| Literature DB >> 31152430 |
Lili Yu1, Kai-Yuan Ji2, Jian Zhang1, Yanxia Xu1, Yue Ying1, Taoyi Mai3, Shuxiang Xu1, Qian-Bing Zhang1, Kai-Tai Yao4, Yang Xu5,6.
Abstract
Human embryonic stem cells (hESCs) depend on glycolysis for energy and substrates for biosynthesis. To understand the mechanisms governing the metabolism of hESCs, we investigated the transcriptional regulation of glucose transporter 1 (GLUT1, SLC2A1), a key glycolytic gene to maintain pluripotency. By combining the genome-wide data of binding sites of the core pluripotency factors (SOX2, OCT4, NANOG, denoted SON), chromosomal interaction and histone modification in hESCs, we identified a potential enhancer of the GLUT1 gene in hESCs, denoted GLUT1 enhancer (GE) element. GE interacts with the promoter of GLUT1, and the deletion of GE significantly reduces the expression of GLUT1, glucose uptake and glycolysis of hESCs, confirming that GE is an enhancer of GLUT1 in hESCs. In addition, the mutation of SON binding motifs within GE reduced the expression of GLUT1 as well as the interaction between GE and GLUT1 promoter, indicating that the binding of SON to GE is important for its activity. Therefore, SON promotes glucose uptake and glycolysis in hESCs by inducing GLUT1 expression through directly activating the enhancer of GLUT1.Entities:
Keywords: Glut1; chromosome interaction; enhancer; epigenetics; human embryonic stem cell; metabolism; pluripotency factors; promoter
Year: 2019 PMID: 31152430 PMCID: PMC6711954 DOI: 10.1007/s13238-019-0637-9
Source DB: PubMed Journal: Protein Cell ISSN: 1674-800X Impact factor: 14.870
Figure 1Identification of theenhancer, denoted GE, in hESCs. (A) Integrated analysis to predict the enhancer of GLUT1 in H9 hESCs. Based on the epigenetic signature of enhancers, the blue shaded region is the predicted enhancer of GLUT1 in hESCs. Insulator loop (red line) and cohesin loop (green line) involving the enhancer and promoter of GLUT1 are displayed, the blocks connected by a horizontal line show the interaction of two regions of the genome. Based on the ChIP-seq data, the binding sites for NANOG, OCT4, SOX2 as well as H3K27ac and H3K4me1 around GE are displayed at the top. The co-binding site of SOX2, OCT4 and NANOG (SON) is indicated with a red arrowhead. (B) A hypothetical model how the promoter and enhancer of the GLUT1 gene interact in hESCs. (C) 3C analysis confirmed the long-distance interaction between the promoter and enhancer of the GLUT1 gene. The GLUT1 promoter is indicated by dark blue and target restriction fragments light blue. GE-containing restriction fragment is shaded red. Primers were all forward orientation and positioned at the right end of each restriction fragment. Relative cross-linking value for each restriction fragment was plotted over the 70 kb genomic DNA fragment. Data represent mean ± SEM. n = 3. The value of the crosslinking between promoter and the nearest neighboring fragment is arbitrarily set to 1. (D) ChIP-qPCR assay was used to confirm the binding of SON to GE and the epigenetic signature of GE in hESCs. Data represent mean + SEM. n = 3
Figure 2The predicted enhancer of thegene (GE) is required for the expression of GLUT1 in hESCs. (A) The strategy to delete GE in H9 hESCs using CRISPR/CAS9 technology. The top panel shows the SON binding site and the epigenetic profiles for H3K27ac and H3K4me1. The deleted region is indicated in light blue. (B) Deletion of GE in hESCs reduced the mRNA levels of GLUT1. GE-deleted hESCs are denoted GE-KO hESCs. Data represent mean ± SEM. n = 3. (C) Deletion of GE in hESCs reduced the protein levels of GLUT1. (D) Deletion of GE in hESCs reduced glucose uptake. Data represent mean ± SD. n = 4. (E) Deletion of GE in hESCs significantly reduced their ECAR. Data represent mean ± SD. n = 6. (F) The deletion of GE reduced the mRNA expression levels of pluripotency genes in hESCs. Data represent mean + SD. n = 3. (G) Deletion of GE greatly reduced the long-distance chromosomal interaction between promoter and GE region of the GLUT1 gene. The GLUT1 promoter area is indicated by dark blue and the target restriction fragments light blue. GE-containing restriction fragment is indicated by red color. Primers were all forward orientation and positioned at the right end of each restriction fragment. Data represent mean ± SEM. *P ≤ 0.05 by two-tailed Student’s t test comparing WT to GE-KO. n = 3
Figure 3SON-binding motif within GE is required for GE activity in activatingexpression. (A) Schematic strategy to disrupt the SON binding site within GE. (B) Identification of the core binding sequence of the SON binding site based on the ChIP-seq data of SON in hESCs and disruption of the SON binding motif in hESCs. The sequences of GLUT1-GE-SON-MU hESCs are shown below, and the binding motif of SON is shaded black. (C) The disruption of the SON binding motif within GE in hESCs reduced the binding of SON to GE and the enhancer-specific epigenetic signature of GE as confirmed by ChIP-qPCR assay. Data represent mean + SEM. n = 3. (D) The disruption of the SON binding motif reduced the long-range interaction between the promoter and GE of GLUT1. The GLUT1 promoter is indicated by dark blue and target restriction fragments light blue. GE-containing fragment is indicated by red box. Data represent mean ± SEM. n = 3. *P < 0.05. (E) The disruption of the SON site reduced the mRNA levels of the GLUT1 gene. Data represent mean ± SEM. n = 3. (F) The disruption of the SON site reduced the protein levels of GLUT1 in hESCs
Figure 4The deletion of GE reduced the expression ofand genes of neural lineages in teratomas formed by hESCs. (A) The volume of teratomas formated by GE-KO and wild type control hESCs. The formula V = ab2/2 was used to calculate the tumor or teratoma volume (V). The length (a) and width (b) of the teratoma were measured with calipers. (B) Cells derived from each of the three germ layers were present in the teratomas formed by GE-KO hESCs in NSG mice. (C) The heat maps showing the differentially expressed genes in the teratomas formed by control parental hESCs and GE-KO hESCs. n = 3. (D) Enriched GO biological process of up-regulated genes (orange) and down-regulated genes (blue) in teratomas formed by GE-KO hESCs. The X-axis of histogram is −log10(P value) of individual terms calculated by right-sided hypergeometric test and corrected with Bonferroni. GO categories are indicated on Y-axis
Figure 5The conservation of GE in various human cells and higher mammals. (A) Integrated analysis of the activity of GE in human IPSC lines. Insulators (red lines) and interactions (green lines) of human iPSCs involving the enhancer and promoter of GLUT1 are displayed at bottom. Binding profiles for OCT4 and H3K27ac of IPSCs are displayed at the top. (B) GE is active in human iPSCs, ectoderm, endoderm, neural progenitor cells (NPCs), mesenchymal stem cells (MSCs), and certain human cancer cells as indicated by the epigenetic marker (H3K27ac) labeled in blue. (C) Fast minimum evolution tree was used to reveal the evolutionary relationship of GE. (D) GE is active in mouse ESCs. The epigenetic signature (H3K27ac and H3K4me1) of GE (blue box) and the binding profiles of SON are conserved in mouse ESCs. The predicted interaction sites between the enhancer and promoter of the Glut1 gene in mouse ESCs are indicated by green boxes. The conserved region of the mouse and human GE is indicated with a red arrowhead
| 3C primers | Sequence |
|---|---|
| ge-ECORI-f-bait | CCTCGCCTCCCAAAGTACTG |
| ge-ECORI-f-probe | ATTACAGGCGTGAGCCACTGAGCCC |
| ge-ECORI-f-1 | CCAGGTAAGTGATTGGTATGGAGTT |
| ge-ECORI-f-2 | GAGTCCAAGGAAGCAAGAAATATT |
| ge-ECORI-f-m-1 | CGCCAAAGAAGAAAACAATTACC |
| ge-ECORI-f-m-2 | CGTCTCAACTGGATTATCAGATAGG |
| ge-ECORI-f-m-3 | GGAGTGCCTAGGGTTTTCTATCC |
| ge-ECORI-f-p | GAGGGCTGTAAGGGAGAATCC |
| ge-ECORI-f-p-1 | GCAACGATGTTGGAGTATTTGTC |