). In concert with immune selection, we hypothesize that the rate of recombination is upregulated in vivo. Recently, an alternative sigma factor, MG428, was identified that induces expression of RecA and other recombination enzymes thereby increasing antigenic and phase variation [51-53]. We hypothesize that specific inducing signals for the MG428 regulon, as yet unknown, will be found in the genital tract.We analyzed the MgpC protein for predicted conformational B cell epitopes using the available crystal structure [29]. We found that most conformational epitopes are located in the variable KLM region of MgpC and that sequence variation detected in M. genitaliumpatient isolates alters the amino acids specifically localized to these epitopes. These data support our hypothesis that the role of gene variation is avoidance of specific antibody. Interestingly, few conformational epitopes are predicted in conserved sequences of MgpC suggesting that low immunogenicity may be an additional strategy to avoid antibody targeting of these invariant yet surface exposed regions. Further studies are needed to determine if epitopes predicted in silico are indeed targeted by host antibodies, and if the MG281 antibody binding protein of M. genitalium [54] plays a role in immune evasion.
Unadjusted immunoblot image.
Original blots showing reactivity of patient sera to M. genitalium whole cell lysates.(TIF)Click here for additional data file.28 Aug 2020PONE-D-20-17903Sequence variation and immunogenicity of the Mycoplasma genitalium MgpB and MgpC adherence proteins during persistent infection of men with non-gonococcal urethritisPLOS ONEDear Dr. Wood,Thank you for submitting your manuscript to PLOS ONE. I want to apologize for the delay- finding reviewers was challenging this summer. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by Oct 12 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,Catherine A. Brissette, Ph.D.Academic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: YesReviewer #3: Partly**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: YesReviewer #3: N/A**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: YesReviewer #3: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: YesReviewer #3: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The manuscript by Wood and colleagues reports on the sequence variation of two highly variable adhesion related proteins of the STI pathogen, Mycoplasma genitalium. This species uses rampant recombination between variant sequences to shuffle new coding sequences into a single expression locus. Although the main features of the process have been known for a while, this study documents variation seen isolates from four persistently colonized men. Overall the data are quite clear cut, although it was no unambiguously clear, how much of the MgpB variation was previously reported in reference 27 (please see below)Specific Points1. Introduction. Since there are a number of different protein names used for MgpB and MgpC, it would be informative to include these in parentheses the first time the proteins are introduced (e.g. L57; for example include MG numbers and P110 etc).2. L68 The term MgPars is introduced here, without any information provided about their nature.3. L70 It is not clear how recombination mediated antigenic variation and the “exchange of large regions of mgpBC with single or multiple MgPars” i.e. phase variation, are actually different processes. Is it the length of the region shuffled? In which case this third mechanism of phase variation would seem to be one extreme end of the antigenic variation recombination spectrum. This distinction was unclear when I read it.4. L71 It is not clear how recA (the primary mechanism for these phenomena) can generate point mutations (L70) unless some of the MgPars carry such isolated mutations.5. L83. This might be interpreted that immune selection is causing the variation directly, whereas presumably it is the driver of selecting against the previous antigenic epitopes.6. L134. Please include the name of the PCR polymerase (hi fidelity? ) and the typical number of cycles that were necessary to amplify the variable regions. These points are important when trying to assess the sequence variation obtained.7. L30 and L135. As you read the methods, there are day numbers that seem discrepant. On L30, DNA is prepared from co-cultured cells after day 7, 14, 21, 28 but then on L135 the templates are from three or 10 weeks.8. L147. The authors state that the conserved regions of mgpB for these isolates were reported in ref 27. Table S3 from that paper seems to include variable regions also, so it is not 100% clear what was reported before and what is new (in regards to variable sequences in MgpB).9. L189 and ref 37. How many different strain types are known? And how many different strains can have the same “strain type”? Although it is possible that the strain typing shows that a “single strain across all time points” was present, it does not categorically prove that. It would be more accurate to state that only a single strain type was detected. Also L352 “with a single persistent strain type…”?10. Most of the sequence analysis comes from clones of PCR products obtained from co-cultured cells and uses the 3 week DNA prep. Was insufficient DNA recoverable at earlier times (the methods indicate that day 7 and day 14 DNA preps were made, but these were not characterized)? What was the rationale for this?11. Is the recombination reciprocal and do the authors have data from any of the MgPar sites?Minor points1. L47 Should “Chlamydia” be italicized?2. L99 versus L121. There is variable hyphenation usage in “co-culture”. Please use one style throughout.3. L119, L124, L132, L137. Please provide ECL and pCR2.1 supplier details and check to see if company locations are required for ATCC, Epicentre and PCR enzyme (see point 6 above)4. Figure 2-indicate what he “Rb” refers to in the legend.5. L402 i.e. (should this be italicized)?6. L416 should “in silico” be italicized?Reviewer #2: The main goal of the study from Wood et al., is to determine the extent of sequence variation in the MgpB and MgpC over time in men persistently infected with Mycoplasma genitalium. MgpB and MgpC are adherence proteins, which are immunodominant targets of host antibodies.The work extends previous studies (analyzing mostly a single variable region or with other limitations) carried out by some of the coauthors and by other groups. The methodology used and the analysis performed in the present work seem appropriated and the conclusions consistent. However, the amount of patients used (four) in the study is maybe a bit too small and the novelty of results limited.It would be nice to indicate at some point in the text the alternative nomenclature of P140 and P110 for MgpB and MgpC, respectively.In the work the analysis is performed in parallel for MgpB and MgpC, except for the mapping of the variant amino acids onto the protein structure that is only done for MgpC. Since some weeks ago the structure of MgpB was published and it is now also available. In my opinion the mapping of variants should now also be done for MgpB and included in this work.Reviewer #3: In this manuscript, Wood and colleagues examine the generation of sequence variation within the main adhesins of M. genitalium during persistent infection. This variation is intended to modify/replace the antigenic regions of the MgpB and MgpC adhesins to avoid host antibody recognition. In contrast to previous studies, where the analysis was limited to a single region or a low number of cloned sequences, the current report addresses sequence variation in all four variable regions of the mgpBC expression site and analyze multiple clones. Therefore, the present study provides a more complete picture of the diversity and complexity of MgpB and MgpC variation over time.The topic of study is critical to understand persistence of M. genitalium in the genital tract and the authors have wide experience investigating sequence variation in this pathogen. Overall, the results are well-presented and are easy to follow, so I do not have specific comments on this regard. However, in my opinion, there are a few questions regarding the study design that would need to be clarified:1) To identify sequence variants (L134-141 and L207-217), the authors use PCR amplification, followed by cloning and Sanger sequencing of multiple plasmids (around 75). The number of individual clones analyzed seems sufficient to obtain a representative view of the predominant sequence variants present at each time point. However, clone selection is always a matter of concern. Therefore, could Next Generation Sequencing technology have been used to analyze the different PCR amplicons? If so, do the authors think that the use of NGS could impact or improve the results presented in this study? Could the use of NGS benefit future studies addressing sequence variation of Mge during persistent infection?2) The Mge isolates analyzed were recovered by co-culture of processed patient urine with Vero cells (L120-133). The possible impact of co-culture with Vero cells (three or more weeks) on sequence variation is also matter of concern (L272-282). In this regard, could this step introduce some bias in the sequence variants identified? For example, selecting for adhesin variants with increased adherence capacity or some other feature important for in vitro survival. Therefore, was this co-culture strictly necessary? Can DNA from Mge be extracted/sequenced directly from a patient sample (for example the urine pellets after centrifugation)? In addition, why was only culture supernatants used to isolate DNA (L131)? I do not have experience isolating Mge clinical strains but, shouldn’t the bacteria be attached to Vero cells?3) The current study seems appropriate to determine the extent of sequence variation in the adhesin genes over time in men with NGU persistently infected with Mge (L174). However, the relationship between the observed changes and antigenic variation, and the impact on antibody recognition in less apparent. In this sense, all evidences are indirect. Even if amino acid changes localize (in general) to regions predicted as epitopes, no direct evidence is provided that these changes effectively avoid antibody recognition. Therefore, all conclusions on this regard must be limited and presented as a possibility rather than a fact.To establish a solid relationship between sequence variation and antibody recognition, direct evidence is required. For example, for each particular Mge isolate, is it possible to test if patient serum from Visit 1 is less or non-reactive against MgpB or MgpC variants predominantly expressed at Visit 3? To test this, can the Mge strains expressing the adhesin variants predominant at Visit 3 be isolated and used as template (whole cell lysates) for western blotting analysis using sera from Visit 1? Alternatively, is it possible to generate Mge mutants expressing these new variants that could be analyzed by western blotting instead of G37 whole cell lysates? Moreover, could the predominant variants (MgpB/MgpC) identified at Visit 3 be expressed as recombinant proteins (heterologous expression) and used to demonstrate loss of recognition by serum from Visit 1?Minor points:Why are Figure legends embedded within the manuscript?L64 “is affected by two mechanisms”: rather than two mechanisms, I think antigenic and phase variation are two processes or even purposes.L99 “Among the four”. New paragraph.L135 “three (or ten weeks)”. When ten?L207-217. This is Methods rather than Results?L224 “consistent with immune selection against specific epitopes”. Could sequence variation have other purposes? Perhaps not all sequence changes are aimed to avoid immune system recognition and are negatively/positively selected by other forces with different purposes.L226 “the predominant sequence”. Are “predominant sequences” much more abundant than other sequences in each sample? Can the authors show the % of identification of the predominant sequence for each isolate and time point? Were mixtures often identified (other than for patient 43 Visit 1)?**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.28 Sep 2020Response to ReviewersPONE-D-20-17903Sequence variation and immunogenicity of the Mycoplasma genitalium MgpB and MgpC adherence proteins during persistent infection of men with non-gonococcal urethritisWe thank the reviewers for their thorough critique of our manuscript. We have incorporated their suggestions as outlined below.Editor comment regarding data not shown:Response: We have briefly explained these data in Results.Reviewer 11. Introduction. Since there are a number of different protein names used for MgpB and MgpC, it would be informative to include these in parentheses the first time the proteins are introduced (e.g. L57; for example include MG numbers and P110 etc).Response: These designations have been added.2. L68 The term MgPars is introduced here, without any information provided about their nature.Response: We have expanded the description of the MgPars.3. L70 It is not clear how recombination mediated antigenic variation and the “exchange of large regions of mgpBC with single or multiple MgPars” i.e. phase variation, are actually different processes. Is it the length of the region shuffled? In which case this third mechanism of phase variation would seem to be one extreme end of the antigenic variation recombination spectrum. This distinction was unclear when I read it.Response: Our previous publication (Burgos et al 2018) describes multiple ways in which recombination can produce phase variants. We have revised this paragraph in Introduction to clarify the differences between antigenic and phase variation.4. L71 It is not clear how recA (the primary mechanism for these phenomena) can generate point mutations (L70) unless some of the MgPars carry such isolated mutations.Response: We did not mean to imply that RecA generates point mutations, and have revised that sentence to clarify. RecA is required for most antigenic and phase variants, but a small number of variants arise in recA mutants. However, it is also true that point mutations can be found in the MgPars which prevent MgpB/C expression when recombined into the expression site.5. L83. This might be interpreted that immune selection is causing the variation directly, whereas presumably it is the driver of selecting against the previous antigenic epitopes.Response: We have revised this sentence.6. L134. Please include the name of the PCR polymerase (hi fidelity? ) and the typical number of cycles that were necessary to amplify the variable regions. These points are important when trying to assess the sequence variation obtained.Response: These details have been added. We used Platinum PCR SuperMix High Fidelity and 30 cycles of amplification.7. L30 and L135. As you read the methods, there are day numbers that seem discrepant. On L30, DNA is prepared from co-cultured cells after day 7, 14, 21, 28 but then on L135 the templates are from three or 10 weeks.Response: Sorry for the confusion. All strains were analyzed after three weeks in culture. One strain was further subcultured twice (for a total of ten weeks in vitro) to determine if variants arose during Vero coculture. We have clarified this in the methods.8. L147. The authors state that the conserved regions of mgpB for these isolates were reported in ref 27. Table S3 from that paper seems to include variable regions also, so it is not 100% clear what was reported before and what is new (in regards to variable sequences in MgpB).Response: Only the conserved sequences of mgpB and mgpC for these patient isolates are included in our prior publication. For clarity, we have changed the patient designations in the current manuscript (Patients 43, 47, 68 and 70) so that they match our previous publication (Patients 10366, 10378, 10467, and 10477, respectively).9. L189 and ref 37. How many different strain types are known? And how many different strains can have the same “strain type”? Although it is possible that the strain typing shows that a “single strain across all time points” was present, it does not categorically prove that. It would be more accurate to state that only a single strain type was detected. Also L352 “with a single persistent strain type…”?Response: We have modified as suggested to “only a single strain type was detected”. Dozens of M. genitalium strain types have been described, and this strain typing method has been used in several studies to confirm sexual transmission M. genitalium, track the development of antimicrobial resistance during treatment, and distinguish persistent infection from reinfection. In the particular study from which these strains were obtained, we found 26 strain types among the 46 men tested (Totten et al, manuscript in prep). In all cases of persistent NGU, the same M. genitalium strain type was detected at multiple clinic visit.10. Most of the sequence analysis comes from clones of PCR products obtained from co-cultured cells and uses the 3 week DNA prep. Was insufficient DNA recoverable at earlier times (the methods indicate that day 7 and day 14 DNA preps were made, but these were not characterized)? What was the rationale for this?Response: In future studies, we intend to study the effect of patient sera on viable cells of the M. genitalium strains isolated from patients at different clinic visits to determine if antibody reactivity correlates with loss of particular variants from patient specimens. We therefore determined sequences for the Vero coculture time point with the maximum number of M. genitalium cells (corresponding to late log phase) for our analysis. The weekly DNA preps were used for qPCR to confirm growth (increase in genomes) of the M. genitalium strains from patient urine. We have edited this paragraph for clarity.11. Is the recombination reciprocal and do the authors have data from any of the MgPar sites?Response: We have not sequenced the MgPars from these isolates to confirm whether recombination was reciprocal in these variants. In addition, as these are mixed populations it would be difficult to sort out which MgPar sequences corresponded to particular expression site sequences in a single cell.Minor points1. L47 Should “Chlamydia” be italicized?Response: We have edited to: Chlamydia trachomatis.2. L99 versus L121. There is variable hyphenation usage in “co-culture”. Please use one style throughout.Response: We have changed to “coculture”.3. L119, L124, L132, L137. Please provide ECL and pCR2.1 supplier details and check to see if company locations are required for ATCC, Epicentre and PCR enzyme (see point 6 above)Response: We have added supplier names and locations as suggested.4. Figure 2-indicate what he “Rb” refers to in the legend.Response: “Rb” refers to rabbit, we have added this to Figure 2 legend.5. L402 i.e. (should this be italicized)?Reponse: no6. L416 should “in silico” be italicized?Response: We have italicized “in silico”.Reviewer #2However, the amount of patients used (four) in the study is maybe a bit too small and the novelty of results limited.Response: We agree that it would be informative to obtain this information from more patients, however, given the imperative to treat M. genitaliuminfection when detected in symptomatic patients it is rare to obtain consecutive specimens from individual patients, and even more uncommon to obtain corresponding serum.It would be nice to indicate at some point in the text the alternative nomenclature of P140 and P110 for MgpB and MgpC, respectively.Response: We have added these alternative nomenclatures.In the work the analysis is performed in parallel for MgpB and MgpC, except for the mapping of the variant amino acids onto the protein structure that is only done for MgpC. Since some weeks ago the structure of MgpB was published and it is now also available. In my opinion the mapping of variants should now also be done for MgpB and included in this work.Response: The analysis of MgpB epitopes (and antibody reactivity) is planned for future experiments and will be published separately once complete. The ongoing COVID pandemic and the closure of our research building due to a radiation spill currently limit progress on this goal.Reviewer #31) To identify sequence variants (L134-141 and L207-217), the authors use PCR amplification, followed by cloning and Sanger sequencing of multiple plasmids (around 75). The number of individual clones analyzed seems sufficient to obtain a representative view of the predominant sequence variants present at each time point. However, clone selection is always a matter of concern. Therefore, could Next Generation Sequencing technology have been used to analyze the different PCR amplicons? If so, do the authors think that the use of NGS could impact or improve the results presented in this study? Could the use of NGS benefit future studies addressing sequence variation of Mge during persistent infection?Response: We appreciate this comment, and in fact attempted a similar analysis using PacBio SMRT sequencing, however, in complex mixtures of variants, PCR amplicons are predominantly heteroduplexes which was incompatible with the PacBio sequence read algorithm used at that time (See Verhey et al, PMID: 29740915). Illumina-type, short-read sequencing would not be able to distinguish between variable sequences located in the expression site from those located in the MgPars (and not expressed). Targeted Nanopore sequencing strategies are planned for future experiments. We considered that bias might be introduced during PCR and cloning and for this reason used a strategy where each variable region was amplified with two differ primer pairs for each variable region; similar sequences were obtained with both primer pairs for all four patients analyzed.2) The Mge isolates analyzed were recovered by co-culture of processed patient urine with Vero cells (L120-133). The possible impact of co-culture with Vero cells (three or more weeks) on sequence variation is also matter of concern (L272-282). In this regard, could this step introduce some bias in the sequence variants identified? For example, selecting for adhesin variants with increased adherence capacity or some other feature important for in vitro survival. Therefore, was this co-culture strictly necessary? Can DNA from Mge be extracted/sequenced directly from a patient sample (for example the urine pellets after centrifugation)? In addition, why was only culture supernatants used to isolate DNA (L131)? I do not have experience isolating Mge clinical strains but, shouldn’t the bacteria be attached to Vero cells?Response: As mentioned above (see Reviewer 1, comment 10), one of our future goals is to determine if antibodies (from patients or immunized rabbits) targeting a particular sequence will kill M. genitaliumpatient isolates expressing that sequence but not cells expressing a variant sequence. Direct analysis of patient urine specimens would include DNA from both live and dead M. genitalium which could confuse the interpretation of these experiments.The reviewer is correct that M. genitalium cells are adherent to Vero cells, however, after 21 days of coculture the Vero cells have detached from the plastic so M. genitalium adhered to Vero cells, and M. genitalium present in the supernatant would both be included in sequence analysis, this important detail has been added to Methods.3) The current study seems appropriate to determine the extent of sequence variation in the adhesin genes over time in men with NGU persistently infected with Mge (L174). However, the relationship between the observed changes and antigenic variation, and the impact on antibody recognition in less apparent. In this sense, all evidences are indirect. Even if amino acid changes localize (in general) to regions predicted as epitopes, no direct evidence is provided that these changes effectively avoid antibody recognition. Therefore, all conclusions on this regard must be limited and presented as a possibility rather than a fact.To establish a solid relationship between sequence variation and antibody recognition, direct evidence is required. For example, for each particular Mge isolate, is it possible to test if patient serum from Visit 1 is less or non-reactive against MgpB or MgpC variants predominantly expressed at Visit 3? To test this, can the Mge strains expressing the adhesin variants predominant at Visit 3 be isolated and used as template (whole cell lysates) for western blotting analysis using sera from Visit 1? Alternatively, is it possible to generate Mge mutants expressing these new variants that could be analyzed by western blotting instead of G37 whole cell lysates? Moreover, could the predominant variants (MgpB/MgpC) identified at Visit 3 be expressed as recombinant proteins (heterologous expression) and used to demonstrate loss of recognition by serum from Visit 1?Response: We agree with the reviewer’s comments and are working towards this evidence (see lines 478-481). The dependence of clinical isolates on Vero coculture for growth (and the protein contributed by these cells), and the low yield of M. genitalium from these cultures, makes it difficult to obtain enough whole cell lysate to analyze by Western blot. The experiments to express recombinant proteins of variable sequences are underway, however, these will necessarily measure reactivity to primarily linear (rather than conformational) epitopes. For this reason, in future experiments, we will replace the M. genitalium type strain (G37) variable regions with Visit 1 or Visit 3 specific sequences and measure biologic activity of patient antibodies to these engineered strains.We agree that our analysis provides indirect evidence that antibodies select against particular sequences; it was not our intention to present this as fact. See for example, line 36, “these findings support the hypothesis”, line 105 “consistent with a model”, and line 529-31 “Further studies are needed to determine if epitopes predicted in silico are indeed targeted by host antibodies...”. Further, we have changed “substantiate” to “support” in the Abstract (line 36).Minor points:Why are Figure legends embedded within the manuscript?Response: PLOS One requires them to be there.L64 “is affected by two mechanisms”: rather than two mechanisms, I think antigenic and phase variation are two processes or even purposes.Response: This sentence has been revised, see response to Reviewer 1 aboveL99 “Among the four”. New paragraph.Response: DoneL135 “three (or ten weeks)”. When ten?Response: Ten weeks refers to three serial passages of 3-4 weeks each. This has been clarified in the resubmission, see response to Reviewer 1, comment 7.L207-217. This is Methods rather than Results?Response: We prefer to keep this section in Results rather than Methods because we present results of sequencing two different PCR products for each region.L224 “consistent with immune selection against specific epitopes”. Could sequence variation have other purposes? Perhaps not all sequence changes are aimed to avoid immune system recognition and are negatively/positively selected by other forces with different purposes.Response: It has previously been suggested that variation may affect MgpBC function, for example, adherence to different host receptors. However, the recent discovery that the sialic acid binding site is composed of absolutely conserved amino acids in MgpC, and the fact that antigenic variants analyzed in vitro maintain their adherent phenotype sows doubt on that theory. Furthermore, the tremendous diversity of variable regions within and between strains (changing a few to dozens of amino acids) makes it unlikely that variants would perform different functions from each other. Nonetheless, variation may indeed have an as yet unidentified purpose other than immune evasion which is why we are careful to say that our observations are consistent with immune selection rather than proving immune selection.L226 “the predominant sequence”. Are “predominant sequences” much more abundant than other sequences in each sample? Can the authors show the % of identification of the predominant sequence for each isolate and time point? Were mixtures often identified (other than for patient 43 Visit 1)?Response: This relative proportions of the different variants is displayed in Figures 3 and 4; each line represents a single sequence with the most abundant sequence indicated by the lines without colored bars. We considered presenting the various percentages of each variant, however, simple percentages don’t reflect the true similarity/diversity of the variants. For example, sequences with single amino acid change or multiple amino acid changes would both be counted as “variants” but multiple amino acid changes would likely have a larger effect on antigenicity and therefore antibody reactivity. Mixtures of variants were identified in all four patients as shown in Figures 3 and 4.Submitted filename: Response to Reviewers PONE-D-20-17903.docxClick here for additional data file.30 Sep 2020Sequence variation and immunogenicity of the Mycoplasma genitalium MgpB and MgpC adherence proteins during persistent infection of men with non-gonococcal urethritisPONE-D-20-17903R1Dear Dr. Wood,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Catherine A. Brissette, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:2 Oct 2020PONE-D-20-17903R1Sequence variation and immunogenicity of the Mycoplasma genitalium MgpB and MgpC adherence proteins during persistent infection of men with non-gonococcal urethritisDear Dr. Wood:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Catherine A. BrissetteAcademic EditorPLOS ONE
Authors: Craig R Cohen; Lisa E Manhart; Elizabeth A Bukusi; Sabina Astete; Robert C Brunham; King K Holmes; Samuel K Sinei; Job J Bwayo; Patricia A Totten Journal: Lancet Date: 2002-03-02 Impact factor: 79.321
Authors: Liang Ma; Jørgen S Jensen; Miriam Mancuso; Ryoichi Hamasuna; Qiuyao Jia; Chris L McGowin; David H Martin Journal: PLoS One Date: 2010-12-20 Impact factor: 3.240
Authors: Maria C Fookes; James Hadfield; Simon Harris; Surendra Parmar; Magnus Unemo; Jørgen S Jensen; Nicholas R Thomson Journal: BMC Genomics Date: 2017-12-28 Impact factor: 3.969
Authors: Pam Sonnenberg; Catherine A Ison; Soazig Clifton; Nigel Field; Clare Tanton; Kate Soldan; Simon Beddows; Sarah Alexander; Rumena Khanom; Pamela Saunders; Andrew J Copas; Kaye Wellings; Catherine H Mercer; Anne M Johnson Journal: Int J Epidemiol Date: 2015-12 Impact factor: 7.196