Literature DB >> 32982443

Abnormal Activations of Super-Enhancers Enhance the Carcinogenicity in Lung Adenocarcinoma.

Jianlong Zhou1,2, Dingxue Wang3, Dongxin Tang3, Wenhua Huang1.   

Abstract

BACKGROUND: Lung tumors and normal lung tissues show large differences in epigenetic modification which can affect the chromosome structure and expression of genes. However, the epigenetic reprogramming in lung adenocarcinoma remains unclear. METHODS AND
RESULTS: With the bioinformatics analysis, we found that some activated super-enhancers (SEs) only appear in lung adenocarcinoma cells, and 781 abnormal activated super-enhancers (AASEs) were found. Not only are the traditional oncogenes found to be activated by AASEs, such as MET and SLC2A1, but also some new genes were activated by AASEs, which probably contributes to the carcinogenic process in lung cancer. The enrichment analysis of the genes activated by AASEs shows that the glycolysis process and cell proliferation were enhanced and the apoptotic process was negatively regulated. Two AASEs were separately knockout by CRISPR/Cas9 in A549, PC-9, and H1299 cell lines and the expression of target genes decreased. The motif of CTCF, SMARCA1, SOX4, FOXM1, IRF3, IRF7, and STAT2 was enriched in AASEs, supporting that the chromosome structure changed and these transcription factors would be the master regulators on the formation of AASEs.
CONCLUSION: This study provided comprehensive insight into the mechanisms of SEs, as well as a potential therapeutic target for lung cancer.
© 2020 Zhou et al.

Entities:  

Keywords:  epigenetic; lung adenocarcinoma; super-enhancer; transcription factors

Year:  2020        PMID: 32982443      PMCID: PMC7501973          DOI: 10.2147/CMAR.S258497

Source DB:  PubMed          Journal:  Cancer Manag Res        ISSN: 1179-1322            Impact factor:   3.989


Introduction

Lung cancer is the most common cause of cancer-related deaths worldwide, and lung adenocarcinoma is the most frequent pathological type in lung cancer.1,2 It is important to investigate the underlying mechanisms of lung tumorigenesis and tumor progression. Lung tumor cells and normal lung cells have very different characteristics, including the histological features, expression of genes, and epigenetic modification of genome.3,4 Super-Enhancers (SEs) are regions of genome comprising multiple individual enhancers which are the key regulatory elements to control tissue-specific transcription. SEs have been identified by locating genomic regions that are highly enriched in the H3K27ac ChIP-Seq signal.5 Compared to typical enhancers, SEs are larger, and exhibit a higher transcription factor and histone modification density. An array of transcription factor proteins bind on SEs and drive transcription of genes involved in cell identity.6–8 In cancer cells, abnormal SEs enhance the expression of critical oncogenes such as CACNA1H, MYC, LMO1, and RARA.9–12 Cancer cells generate new SEs nearoncogenes that are involved in tumor pathogenesis, and the absence of these SEs would reduce by at least 50% the survival rate of cancer cells.9 Accordingly, targeting the SEs and transcription factors on it will be the approaches to cancer diagnosis and clinical therapeutics, including small-molecule inhibitors against super-enhancers binding proteins and gene therapy strategies.13 In the study of SEs in lung cancer, we found hundreds of emerging SEs in lung adenocarcinoma. Abnormal activation of these super-enhancers enhance the expression of oncogenes which would be the cause of lung adenocarcinoma pathogenesis. With the analysis and mining of bioinformation, we got all AASEs and their associated oncogenes in lung adenocarcinoma. The activated biological processes and pathways will show us the major characteristic and new therapeutic target of lung adenocarcinoma. Furthermore, we predicted the transcription factors binding on AASEs, which could be the pathogenic elements and help us understand pathogenesis in lung cancer.

Materials and Methods

Cell Culture

The human A549, PC-9, and H1299 cell lines were obtained from ATCC (American Type Culture Collection). A549 were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS, HyColne, UT, USA) at 37°C in a humidified atmosphere containing 5% CO2. PC-9 and H1299 were cultured in Roswell Park Memorial Institute (RPMI) 1640 (Gibco) containing 10% FBS at 37°C in a humidified atmosphere containing 5% CO2.

Genome Editing

For the knockout of AASEs in A549, two expression cassettes encoding the sgRNA sequences (sgRNA1-MET-AASE CTCCGTTAGAGGCGTGTCAG, sgRNA2-MET-AASE TACTCTTAGTATCCTGACTA; sgRNA1-EGFR-AASE TCATCTTCGATGACTCTGCT, sgRNA1-EGFR-AASE CTCACATGTGTCTATTCGGG) flanking the deletion region were cloned into a plasmid that expresses a codon-optimized version of Cas9. Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) was used to transfect the plasmid into the A549 cells. The transfected A549 cells were selected with puromycin for 2 days. The genotyping primers are as follows: MET-AASE: 5ʹ-AAAGCAGTGGGCATATGGGA-3ʹ (forward), 5ʹ-GTGCTCTAATGCAGGTTGGG-3ʹ (reverse1), 5ʹ-ACCTACTTAGCCTACTCA-3ʹ (reverse2); EGFR-AASE: 5ʹ-TGAGTAGGCTAAGTAGGT-3ʹ (forward), 5ʹ-AAGGCACAGCCCGTGAAAT-3ʹ (reverse1), 5ʹ-CACATTCATGCCACAGAA-3ʹ (reverse2).

Quantitative RT-PCR

Total RNA was purified from A549 with RNeasy Mini Kit (QIAGEN), and total RNA (1 µg) was reversely transcribed into cDNA and analyzed by qPCR. The primers for β-Actin are 5ʹ-GCCAACACAGTGCTGTCT-3ʹ (forward) and 5ʹ-AGGAGCAATGATCTTGATCTT-3ʹ (reverse). The primers for MET are 5ʹ-TGCACAGTTGGTCCTGCCATGA-3ʹ (forward) and 5ʹ-CAGCCATAGGACCGTATTTCGG-3ʹ (reverse). The primers for EGFR are 5ʹ-AACACCCTGGTCTGGAAGTACG-3ʹ (forward) and 5ʹ-TCGTTGGACAGCCTTCAAGACC-3ʹ (reverse). The levels of MET and EGFR mRNA were normalized to those of β-Actin. Changes in mRNA expression were calculated according to the 2−ΔΔCT method (CT, cycle threshold).

Analysis of Gene Expression Profile

The gene expression profiles of lung cancers and matched adjacent non-malignant lung were downloaded from the GEO database (accession: GSE75037 and GSE32863) (). GSE75037 and GSE32863 were based on Illumina WG6-V3 expression arrays, and GSE75037 included 83 lung adenocarcinomas and 83 matched adjacent non-malignant lung tissues, GSE32863 included 58 lung adenocarcinomas and 58 matched adjacent non-malignant lung tissues. Differentially expressed genes between tumors and non-malignant lung tissues were identified using two-group comparisons, and P<0.05 was set as the cutoff criterion.

The Analysis of Super Enhancer and ChIP-Seq Data

The super-enhancer regions of the lung cancer cell line (A549) and normal lung tissue (lung_30y). AASEs were found by calculating the super-enhancer regions which only occur in A549 compared to normal lung tissue though BEDTools.30 The super-enhancer corresponded ChIP-seq data of H3K27ac were obtained from the Encyclopedia of DNA Elements (ENCODE).31 The ChIP-Seq data were displayed using the UCSC Genome Browser (). All analyses were performed using human (build hg19, GRCh37) RefSeq annotations downloaded from the UCSC genome browser.

Functional and Pathway Enrichment Analysis

Panther () was used to class the genes based on Gene Ontology (GO) molecular function. DAVID (, version 6.8) was used for the KEGG pathway and GO analysis for the activated genes. EASE Score, a modified Fisher Exact P-value, is used to measure the gene-enrichment in annotation terms. P-value<0.05 to be considered strongly enriched in the annotation categories.

Construction of Protein–Protein Interaction Network

To further explore the relationships between genes activated by AASEs, the protein–protein interaction network was mapped by (STRING) database () with default parameter and visualized though Cytoscape software ().

Analysis of Motif Enrichment

The AME tool in MEME suite is used to identify motifs that are relatively enriched in the sequences of AASEs with default parameter.32 The motif database is HOCOMOCO Human (v11 CORE).33

Survival Analysis

Kaplan-Meier Plotter is a web tool that predicts the prognostic values of genes in lung cancer patients (). The patients with lung cancer were divided into two groups according to the particular gene expression level (high vs low expression). Based on these categories, overall survival (OS) analysis of the two patient groups was compared by the tool. The HR with 95% CIs and log-rank P-value were calculated and shown.

Results

Abnormal Activation of Super-Enhancers in Lung Adenocarcinoma

Lung tissue and lung tumor share the same genome, their histone modifications such as H3K27ac H3K4me1 are distinct.4 In the research of epigenetic processes in lung cancer, we found some regions of chromosome were overactivated in lung cancer. These regions were largely marked with H3K27ac which is an active enhancer marker in genome and clusters of these enhancers formed new super-enhancers in lung cancers (Figure 1A). The super-enhancers data of lung normal tissue and lung cancer cell lines were obtained from the SEdb database.14 After analysis, we find 781 emerging super-enhancer regions in lung cancer line (A549) (). We can find the abnormally activated super-enhancers (AASEs) emerged in lung cancer and the nearby genes, such as ENO1, MET, EGFR, SLC2A1, and TKT, were over-expression in lung cancer tissues (Figure 1B). These genes are widely recognized for their importance in cancer.
Figure 1

Abnormal activation of super-enhancers in lung cancer. (A) A hypothetical model of how SEs are abnormally activated in lung cancer and induce the overexpression of genes distantly (enhancer) or closely (promoter). (B) Examples of the abnormal activation of super enhancers and the involved genes are overexpressed in lung cancer tissues. The expression of genes came from GSE32863 (58 lung adenocarcinoma and 58 adjacent non-tumor lung tissues).

Abnormal activation of super-enhancers in lung cancer. (A) A hypothetical model of how SEs are abnormally activated in lung cancer and induce the overexpression of genes distantly (enhancer) or closely (promoter). (B) Examples of the abnormal activation of super enhancers and the involved genes are overexpressed in lung cancer tissues. The expression of genes came from GSE32863 (58 lung adenocarcinoma and 58 adjacent non-tumor lung tissues).

AASEs Cause Oncogenesis and Promote Tumor Development

The closest active genes of SEs were obtained from the SEdb database.14 Combining the gene expression data of GSE75037 and GSE32863 which were tested from lung adenocarcinoma tumors and their matched histologically normal adjacent lung tissue samples, we screened 261 genes which were activated by AASEs and over-expressed in lung cancer (Figure 2A and B, ). The major molecular functions of these genes are binding and catalytic activity (Figure 2C). From the results of the protein–protein interaction network, we could find the the HSPA4, HSPB1, EGFR, MAPK6, and MET were in the center of the network (Figure 2D). From the results of the GO biological process and KEGG pathway enrichment analysis, we found these genes were significantly enriched in the glycolysis process, metabolic pathway, negative regulation of apoptotic process, cell proliferation, TGF-β signaling pathway, and VEGF signaling pathway (Figure 3A and B). The over-activated of these genes formed the major characteristic in lung cancer cells.
Figure 2

Genes activated by abnormal SEs in lung cancer. (A) Screening the genes activated by SE which is over-expressed in both two lung cancer databases (GSE75037 and GSE32863). (B) Heatmaps show the expression of screened genes in (A). (C) Molecular function of over-expressed genes activated by AASEs. (D) The protein–protein interaction network of the genes activated by AASEs.

Figure 3

AASEs enhance the carcinogenicity through up-regulation of the involved gene. (A) Enriched Gene Ontology (GO) biological process of over-expressed genes activated by AASEs. (B) Enriched KEGG pathway of over-expressed genes activated by abnormal AASEs.

Genes activated by abnormal SEs in lung cancer. (A) Screening the genes activated by SE which is over-expressed in both two lung cancer databases (GSE75037 and GSE32863). (B) Heatmaps show the expression of screened genes in (A). (C) Molecular function of over-expressed genes activated by AASEs. (D) The protein–protein interaction network of the genes activated by AASEs. AASEs enhance the carcinogenicity through up-regulation of the involved gene. (A) Enriched Gene Ontology (GO) biological process of over-expressed genes activated by AASEs. (B) Enriched KEGG pathway of over-expressed genes activated by abnormal AASEs.

Identify the Activation of AASEs in Lung Adenocarcinoma

To determine whether AASEs could activate the transcription of nearby genes, we knockout the AASEs of MET and EGFR in A549, PC-9, and H1299 cell lines though CRISPR/Cas9-based genome engineering (Figure 4A). The pool of cells after transfection and screening were collected to identity the activation of AASEs near MET and EGFR. The results showed the deletion of AASEs decreased the expression of the MET and EGFR mRNA in A549, PC-9, and H1299 cell lines (Figure 4B).
Figure 4

Identify the activation of AASEs though CRISPR/Cas9-based genome engineering. (A) Knockout the AASEs of MET and EGFR in A549 cell line (MET-E-KO and EGFR-E-KO). Scissors sketch shows the regions that knockout through CRISPR/Cas9 (left). PCR-based genotyping of MET-E-KO and EGFR-E-KO (right). (B) The RNA expressions of MET and EGFR were decreased when their AASEs were deleted (*P<0.05).

Identify the activation of AASEs though CRISPR/Cas9-based genome engineering. (A) Knockout the AASEs of MET and EGFR in A549 cell line (MET-E-KO and EGFR-E-KO). Scissors sketch shows the regions that knockout through CRISPR/Cas9 (left). PCR-based genotyping of MET-E-KO and EGFR-E-KO (right). (B) The RNA expressions of MET and EGFR were decreased when their AASEs were deleted (*P<0.05).

Master Transcription Factors Activate AASEs

Master transcription factors could bind on the SEs and determine the cell type-specific.6 To find which master transcription factors bound on AASEs, we analyzed the motifs of transcription factors which were enriched in the sequences of AASEs (Figure 5A). The most enriched transcription factor is CTCF, which is thought to be in regulating the 3D structure of chromatin and forming enhancer-promoter loops (Figure 5B).15,16 The other enriched transcription factors are SMARCA1, SOX4, FOXM1, IRF3, IRF7, and STAT2, and these factors function in regulating the transcription of genes. Consistent with the mRNA expression data of lung tumor tissues and adjacent non-tumor tissues, SMARCA1, SOX4, FOXM1, IRF3, IRF7, and STAT2 are overexpressed in lung cancer and correlated with the poor prognosis of lung cancer patients, but not CTCF (Figure 5C and D).
Figure 5

The master transcription factors contribute to the AASEs in lung cancer. (A) Motif of enriched transcription factors in AASEs. (B) The enrichment P-value of transcription factors in AASEs. (C) The overexpression of master transcription factors in lung cancer. (D) Log-rank (Mantel Cox) survival test of lung cancer patients based on the levels of IRF7, STAT2, FOXM1, IRF3, SOX4, and SMARCA1 (low expression n=963, high expression n=963).

The master transcription factors contribute to the AASEs in lung cancer. (A) Motif of enriched transcription factors in AASEs. (B) The enrichment P-value of transcription factors in AASEs. (C) The overexpression of master transcription factors in lung cancer. (D) Log-rank (Mantel Cox) survival test of lung cancer patients based on the levels of IRF7, STAT2, FOXM1, IRF3, SOX4, and SMARCA1 (low expression n=963, high expression n=963).

Discussion

Our results identified the AASEs that contribute to the pathogenesis in lung cancers. AASEs promote the initiation and progression of lung cancer by enhancing the expression of genes such as ENO1, MET, EGFR, SLC2A1, and TKT (Figure 1B). New SEs appeared around these genes in lung cancer cells, but not in normal lung tissues. The genes we show in Figure represent the well-known oncogenes: ENO1 is up-regulated in several tumors including breast, lung, prostate, and pancreas, and plays an important role in the Warburg effect in cancer cells.17 Another Warburg effect gene SLC2A1, also known as GLUT1, plays a key role in glucose uptake in many cell types including cancer cells. High expression of SLC2A1 will promote growth and proliferation in cancer cells.18 MET is a proto-oncogene and plays a role in cellular survival, embryogenesis, and cellular migration and invasion.19 Overexpression of MET is also associated with multiple human cancers.20 EGFR (Epidermal growth factor receptor) has been reported to be implicated in the pathogenesis of many human malignancies and promote the metastasis of cancer.21 TKT is a thiamine-dependent enzyme involved in glycolysis and the pentose phosphate pathway which is essential in cancer energy metabolism.22 Furthermore, with the visualization of AASEs regions and ChIP-Seq signal data of H3K27ac, we could find a new activated mechanism of the oncogenes and more genes involved in cancer pathogenesis. We choose two AASEs and knockout them in three lung adenocarcinoma cell lines, the expression of target genes MET and EGFR fell by half. MET and EGFR were well-known oncogenes, and their AASEs regions will be the therapeutic target in lung cancer. To investigate the function and pathway affected by AASEs, enrichment analysis of the genes activated by AASEs was undertaken. The results showed the energy-related processes and pathways appeared frequently. Increased glucose uptake and aerobic glycolysis are the major characteristic in cancer cells.23 The energy metabolism associated genes such as ENO1, SLC2A1, ENO3, G6PD, and TKT were activated by AASEs and over-expressed in lung cancer cells. Meanwhile, cell proliferation was positively regulated and the apoptotic process was negatively regulated in lung cancer cells. In the results of enriched transcription factors on AASEs, we found CTCF to have the minimum P-value. CTCF (CCCTC-Binding Factor) is a multifunctional protein in genome regulation and gene expression.24,25 CTCF can bind and remodel the three-dimensional structure of the genome which promotes the formation of long-range interaction of chromosome.26 A number of studies have demonstrated the co-localization of CTCF and cohesion on chromosomes, suggesting they can steady the chromatin loops between enhancers and promoters and also promote the binding of transcription factors at enhancers.27–29 Therefore, the enrichment of CTCF on AASEs means large changes of chromosome structure happened on AASEs and help the formation of the connections between SEs and promoter of genes. The transcription factors such as IRF7, SOX4, STAT2, and FOXM1 will promote the activation of AASEs and regulate the transcription of downstream genes through long-range interaction. High expression of these transcription factors means poor survival rates in lung cancer patients. They can be biomarkers and therapeutic targets in lung cancer. However, further studies are required to find the mechanism that these transcription factors are activating AASEs by in lung cancer.
  33 in total

1.  Cancer statistics, 2015.

Authors:  Rebecca L Siegel; Kimberly D Miller; Ahmedin Jemal
Journal:  CA Cancer J Clin       Date:  2015-01-05       Impact factor: 508.702

2.  CTCF mediates interchromosomal colocalization between Igf2/H19 and Wsb1/Nf1.

Authors:  Jian Qun Ling; Tao Li; Ji Fan Hu; Thanh H Vu; Hui Ling Chen; Xin Wen Qiu; Athena M Cherry; Andrew R Hoffman
Journal:  Science       Date:  2006-04-14       Impact factor: 47.728

3.  GLUT1 expression in malignant tumors and its use as an immunodiagnostic marker.

Authors:  Kátia C Carvalho; Isabela W Cunha; Rafael M Rocha; Fernanda R Ayala; Mariana M Cajaíba; Maria D Begnami; Rafael S Vilela; Geise R Paiva; Rodrigo G Andrade; Fernando A Soares
Journal:  Clinics (Sao Paulo)       Date:  2011       Impact factor: 2.365

Review 4.  Lung cancer: current therapies and new targeted treatments.

Authors:  Fred R Hirsch; Giorgio V Scagliotti; James L Mulshine; Regina Kwon; Walter J Curran; Yi-Long Wu; Luis Paz-Ares
Journal:  Lancet       Date:  2016-08-27       Impact factor: 79.321

5.  BEDTools: a flexible suite of utilities for comparing genomic features.

Authors:  Aaron R Quinlan; Ira M Hall
Journal:  Bioinformatics       Date:  2010-01-28       Impact factor: 6.937

6.  CTCF-mediated functional chromatin interactome in pluripotent cells.

Authors:  Lusy Handoko; Han Xu; Guoliang Li; Chew Yee Ngan; Elaine Chew; Marie Schnapp; Charlie Wah Heng Lee; Chaopeng Ye; Joanne Lim Hui Ping; Fabianus Mulawadi; Eleanor Wong; Jianpeng Sheng; Yubo Zhang; Thompson Poh; Chee Seng Chan; Galih Kunarso; Atif Shahab; Guillaume Bourque; Valere Cacheux-Rataboul; Wing-Kin Sung; Yijun Ruan; Chia-Lin Wei
Journal:  Nat Genet       Date:  2011-06-19       Impact factor: 38.330

7.  Topological domains in mammalian genomes identified by analysis of chromatin interactions.

Authors:  Jesse R Dixon; Siddarth Selvaraj; Feng Yue; Audrey Kim; Yan Li; Yin Shen; Ming Hu; Jun S Liu; Bing Ren
Journal:  Nature       Date:  2012-04-11       Impact factor: 49.962

8.  Core pluripotency factors promote glycolysis of human embryonic stem cells by activating GLUT1 enhancer.

Authors:  Lili Yu; Kai-Yuan Ji; Jian Zhang; Yanxia Xu; Yue Ying; Taoyi Mai; Shuxiang Xu; Qian-Bing Zhang; Kai-Tai Yao; Yang Xu
Journal:  Protein Cell       Date:  2019-05-31       Impact factor: 14.870

9.  MEME SUITE: tools for motif discovery and searching.

Authors:  Timothy L Bailey; Mikael Boden; Fabian A Buske; Martin Frith; Charles E Grant; Luca Clementi; Jingyuan Ren; Wilfred W Li; William S Noble
Journal:  Nucleic Acids Res       Date:  2009-05-20       Impact factor: 16.971

Review 10.  Targeting Super-Enhancers for Disease Treatment and Diagnosis.

Authors:  Ha Youn Shin
Journal:  Mol Cells       Date:  2018-05-10       Impact factor: 5.034

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.