Literature DB >> 33002344

Screening lncRNAs with diagnostic and prognostic value for human stomach adenocarcinoma based on machine learning and mRNA-lncRNA co-expression network analysis.

Qun Li1, Xiaofeng Liu1, Jia Gu2, Jinming Zhu3, Zhi Wei1, Hua Huang1.   

Abstract

BACKGROUND: Stomach adenocarcinoma (STAD), is one of the most lethal malignancies around the world. The aim of this study was to find the long noncoding RNAs (lncRNAs) acting as diagnostic and prognostic biomarker of STAD.
METHODS: Base on TCGA dataset, the differentially expressed mRNAs (DEmRNAs) and lncRNAs (DElncRNAs) were identified between STAD and normal tissue. The machine learning and survival analysis were performed to evaluate the potential diagnostic and prognostic value of lncRNAs for STAD. We also build the co-expression network and functional annotation. The expression of selected candidate mRNAs and lncRNAs were validated by Quantitative real-time polymerase chain reaction (qRT-PCR) and GSE27342 dataset. GSE27342 dataset were also to perform gene set enrichment analysis.
RESULTS: A total of 814 DEmRNAs and 106 DElncRNAs between STAD and normal tissue were obtained. FOXD2-AS1, LINC01235, and RP11-598F7.5 were defined as optimal diagnostic lncRNA biomarkers for STAD. The area under curve (AUC) of the decision tree model, random forests model, and support vector machine (SVM) model were 0.797, 0.981, and 0.983, and the specificity and sensitivity of the three model were 75.0% and 97.1%, 96.9% and 96%, and 96.9% and 97.1%, respectively. Among them, LINC01235 was not only an optimal diagnostic lncRNA biomarkers, but also related to survival time. The expression of three DEmRNAs (ESM1, WNT2, and COL10A1) and three optimal diagnostic lncRNAs biomarkers (FOXD2-AS1, RP11-598F7.5, and LINC01235) in qRT-PCR validation was were consistent with our integrated analysis. Except for FOXD2-AS1, ESM1, WNT2, COL10A1, and LINC01235 were upregulated in STAD, which was consistent with our integration results. Gene set enrichment analysis results indicated that DNA replication, Cell cycle, ECM-receptor interaction, and P53 signaling pathway were four significantly enriched pathways in STAD.
CONCLUSION: Our study identified three DElncRNAs as potential diagnostic biomarkers of STAD. Among them, LINC01235 also was a prognostic lncRNA biomarkers.
© 2020 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals LLC.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33002344      PMCID: PMC7667366          DOI: 10.1002/mgg3.1512

Source DB:  PubMed          Journal:  Mol Genet Genomic Med        ISSN: 2324-9269            Impact factor:   2.183


INTRODUCTION

Stomach adenocarcinoma (STAD), the predominant subtype in stomach cancer, is one of the major malignancies in the world (Gu et al., 2017). At present, the main treatment of STAD has been gastrectomy accompanied by chemotherapy and radiation therapy. Due to the no symptoms or no specific symptoms of the disease in its early stages, 80% of patients are diagnosed at advanced stages (Cancer Genome Atlas Research Network, 2014). In spite of advancements have been made with treatment, the survival of STAD patient remains low (Cervantes et al., 2013; Siegel et al., 2014). Hence, searching for new diagnosis and prognosis biomarkers of STAD are urgent issues. With the advances of microarray technology, bioinformatics have become most usually used tool to obtain potential biomarkers in multiple diseases (Wang et al., 2015, 2019; Yang & Li, 2019). Mounting evidence demonstrates that long noncoding RNA (lncRNA) is closely relevant to the biological processes in cancers, such as tumor occurrence, development, and metastasis (Dey et al., 2014; Gu et al., 2017). In recent years, many lncRNAs has been identified as novel candidate biomarkers for diagnostic and prognostic of various cancer (Pan et al., 2019; Wei et al., 2019; Zeng et al., 2017). However, to our knowledge, there are few study on lncRNA biomarkers in STAD is rare. Bioinformatic analysis of the Cancer Genome Atlas (TCGA) datasets has been proven to be a novel tool in seeking diagnostic and prognostic markers for a variety of malignancies (Ding et al., 2017; Tsai et al., 2016). Machine learning is considered to be one of the most accurate prediction methods, with the ability to determine the importance of variables and to model complex interactions between independent variables (Cutler et al., 2007). In this study, aiming to identify the diagnostic and prognostic lncRNAs biomarkers in STAD patients, we applied the bioinformatics analysis according to the lncRNA and mRNA expression profiles derived from TCGA dataset. We performed the machine learning and survival analysis to evaluate the potential diagnostic and prognostic value of lncRNAs for STAD. The DElncRNA‐DEmRNA co‐expression network was structured by Pearson correlation coefficient. The functions of the DEmRNAs co‐expressed with the identified optimal diagnostic lncRNAs in STAD was analyzed by functional annotation. The expression levels of ESM1 (MIM#: 601521), WNT2 (MIM#: 147870), COL10A1 (MIM#: 120110), FOXD2AS1, RP11‐598F7.5, and LINC01235 were verified by qRT‐PCR. To our knowledge, this is first time to seek diagnostic and prognostic lncRNAs biomarkers in STAD by using machine learning.

MATERIALS AND METHODS

Integrated profiles in TCGA

The lncRNA expression profiles (Level 3‐IlluminaHiSeq‐lncRNASeq data) and mRNA expression profiles (Level 3‐IlluminaHiSeq‐mRNASeq data) and correlated clinical information were download from the Cancer Genome Atlas (TCGA) (http://tcga-data.nci.nih.gov/) through Genomic Data Commons tool. The present study included only patients who were histologically diagnosed as STAD. Finally, 375 STAD tissues and 32 normal adjacent samples from patients with STAD were included in this study.

Identification of DEmRNAs and DElncRNAs

The RNA‐Seq expression datasets were downloaded, and then, transformed from Fragments Per Kilobase Million (FPKM) data into Transcripts Per Kilobase Million (TPM) data. TPM has been considered to be more comparable than FPKM and reads per kilobase of transcript per million mapped reads (RPKM) (Li et al., 2010). Log2 of its TPM value was used as the measure of mRNAs and lncRNAs expression level here. The DElncRNAs and DEmRNAs in STAD compared to adjacent normal tissues were calculated using the R package DESeq2. Benjamini and Hochberg multiple testing method was applied to acquire the false discovery rate (FDR). FDR <.05 and |Log2fold change|>2 were used to define DElncRNAs and DEmRNAs. Hierarchical clustering analysis of DElncRNAs and DEmRNAs were further performed by using R package v3.3.3 (https://www.r-proje​ct.org/).

Identification of the optimal diagnostic lncRNAs biomarkers for STAD

LASSO algorithm was conducted by the glmnet package (https://cran.r-proje​ct.org/web/packa​ges/glmne​t/) to decrease dimensions of the data. We also performed Elastic net to decrease dimensions of the data. We performed single 10‐fold cross‐validation cycles with the coordinate descent algorithm for each fold and found regularization parameters that result in the smallest average mean squared errors across all folds. The optimal DElncRNAs were selected in STAD and normal tissue. To further identify the optimal diagnostic lncRNA biomarkers for STAD, we performed feature selection procedures as follows. (1) The importance value of each lncRNA was ranked according to mean decrease in accuracy from large to small by random forest algorithm. (2) The optimum number of features was found by adding a DElncRNA at a time in the top‐down forward‐wrapper packaging method. (3) By using support vector machine (SVM) at each increment and the optimal diagnostic lncRNA biomarkers were identified for STAD. The “random Forests” packet (https://cran.r-proje​ct.org/web/packa​ges/rando​mFore​st/) was used to establish the random forest model. The “rpart” packet (https://cran.r-proje​ct.org/web/packa​ges/rpart/) was used to build the decision tree model. The e1071 package (https://cran.r-proje​ct.org/web/packa​ges/e1071/​index.html) in R was used to establish the SVM model. Diagnostic ability of these three models, and each lncRNA biomarker was evaluated by acquiring the area under the receiver operating characteristic (ROC) curve (AUC), sensitivity, and specificity. By using pROC package in R language, we performed the ROC analyses to assess the diagnostic value of lncRNA biomarker. The AUC under binomial exact confidence interval was calculated and ROC curve was produced.

Survival analysis of optimal diagnostic lncRNAs biomarkers for STAD

To determine the potential association between the identified DElncRNAs and survival in STAD patients, survival analysis (https://cran.r-proje​ct.org/web/packa​ges/survi​val/index.html) in R was performed.

DEmRNAs co‐expressed with the identified optimal diagnostic lncRNAs

The correlation between the optimal diagnostic lncRNAs and DEmRNAs were analyzed by the Pearson correlation coefficient. The threshold for DElncRNA‐DEmRNA co‐expression pairs was p < 0.05 and R > 0.5. We used the Cytoscape software (http://www.cytos​cape.org/) to build the DElncRNA‐DEmRNA co‐expression network.

Functional annotation of DEmRNAs co‐expressed with the identified optimal diagnostic lncRNAs

Gene Ontology (GO) classification and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were performed using Metascape (http://metas​cape.org/gp/index.html). p < 0.05 was considered to indicate a statistically significant difference.

Confirmation by qRT‐PCR

Base on the results of TCGA integration analysis, three DEmRNAs (ESM1, WNT2, and COL10A1) and three optimal diagnostic lncRNAs biomarkers (FOXD2AS1, RP11‐598F7.5, and LINC01235) were screened as candidate mRNAs and lncRNAs. Twelve tissues samples of STAD patients (n = 6) and normal adjacent (n = 6) were obtained. This study was approved by the Institutional Ethics Committees of the 960th Hospital of the PLA Joint Logistics Support Force and complied with the Declaration of Helsinki. All the participants had signed a written informed. Total RNA was extracted from samples using a RNA simple total RNA kit (Tiangen, China). RNA was reverse‐transcribed using a Fast Quant RT Kit (Tiangen, China) according to the manufacturer's instructions. Quantitative real‐time PCR were conducted using the Super Real PreMix Plus SYBR Green (Tiangen, China) on ABI 7500 real‐time PCR system. The 2−∆∆Ct method was used to analyze the relative quantification of mRNA and lncRNA levels. Each sample was analyzed in triplicate. The PCR primers used are listed in Table 1. The human ACTB were used as endogenous controls for mRNA and lncRNA expression in analysis.
TABLE 1

Primer sequences used for qRT‐PCR

NameSequence (5′ to 3′)
ACTB‐FCATGTACGTTGCTATCCAGGC
ACTB‐RCTCCTTAATGTCACGCACGAT
ESM1‐FCAGTGAGTGCAAAAGCAGCC
ESM1‐RTCCTCCCCATTAGAAGGCTGA
WNT2‐FTCTCGGTGGAATCTGGCTCTGG
WNT2‐RTGGCTAATGGCACGCATCACATC
COL10A1‐FCAGGAAAACCAGGCTACGGA
COL10A1‐RCCAGCTGGTCCAACZTCTCC
FOXD2‐AS1‐FTGCATCCTGTGTCCTGTGTC
FOXD2‐AS1‐RCCACTAGGGTCTCGCTGTTG
RP11‐598F7.5‐FGCATGTCTGTCTCAAGCTGC
RP11‐598F7.5‐RTGCAGAAGTTCGTGGAGGAC
LINC01235‐FCGAGACCAGCCTGACCAACATG
LINC01235‐RCTCCTGCCTTAGCCTCCTGAGTAG
Primer sequences used for qRT‐PCR

Validation in the Gene Expression Omnibus (GEO) dataset

GSE27342 dataset was obtained from the GEO (https://www.ncbi.nlm.nih.gov/geo/), which consisted of 80 patients with STAD and 80 normal controls. The GEO dataset GSE27342 was performed to confirm the expression of some DEmRNAs and DElncRNAs.

Gene set enrichment analysis

The samples in the GSE27342 dataset were divided into two groups including 80 patients with STAD and 80 normal controls. Gene set enrichment analysis (http://www.broad​insti​tute.org/gsea/index.jsp) was performed to understand the meaningful KEGG pathway in the two groups. The annotated gene sets of version 6.0 were downloaded from the Molecular Signatures Database (MSigDB; http://softw​are.broad​insti​tute.org/gsea/msigd​b/index.jsp). The inclusion criteria were normalized p < 0.05 and false discovery rate (FDR) <25%.

RESULTS

DEmRNAs and DElncRNAs in STAD

The detailed characteristics of 375 STAD tissues and 32 normal adjacent samples from patients with STAD are listed in Table S1. A total of 814 DEmRNAs (550 downregulated and 264 upregulated mRNAs) and 106 DElncRNAs (55 downregulated and 51 upregulated lncRNAs) between STAD and normal tissue were identified with FDR <0.05 and |Log2fold change|>2. All DEmRNAs and DElncRNAs between STAD and normal are displayed in Tables S2 and S3, respectively. Hierarchical clustering analysis of the top 100 DEmRNAs and all of DElncRNAs between STAD and normal tissue are demonstrated in Figures 1a,b, respectively.
FIGURE 1

Hierarchical clustering analysis of DElncRNAs and top 100 DEmRNAs between STAD and normal tissues. (a) DEmRNAs. (b) DElncRNAs. Row and column represented DElncRNAs/DEmRNAs and tissue samples, respectively. The color scale represented the expression levels

Hierarchical clustering analysis of DElncRNAs and top 100 DEmRNAs between STAD and normal tissues. (a) DEmRNAs. (b) DElncRNAs. Row and column represented DElncRNAs/DEmRNAs and tissue samples, respectively. The color scale represented the expression levels

Identification of optimal diagnostic lncRNAs biomarkers for STAD

According to reduced dimensions of the data, we obtained 28 and 49 DElncRNAs between STAD and normal tissues by using LASSO algorithm and Elastic net, respectively (Tables 2 and 3). Hierarchical clustering analysis of the 28 DElncRNAs are shown in Figure 2a. The random forest analysis was used to rank the 28 DElncRNAs according to the mean decrease in accuracy (Figure 2b). Ten‐fold cross‐validation result suggested that the average accuracy rate of three DElncRNAs (FOXD2AS1, LINC01235, and RP11‐598F7.5) reached the higher score for the first time (Figure 2c). Base on the Elastic net, 10‐fold cross‐validation result also suggested that the average accuracy rate of three DElncRNAs (FOXD2AS1, LINC01235, and RP11‐598F7.5) reached the higher score for the first time (Figure S1). Hierarchical clustering analysis of the three DElncRNAs (FOXD2AS1, LINC01235, and RP11‐598F7.5) are displayed in Figure 2d. Therefore, these three DElncRNAs were determined as the optimal diagnostic lncRNA biomarkers for STAD which were used to establish the random forests, decision tree, and SVM models. Hierarchical clustering analysis of these three DElncRNAs between STAD and normal tissue are displayed in Figure 2d. Box‐plot uncovered the expression levels of these three DElncRNAs between STAD and normal tissues (Figure 2e–g). The AUC of the decision tree model was 0.797 and the specificity and sensitivity of this model were 75.0% and 97.1%, respectively (Figure 3a). The AUC of the random forests model was 0.981 and the specificity and sensitivity of this model were 96.9% and 96%, respectively (Figure 3b). The AUC of the SVM model was 0.983 and the specificity and sensitivity of this model were 96.9% and 97.1% (Figure 3c). The AUC of all these three lncRNAs (FOXD2AS1, LINC01235, and RP11‐598F7.5) were also above 0.916 (Figure 3d–f). Taken together, the AUC of all these three lncRNAs and their combination were all greater than 0.79 which indicated the FOXD2AS1, LINC01235, and RP11‐598F7.5 and their combination were related to STAD and could predict the occurrence of STAD.
TABLE 2

DElncRNAs between STAD and normal tissues after reduced dimensions of data by LASSO algorithm

Symbollog2FoldChange p‐valueFDRUpdown
FOXD2‐AS12.1393277512.28E‐312.63E‐28Up
IL12A‐AS1−3.3401808885.18E‐314.78E‐28Down
AC090616.2−2.2658961341.14E‐298.77E‐27Down
RP11‐598F7.52.3743311162.37E‐271.37E‐24Up
ADAMTS9‐AS1−2.7505384613.62E‐271.86E‐24Down
DLGAP1‐AS22.0435035442.23E‐256.44E‐23Up
RP11‐613D13.8−2.4236095752.96E‐247.19E‐22Down
LINC02158−2.2454297643.21E‐247.39E‐22Down
AL928768.3−3.7031977881.06E‐221.96E‐20Down
LINC012352.539911335.63E‐228.95E‐20Up
LINC01336−2.5497641945.00E‐205.12E‐18Down
AC015849.162.2564258669.54E‐209.36E‐18Up
RNF144A‐AS12.1392123527.70E‐196.96E‐17Up
C5orf66‐AS1−3.1872198969.81E‐198.53E‐17Down
CDKN2B‐AS1−2.5871073472.91E‐182.27E‐16Down
LINC01697−2.7477335679.67E‐186.73E‐16Down
AC073283.72.0816553862.20E‐161.18E‐14Up
LINC00982−2.3068501931.49E‐156.46E‐14Down
RP11‐963H4.3−2.0224007237.67E‐153.00E‐13Down
RP11‐641D5.2−2.0409497271.08E‐143.99E‐13Down
PGM5‐AS1−3.1926761481.26E‐144.58E‐13Down
RP11‐7 K24.3−2.0414964559.89E‐142.90E‐12Down
AC096579.15−2.466341561.27E‐133.67E‐12Down
AC104024.1−2.1119376831.75E‐134.82E‐12Down
PART1−2.315872568.27E‐121.64E‐10Down
C20orf166‐AS1−2.4913646922.57E‐114.40E‐10Down
CASC92.2764943352.79E‐114.69E‐10Up
AF001548.6−2.0813760391.45E‐081.29E‐07Down
TABLE 3

DElncRNAs between STAD and normal tissues after reduced dimensions of data by Elastic net

Symbollog2FoldChange p‐valueFDRUpdown
FOXD2‐AS12.1393282.28E‐312.63E‐28Up
RP11‐598F7.52.3743312.37E‐271.37E‐24Up
LINC012352.5399115.63E‐228.95E‐20Up
AL928768.3−3.70321.06E‐221.96E‐20Down
GAPLINC2.0628591.75E‐181.43E‐16Up
DUXAP83.3164781.22E‐352.80E‐32Up
LINC01336−2.549765.00E‐205.12E‐18Down
DLGAP1‐AS22.0435042.23E‐256.44E‐23Up
LINC01697−2.747739.67E‐186.73E‐16Down
C5orf66‐AS1−3.187229.81E‐198.53E‐17Down
RP1‐60O19.12.7391874.28E‐141.32E‐12Up
RP11‐867G23.10−3.089741.47E‐254.53E‐23Down
ADAMTS9‐AS2−2.158444.67E‐162.24E‐14Down
AC015849.162.2564269.54E‐209.36E‐18Up
RNF144A‐AS12.1392127.70E‐196.96E‐17Up
LINC020862.5255632.62E‐148.68E‐13Up
KRT7‐AS2.2268963.66E‐128.11E‐11Up
AC073283.72.0816552.20E‐161.18E‐14Up
LINC02158−2.245433.21E‐247.39E‐22Down
RP11‐770 J1.3−2.050151.84E‐398.50E‐36Down
PGM5‐AS1−3.192681.26E‐144.58E‐13Down
MEF2C‐AS1−2.090023.43E‐161.76E‐14Down
RBMS3‐AS3−2.25162.02E‐158.47E‐14Down
RP11‐211G23.22.1188642.16E‐125.14E‐11Up
CTD‐2540F13.22.1416029.78E‐186.73E‐16Up
AC108676.12.4417154.71E‐162.24E‐14Up
CASC92.2764942.79E‐114.69E‐10Up
PART1−2.315878.27E‐121.64E‐10Down
TRPM2‐AS2.7483722.12E‐202.39E‐18Up
CTD‐2540F13.22.1416029.78E‐186.73E‐16Up
RP11‐21A7A.2−2.520239.31E‐175.43E‐15Down
IL12A‐AS1−3.340185.18E‐314.78E‐28Down
AC096579.15−2.466341.27E‐133.67E‐12Down
RP11‐641D5.2−2.040951.08E‐143.99E‐13Down
RP11‐963H4.3−2.02247.67E‐153.00E‐13Down
CDKN2B‐AS1−2.587112.91E‐182.27E‐16Down
RP11‐613D13.8−2.423612.96E‐247.19E‐22Down
RP11‐626H12.22.199153.16E‐171.94E‐15Up
AC090616.2−2.26591.14E‐298.77E‐27Down
C20orf166‐AS1−2.491362.57E‐114.40E‐10Down
UBXN10‐AS1−2.770156.71E‐206.73E‐18Down
LINC00671−2.664573.07E‐203.29E‐18Down
LINC00982−2.306851.49E‐156.46E‐14Down
AC104024.1−2.111941.75E‐134.82E‐12Down
SOX21‐AS1−2.181992.01E‐071.34E‐06Down
RP11‐351 J23.1−2.72555.24E‐141.61E‐12Down
AF001548.6−2.081381.45E‐081.29E‐07Down
RP11‐7 K24.3−2.04159.89E‐142.90E‐12Down
RP11‐800A18.4−2.531061.73E‐124.18E‐11Down
FIGURE 2

Identification of optimal lncRNA biomarkers for STAD. (a) Hierarchical clustering analysis of the 28 DElncRNAs. (b) The importance value of each DElncRNA ranked according to the mean decrease in accuracy by using the random forest analysis. (c) The variance rate of classification performance when increasing numbers of the predictive DElncRNAs. (d) Hierarchical clustering analysis of three lncRNAs biomarkers (FOXD2‐AS1, LINC01235, and RP11‐598F7.5). (e–g) Box‐plot displayed the expression levels of three lncRNAs biomarkers between STAD and normal tissues. The x‐axis represented normal and STAD groups. The y‐axis represented gene expression levels

FIGURE 3

ROC analysis of three STAD‐specific lncRNAs biomarkers. The ROC results of these three diagnostic lncRNAs biomarkers (FOXD2‐AS1, LINC01235, and RP11‐598F7.5) their combination based on decision tree model (Figure 3a), support random forest (Figure 3b) and SVM model (Figure 3c) and individual FOXD2‐AS1 (Figure 3d), LINC01235 (Figure 3e), and RP11‐598F7.5 (Figure 3f). The x‐axis shows 1‐specificity and y‐axis shows sensitivity. Figure 3g–i Survival analysis of FOXD2‐AS1, LINC01235, and RP11‐598F7.5

DElncRNAs between STAD and normal tissues after reduced dimensions of data by LASSO algorithm DElncRNAs between STAD and normal tissues after reduced dimensions of data by Elastic net Identification of optimal lncRNA biomarkers for STAD. (a) Hierarchical clustering analysis of the 28 DElncRNAs. (b) The importance value of each DElncRNA ranked according to the mean decrease in accuracy by using the random forest analysis. (c) The variance rate of classification performance when increasing numbers of the predictive DElncRNAs. (d) Hierarchical clustering analysis of three lncRNAs biomarkers (FOXD2AS1, LINC01235, and RP11‐598F7.5). (e–g) Box‐plot displayed the expression levels of three lncRNAs biomarkers between STAD and normal tissues. The x‐axis represented normal and STAD groups. The y‐axis represented gene expression levels ROC analysis of three STAD‐specific lncRNAs biomarkers. The ROC results of these three diagnostic lncRNAs biomarkers (FOXD2AS1, LINC01235, and RP11‐598F7.5) their combination based on decision tree model (Figure 3a), support random forest (Figure 3b) and SVM model (Figure 3c) and individual FOXD2AS1 (Figure 3d), LINC01235 (Figure 3e), and RP11‐598F7.5 (Figure 3f). The x‐axis shows 1‐specificity and y‐axis shows sensitivity. Figure 3g–i Survival analysis of FOXD2AS1, LINC01235, and RP11‐598F7.5 The association between three lncRNAs (FOXD2AS1, LINC01235, and RP11‐598F7.5) and survival in patients with STAD (Figure 3g–i). Only LINC01235 was significantly associated with the prognosis of patients with STAD. A total of three optimal DElncRNA biomarkers for STAD were co‐expressed with 87 DEmRNAs, accounting for 122 DElncRNA‐DEmRNA co‐expression pairs. FOXD2AS1, LINC01235, and RP11‐598F7.5 were co‐expressed with 55, 50, and 17 DEmRNAs, respectively (Figure 4).
FIGURE 4

lncRNAs‐mRNAs co‐expression network. The ellipses and rhombuses were represented the mRNAs and lncRNAs, respectively. Red and green color represented up and downregulation, respectively. The black border indicates top 10 DEmRNAs and DElncRNAs

lncRNAs‐mRNAs co‐expression network. The ellipses and rhombuses were represented the mRNAs and lncRNAs, respectively. Red and green color represented up and downregulation, respectively. The black border indicates top 10 DEmRNAs and DElncRNAs Base on the functional annotation of 87 DEmRNAs co‐expressed with the identified optimal diagnostic lncRNAs (Figure 5), nuclear chromosome segregation, extracellular matrix organization, extracellular matrix, and meiotic cell cycle were significantly enriched GO terms, and TNF signaling pathway, JAK‐STAT signaling pathway, Transcriptional misregulation in cancer, and ECM‐receptor interaction were four significantly enriched pathways.
FIGURE 5

The function annotation of DEmRNAs co‐expressed with the identified optimal diagnostic lncRNAs. The x‐axis shows ‐log P and y‐axis shows GO terms or KEGG pathways. (a) GO terms. (b) KEGG pathways

The function annotation of DEmRNAs co‐expressed with the identified optimal diagnostic lncRNAs. The x‐axis shows ‐log P and y‐axis shows GO terms or KEGG pathways. (a) GO terms. (b) KEGG pathways We performed the confirmation of three DEmRNAs (ESM1, WNT2, and COL10A1) and three optimal diagnostic lncRNAs biomarkers (FOXD2AS1, RP11‐598F7.5, and LINC01235) by qRT‐PCR. Based on TCGA, ESM1, WNT2, COL10A1, FOXD2AS1, RP11‐598F7.5, and LINC01235 were upregulated in STAD compared to adjacent tissues. According to the qRT‐PCR results, ESM1, WNT2, COL10A1, FOXD2AS1, RP11‐598F7.5, and LINC01235 were upregulated which was consistent with the results of TCGA (Figure 6).
FIGURE 6

Validation optimal lncRNA biomarkers in STAD tissue by qRT‐PCR. * indicated p‐value < 0.05

Validation optimal lncRNA biomarkers in STAD tissue by qRT‐PCR. * indicated p‐value < 0.05

Validation in GEO dataset

The expression pattern of selected DEmRNAs (ESM1, WNT2, and COL10A1) and DElncRNAs (FOXD2AS1 and LINC01235) was verified using GSE27342 dataset. The raw data of box‐plots are displayed in Table S4. As shown in Figure 7, FOXD2AS1 was downregulated, which was inconsistent with our integration results. ESM1, WNT2, COL10A1, and LINC01235 were upregulated in STAD, which was consistent with our integration results, suggesting that the results were convincing.
FIGURE 7

Validation in the GEO dataset. The x‐axis shows healthy normal control (blue color) and STAD (red color) groups and y‐axis shows a log2 transformation to the intensities. **indicated p‐value < 0.01, ***indicated p‐value < 0.001

Validation in the GEO dataset. The x‐axis shows healthy normal control (blue color) and STAD (red color) groups and y‐axis shows a log2 transformation to the intensities. **indicated p‐value < 0.01, ***indicated p‐value < 0.001

Gene set enrichment analysis

Gene set enrichment analysis was performed in the present study using the GSE27342 dataset. The enrichment results showed that DNA replication, Cell cycle, ECM‐receptor interaction, and P53 signaling pathway were four significantly enriched pathways (Figure 8).
FIGURE 8

Enrichment plots from gene set enrichment analysis. (a) DNA replication. (b) Cell cycle. (c) ECM‐receptor interaction. (d) P53 signaling pathway

Enrichment plots from gene set enrichment analysis. (a) DNA replication. (b) Cell cycle. (c) ECM‐receptor interaction. (d) P53 signaling pathway

DISCUSSION

STAD is one of the leading causes of cancer death, accounting for about 10% of newly diagnosed cancer (Liu et al., 2018). Therefore, searching for novel diagnosis and prognosis biomarkers of STAD is needed. In this study, the expression profiles of lncRNAs and mRNA in STAD was obtained from TCGA dataset. We identified 814 DEmRNAs (550 downregulated and 264 upregulated mRNAs) and 106 DElncRNAs (55 downregulated and 51 upregulated lncRNAs) of STAD. A total of three optimal diagnostic lncRNA biomarkers, including FOXD2AS1, LINC01235, and RP11‐598F7.5, for STAD were identified by machine learning. KEGG pathway enrichment analysis showed that DEmRNAs was were enriched TNF signaling pathway, JAK‐STAT signaling pathway, Transcriptional misregulation in cancer, and ECM‐receptor interaction, indicating that DElncRNAs and DEmRNAs might play crucial roles by participating in these pathways in STAD. Gu et al. performed the lncRNA and mRNA expression profile of three STAD tissues and three matched adjacent non‐tumor tissues via RNA‐sequencing, and found that the DEmRNAs co‐expressed with DElncRNAs were significantly enriched in JAK‐STAT signaling pathway, which was considered as a signaling pathway associated with STAD (Gu et al., 2017). Li et al. also carried out the RNA‐sequencing in 15 pairs of STAD tissues and the adjacent normal tissues, and found that DEGs of most significantly enriched in ECM‐receptor interaction signaling pathway (Li et al., 2019). The results indicated that our KEGG pathway enrichment analysis results were convincing. To our knowledge, except of FOXD2AS1 and RP11‐598F7.5, the present study was the first to identify the LINC01235 in STAD. At present, FOXD2AS1 have been proven to be abnormally regulated in various human cancers. For instance, Su et al. have demonstrated that FOXD2AS1 promotes the progression of bladder cancer by regulation AKT and E2F1 (Su et al., 2018). Chen et al. have found FOXD2AS1 acts as a tumor promoter in nasopharyngeal carcinoma by modulating miR‐363‐5p/S100a1 signaling pathway (Chen et al., 2018). Ni et al. have found that FOXD2AS1 promotes tumorigenesis and progression of glioma via miR‐185‐5p/HMGA2 axis (Ni et al., 2019). Xu et al. have reported that FOXD2AS1 expression was upregulated in stomach tumor tissues, and FOXD2AS1 promotes carcinogenesis in stomach cancer through EZH2 and LSD1 mediated EphB3 downregulation (Xu et al., 2018). In current study, we found that FOXD2AS1 was upregulated in both TCGA integration analysis and qRT‐PCR validation. LIF co‐expressed with FOXD2AS1 was enriched in TNF signaling pathway and JAK‐STAT signaling pathway. Therefore, we hypothesized that FOXD2AS1 might play pivotal roles in STAD by regulating the TNF signaling pathway and JAK‐STAT signaling pathway. The survival analysis results showed that LINC01235 was significantly associated with the prognosis of patients with STAD, which provide evidence emphasize its prognostic value for STAD. COL10A1 (Type X collagen gene), belongs to the collagen family, has been found in various human cancers (Sole et al., 2014). Huang et al. reported that the high expression of COL10A1 is an independent biomarkers of prognosis and survival in colon cancer patients (Huang et al., 2018). COL10A1 might promote STAD tumor aggressiveness by regulating of the TGF‐β1‐SOX9 axis (Li et al., 2018). In this study, COL10A1 co‐expressed with LINC01235 was enriched in ECM‐receptor interaction pathway. Therefore, we presumed that LINC01235 might be involved in the occurrence of STAD by regulating ECM‐receptor interaction pathway. WNT2, a member of the WNT protein family, is frequently overexpressed in and colorectal cancer and gastric cancer (Katoh, 2001). Zhang et al. found that WNT2 is upregulated in gastric cancer, and WNT2 contributes to promoting the gastric cancer cells migration and invasion abilities (Zhang et al., 2018). In this study, we found that WNT2 was upregulated in both TCGA integration analysis and qRT‐PCR validation. The DElncRNA‐DEmRNA co‐expression network results showed that WNT2 co‐expressed with RP11‐598F7.5. Hence, we hypothesized that RP11‐598F7.5 might play important roles in STAD by regulating WNT2. ESM1 (endothelial cell‐specific molecule‐1) was correlated to tumorigenesis and tumor progression and was regarded as a marker of angiogenesis in various cancer (Miao et al., 2016; Ozaki et al., 2014). Lv et al. demonstrated that ESM1 level is upregulated in gastric cancer patients, and ESM1 can be used as a potential biomarkers for early detection and prognosis of gastric cancer (Lv et al., 2014). ESM1 expressing microvessel density correlates with the expression of vascular endothelial growth factor and is a prognostic factor for survival in gastric cancer (Chang et al., 2016). ESM1 promotes gastric cancer cell proliferation, and ESM1 level is associated with the pathological tumor stage (Zhao et al., 2014). In this study, our results displayed that ESM1 was upregulated in both TCGA integration analysis and qRT‐PCR validation. The results also showed that ESM1 co‐expressed with FOXD2AS1. Therefore, we hypothesized that ESM1 might be involved in initiation and progression of STAD. Recently, Li et al. performed a more comprehensive study, and their study found that MAGI2AS3 was overexpressed in STAD and associated with poor prognosis, and MAGI2AS3 promotes tumor progression through sponging miR‐141/200a to maintain overexpression of ZEB1 in STAD and BRD4 is a transcriptional regulator of MAGI2AS3 in STAD (Li et al., 2020). We are collecting STAD samples to validate the expression of the identified optimal diagnostic lncRNAs in our following research with larger sample size. Then, the biological significances of optimal diagnostic lncRNAs will be investigated in in vivo and in vitro experiments. In summary, our study found three DElncRNAs (FOXD2AS1, LINC01235, and RP11‐598F7.5) with diagnostic value for STAD. Among them, LINC01235 was not only an optimal diagnostic lncRNA biomarkers, but also related to survival time. Our results warrant further studies on these DEmRNAs and DElncRNAs to improve our comprehending of the STAD progression mechanisms. However, there are limitations to our study. First, the sample size for qRT‐PCR confirmation was small and large numbers of STAD samples are needed for further research. Second, optimal diagnostic lncRNAs of STAD were identified and biological functions were not studied. Therefore, in vivo and in vitro experiments were necessary to uncover the biological functions of optimal diagnostic lncRNAs of STAD in the future work.

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest.

AUTHOR CONTRIBUTIONS

Qun Li and Xiaofeng Liu contributed to the conception of the study. Jia Gu and Jinming Zhu contributed the materials and performed the experiment. Zhi Wei and Hua Huang performed the data analyses. Qun Li and Xiaofeng Liu contributed significantly in writing the manuscript. All authors read and approved the final manuscript. Click here for additional data file. Click here for additional data file. Click here for additional data file. Click here for additional data file. Click here for additional data file.
  33 in total

Review 1.  Long non-coding RNAs as emerging regulators of differentiation, development, and disease.

Authors:  Bijan K Dey; Adam C Mueller; Anindya Dutta
Journal:  Transcription       Date:  2014-10-30

2.  RNA-Seq gene expression estimation with read mapping uncertainty.

Authors:  Bo Li; Victor Ruotti; Ron M Stewart; James A Thomson; Colin N Dewey
Journal:  Bioinformatics       Date:  2009-12-18       Impact factor: 6.937

3.  Endothelial cell-specific molecule-1: a potential serum marker for gastric cancer.

Authors:  Zhongchuan Lv; Yongsheng Fan; Hongbing Chen; Dawei Zhao
Journal:  Tumour Biol       Date:  2014-07-24

Review 4.  Potential Diagnostic, Prognostic and Therapeutic Targets of MicroRNAs in Human Gastric Cancer.

Authors:  Ming-Ming Tsai; Chia-Siu Wang; Chung-Ying Tsai; Hsiang-Wei Huang; Hsiang-Cheng Chi; Yang-Hsiang Lin; Pei-Hsuan Lu; Kwang-Huei Lin
Journal:  Int J Mol Sci       Date:  2016-06-16       Impact factor: 5.923

5.  Identification of key miRNAs and genes associated with stomach adenocarcinoma from The Cancer Genome Atlas database.

Authors:  Jixi Liu; Fang Liu; Yanfen Shi; Huangying Tan; Lei Zhou
Journal:  FEBS Open Bio       Date:  2018-01-02       Impact factor: 2.693

6.  Comprehensive investigation of a novel differentially expressed lncRNA expression profile signature to assess the survival of patients with colorectal adenocarcinoma.

Authors:  Jiang-Hui Zeng; Liang Liang; Rong-Quan He; Rui-Xue Tang; Xiao-Yong Cai; Jun-Qiang Chen; Dian-Zhong Luo; Gang Chen
Journal:  Oncotarget       Date:  2017-03-07

7.  High expression of COL10A1 is associated with poor prognosis in colorectal cancer.

Authors:  Haipeng Huang; Tingting Li; Gengtai Ye; Liying Zhao; Zhenzhan Zhang; Debin Mo; Yiming Wang; Ce Zhang; Haijun Deng; Guoxin Li; Hao Liu
Journal:  Onco Targets Ther       Date:  2018-03-20       Impact factor: 4.147

8.  Wnt2 contributes to the progression of gastric cancer by promoting cell migration and invasion.

Authors:  Zhaoran Zhang; Jinyan Wang; Xiang Dong
Journal:  Oncol Lett       Date:  2018-06-28       Impact factor: 2.967

9.  Serum endocan as a novel prognostic biomarker in patients with hepatocellular carcinoma.

Authors:  Kazuaki Ozaki; Nobuyuki Toshikuni; Joseph George; Takahiro Minato; Yasuhiro Matsue; Tomiyasu Arisawa; Mikihiro Tsutsumi
Journal:  J Cancer       Date:  2014-03-04       Impact factor: 4.207

10.  Screening lncRNAs with diagnostic and prognostic value for human stomach adenocarcinoma based on machine learning and mRNA-lncRNA co-expression network analysis.

Authors:  Qun Li; Xiaofeng Liu; Jia Gu; Jinming Zhu; Zhi Wei; Hua Huang
Journal:  Mol Genet Genomic Med       Date:  2020-10-01       Impact factor: 2.183

View more
  4 in total

1.  Identification of the three subtypes and the prognostic characteristics of stomach adenocarcinoma: analysis of the hypoxia-related long non-coding RNAs.

Authors:  Zehua Fan; Yanqun Wang; Rong Niu
Journal:  Funct Integr Genomics       Date:  2022-06-04       Impact factor: 3.674

Review 2.  Machine Learning for Future Subtyping of the Tumor Microenvironment of Gastro-Esophageal Adenocarcinomas.

Authors:  Sebastian Klein; Dan G Duda
Journal:  Cancers (Basel)       Date:  2021-09-30       Impact factor: 6.575

3.  Screening lncRNAs with diagnostic and prognostic value for human stomach adenocarcinoma based on machine learning and mRNA-lncRNA co-expression network analysis.

Authors:  Qun Li; Xiaofeng Liu; Jia Gu; Jinming Zhu; Zhi Wei; Hua Huang
Journal:  Mol Genet Genomic Med       Date:  2020-10-01       Impact factor: 2.183

4.  Identification of prognostic long non-coding RNA signature with potential drugs in hepatocellular carcinoma.

Authors:  Fengjie Hao; Nan Wang; Xiang Wang; Yongjun Chen; Junqing Wang
Journal:  Aging (Albany NY)       Date:  2021-07-20       Impact factor: 5.682

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.