| Literature DB >> 32977695 |
Eun-Kyeong Han1, Won-Bum Cho2, Jong-Soo Park3, In-Su Choi4, Myounghai Kwak5, Bo-Yun Kim6, Jung-Hyun Lee2.
Abstract
Jeju Island is located at a marginal edge of the distributional range of East Asian evergreen broad-leaved forests. The low genetic diversity of such edge populations is predicted to have resulted from genetic drift and reduced gene flow when compared to core populations. To test this hypothesis, we examined the levels of genetic diversity of marginal-edge populations of Quercus gilva, restricted to a few habitats on Jeju Island, and compared them with the southern Kyushu populations. We also evaluated their evolutionary potential and conservation value. The genetic diversity and structure were analyzed using 40 polymorphic microsatellite markers developed in this study. Ecological Niche Modeling (ENM) has been employed to develop our insights, which can be inferred from historical distribution changes. Contrary to our expectations, we detected a similar level of genetic diversity in the Jeju populations, comparable to that of the southern Kyushu populations, which have been regarded as long-term glacial refugia with a high genetic variability of East Asian evergreen trees. We found no signatures of recent bottlenecks in the Jeju populations. The results of STRUCTURE, neighbor-joining phylogeny, and Principal Coordinate Analysis (PCoA) with a significant barrier clearly demonstrated that the Jeju and Kyushu regions are genetically distinct. However, ENM showed that the probability value for the distribution of the trees on Jeju Island during the Last Glacial Maximum (LGM) converge was zero. In consideration of these results, we hypothesize that independent massive postglacial colonization from a separate large genetic source, other than Kyushu, could have led to the current genetic diversity of Jeju Island. Therefore, we suggest that the Jeju populations deserve to be separately managed and designated as a level of management unit (MU). These findings improve our understanding of the paleovegetation of East Asian evergreen forests, and the microevolution of oaks.Entities:
Keywords: Jeju Island; Quercus gilva; conservation; genetic diversity; marginal edge; massive colonization
Year: 2020 PMID: 32977695 PMCID: PMC7598624 DOI: 10.3390/genes11101114
Source DB: PubMed Journal: Genes (Basel) ISSN: 2073-4425 Impact factor: 4.096
Characterization of six multiplexes of 46 microsatellite loci for Quercus gilva.
| Locus | Primer Sequence (5′–3′) | Repeat | Number | Size | Fluorescent | GenBank |
|---|---|---|---|---|---|---|
| Multiplex mix A | ||||||
| Qrg001 | F: TCTGATGAGGTGCTGGAA | (TC)12 | 7 | 100–118 | 6-FAM | MT811115 |
| Qrg002 | F: TGAGCTTGTTGATTGGAGAA | (CA)12 | 6 | 158–172 | 6-FAM | MT811116 |
| Qrg003 | F: TTGGTGGAAGAGATTGTGAG | (CT)14 | 7 | 213–225 | 6-FAM | MT811117 |
| Qrg004 | F: TGGCTTCCTGACCATACATA | (GAA)6 | 6 | 107–122 | VIC | MT811118 |
| Qrg006 | F: CTCAATGGCGAAATCATCAG | (TTAG)8 | 5 | 220–236 | VIC | MT811119 |
| Qrg007 | F: GTTGGATTGGATTCTGTTGC | (AG)12 | 15 | 103–135 | NED | MT811120 |
| Qrg008 | F: ATCGGAGCAAGAAATCAAAT | (AAG)8 | 3 | 159–168 | NED | MT811121 |
| Qrg009 | F: CACTCTCTTCGACCTTCTTT | (TCA)9 | 6 | 225–240 | NED | MT811122 |
| Multiplex mix B | ||||||
| Qrg011 | F: CGTTCAGATCAGGGTACAAA | (CA)14 | 5 | 160–170 | 6-FAM | MT811123 |
| Qrg012 | F: ATTAATGGAGAACTGCCCTC | (CTT)11 | 5 | 223–235 | 6-FAM | MT811124 |
| Qrg013 | F: TCTCAAACGGACCCATTTAA | (CT)13 | 5 | 108–120 | VIC | MT811125 |
| Qrg014 | F: GTCAGTATAGCATGTGGTGT | (GA)14 | 8 | 159–189 | VIC | MT811126 |
| Qrg015 | F: TTCCCATTTCAGACAAGAGG | (TAAC)7 | 7 | 209–237 | VIC | MT811127 |
| Qrg016 | F: CTCTACCATCAACATCCTGC | (AGAC)6 | 6 | 124–148 | NED | MT811128 |
| Qrg017 | F: ACACCAAACAAAGCAAACAA | (AACA)6 | 3 | 163–171 | NED | MT811129 |
| Qrg018 | F: CAACCACAATGTGTAAAGACA | (ACA)10 | 4 | 218–236 | NED | MT811130 |
| Multiplex mix C | ||||||
| Qrg019 | F: AACTCTTGCTCCATTCATTT | (AG)13 | 8 | 133–149 | 6-FAM | MT811131 |
| Qrg020 | F: AGGATTTGTAGCTGACCCTA | (GTT)8 | 4 | 166–178 | 6-FAM | MT811132 |
| Qrg021 | F: ACAAAGACTACGTGTGCATA | (CT)14 | 10 | 229–253 | 6-FAM | MT811133 |
| Qrg022 | F: GGATGACATGGCTGATCTTC | (AAG)7 | 3 | 123–135 | VIC | MT811134 |
| Qrg024 | F: CCTAAGAAGCACAGGTAAGG | (CT)14 | 11 | 237–263 | VIC | MT811135 |
| Qrg025 | F: CATATAGCCGAGGAAGAAGT | (GAA)6 | 2 | 134–137 | NED | MT811136 |
| Qrg026 | F: GATGGGAATGCTCTTAGGTC | (ATAG)6 | 3 | 180–188 | NED | MT811137 |
| Qrg027 | F: TGGAAATGACATTGTTACCCT | (GA)14 | 12 | 235–271 | NED | MT811138 |
| Multiplex mix D | ||||||
| Qrg028 | F: TAAAGGAGTGCATGGTGAAA | (CT)13 | 9 | 127–147 | 6-FAM | MT811139 |
| Qrg029 | F: AAGATAACTGCACGCTTGTA | (TG)13 | 7 | 184–196 | 6-FAM | MT811140 |
| Qrg030 | F: CTATTCATGGACTCCTCTGT | (AG)15 | 7 | 235–249 | 6-FAM | MT811141 |
| Qrg031 | F: GGTTAGGGCTCTTTCCAAAT | (GA)13 | 8 | 131–145 | VIC | MT811142 |
| Qrg033 | F: TCTTGCCAATCTAAATCCCA | (AAGA)7 | 2 | 239–247 | VIC | MT811143 |
| Qrg034 | F: GGACATCTACAGCCTACAAA | (CT)12 | 12 | 143–173 | NED | MT811144 |
| Qrg036 | F: TAACTTTGTTCTCGCCTGA | (GA)13 | 7 | 239–259 | NED | MT811145 |
| Multiplex mix E | ||||||
| Qrg037 | F: TTCGAGATAGGACAGAGGAG | (AAGA)8 | 5 | 128–144 | 6-FAM | MT811146 |
| Qrg038 | F: TGGCTATGATAATTGTGGGT | (GA)17 | 8 | 182–204 | 6-FAM | MT811147 |
| Qrg039 | F: AAAGTGGATTTGCAGCCTAA | (TC)14 | 6 | 244–260 | 6-FAM | MT811148 |
| Qrg040 | F: GCATTTCTCTCTCTGGTTCA | (AAG)6 | 3 | 128–146 | VIC | MT811149 |
| Qrg041 | F: CTTCCTCGTCAATAGTCCAC | (AAG)12 | 9 | 186–228 | VIC | MT811150 |
| Qrg042 | F: CCCACACATTATACCACGAA | (AG)17 | 8 | 227–253 | VIC | MT811151 |
| Qrg043 | F: CATACATCCTAGTGCAGCAG | (CAA)6 | 2 | 149–155 | NED | MT811152 |
| Multiplex mix F | ||||||
| Qrg046 | F: CTGCCCCTAACTAATCTGTT | (TGT)6 | 2 | 149–152 | 6-FAM | MT811153 |
| Qrg047 | F: AGACCAGTAGATGCTTCAAA | (AAG)9 | 3 | 208–217 | 6-FAM | MT811154 |
| Qrg048 | F: TCCATCGTCAACAAAGGATT | (AG)17 | 7 | 235–269 | 6-FAM | MT811155 |
| Qrg049 | F: CAACTACTGTAGCCTTGTGT | (CA)12 | 7 | 146–166 | VIC | MT811156 |
| Qrg050 | F: GGGACCATAGCAGTGTTAAT | (TC)21 | 8 | 192–216 | VIC | MT811157 |
| Qrg051 | F: CTCCTCTTGGCTATGACATC | (TTC)14 | 10 | 235–259 | VIC | MT811158 |
| Qrg052 | F: ACTTGTAACTAACCTGGCTC | (CTAA)8 | 4 | 150–162 | NED | MT811159 |
| Qrg053 | F: TGACAGTACATGGTAAAGCT | (CT)14 | 7 | 204–228 | NED | MT811160 |
Genetic parameters for 46 microsatellite loci across all samples developed for Quercus gilva.
| Locus |
|
|
| Null | Locus |
|
|
| Null |
|---|---|---|---|---|---|---|---|---|---|
| Qrg001 | 8 | 0.703 | 0.619 | 0.0020 | Qrg027 | 16 | 0.829 | 0.865 | 0.0031 |
| Qrg002 | 10 | 0.741 | 0.755 | 0.0053 | Qrg028 | 10 | 0.842 | 0.820 | 0.0018 |
| Qrg003 | 7 | 0.741 | 0.794 | 0.0112 | Qrg029 | 8 | 0.677 | 0.743 | 0.0275 |
| Qrg004 | 7 | 0.778 | 0.786 | 0.0057 | Qrg030 | 9 | 0.253 | 0.765 | 0.2774 * |
| Qrg006 | 6 | 0.772 | 0.763 | 0.0033 | Qrg031 | 10 | 0.810 | 0.841 | 0.0091 |
| Qrg007 | 18 | 0.918 | 0.899 | 0.0012 | Qrg033 | 3 | 0.222 | 0.209 | 0.0048 |
| Qrg008 | 4 | 0.361 | 0.366 | 0.0058 | Qrg034 | 16 | 0.867 | 0.885 | 0.0038 |
| Qrg009 | 8 | 0.570 | 0.748 | 0.0868 * | Qrg036 | 9 | 0.627 | 0.800 | 0.0910 * |
| Qrg011 | 6 | 0.684 | 0.745 | 0.0071 | Qrg037 | 5 | 0.696 | 0.738 | 0.0118 |
| Qrg012 | 7 | 0.759 | 0.756 | 0.0026 | Qrg038 | 13 | 0.759 | 0.794 | 0.0076 |
| Qrg013 | 8 | 0.513 | 0.657 | 0.0728 * | Qrg039 | 6 | 0.753 | 0.731 | 0.0035 |
| Qrg014 | 11 | 0.861 | 0.835 | 0.0016 | Qrg040 | 3 | 0.468 | 0.539 | 0.0218 |
| Qrg015 | 7 | 0.620 | 0.671 | 0.0073 | Qrg041 | 13 | 0.823 | 0.808 | 0.0025 |
| Qrg016 | 6 | 0.608 | 0.622 | 0.0044 | Qrg042 | 14 | 0.734 | 0.805 | 0.0204 |
| Qrg017 | 5 | 0.589 | 0.597 | 0.0117 | Qrg043 | 3 | 0.133 | 0.131 | 0.0058 |
| Qrg018 | 6 | 0.532 | 0.631 | 0.0464 | Qrg046 | 3 | 0.348 | 0.384 | 0.0192 |
| Qrg019 | 10 | 0.759 | 0.824 | 0.0121 | Qrg047 | 4 | 0.475 | 0.496 | 0.0067 |
| Qrg020 | 5 | 0.633 | 0.674 | 0.0050 | Qrg048 | 12 | 0.595 | 0.808 | 0.0977 * |
| Qrg021 | 19 | 0.861 | 0.886 | 0.0062 | Qrg049 | 10 | 0.430 | 0.505 | 0.0353 |
| Qrg022 | 3 | 0.165 | 0.179 | 0.0099 | Qrg050 | 14 | 0.791 | 0.819 | 0.0044 |
| Qrg024 | 13 | 0.741 | 0.857 | 0.0355 | Qrg051 | 10 | 0.810 | 0.814 | 0.0036 |
| Qrg025 | 2 | 0.044 | 0.067 | 0.0316 | Qrg052 | 4 | 0.551 | 0.572 | 0.0106 |
| Qrg026 | 4 | 0.139 | 0.203 | 0.0607 * | Qrg053 | 10 | 0.741 | 0.756 | 0.0029 |
N, number of alleles; HO, observed heterozygosity number of alleles; HE, expected heterozygosity; Null, null allele frequency estimate. * indicates that the frequency of the null allele exceeds 5%.
Figure 1Comparing genetic diversity (NA and HE) by locus with di-, tri-, and tetranucleotide motifs. Genetic diversity is based on the allele frequency of six populations of Quercus gilva using 46 microsatellite loci.
Summary statistics of genetic diversity for six populations based on 40 microsatellite loci of Quercus gilva.
| ID | Location | Coordinates |
|
|
|
|
|
|
| ||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Jeju Island | |||||||||||
| k-GU | Gueok-ri, Daejeong-eup, Jeju | 33°18′8.21″ N, 126°16′36.59″ E | 136 | 32 | 254 | 5.729 | 11 | 0.043 | 0.660 | 0.645 | − |
| k-JJ | Jeoji-ri, Hangyeong-myeon, Jeju | 33°18′45.36″ N, 126°17′3.76″ E | 168 | 27 | 254 | 5.905 | 4 | 0.016 | 0.656 | 0.640 | 0.003 |
| k-SG | Seogwang-ri, Andeok-myeon, Jeju | 33°17′57.47″ N, 126°18′59.97″ E | 201 | 18 | 237 | 5.925 | 8 | 0.034 | 0.639 | 0.651 | 0.043 |
| Mean | 168.3 | 25.6 | 248.3 | 5.853 | 7.7 | 0.031 | 0.652 | 0.645 | 0.007 | ||
| Pooled populations | 77 | 301 | 7.525 | 33 | 0.110 | 0.641 | 0.657 | 0.018 | |||
| Kyushu | |||||||||||
| j-GM | Kuma-gun, Kumamoto Prefecture | 32°17′39.5″ N, 130°52′17.6″ E | 485 | 23 | 238 | 5.656 | 5 | 0.021 | 0.638 | 0.634 | −0.005 |
| j-MY | Miyakonojo-shi, Miyazaki Prefecture | 31°50′55.7″ N, 131°13′30.4″ E | 230 | 29 | 261 | 5.940 | 10 | 0.038 | 0.636 | 0.647 | 0.003 |
| j-NB | Nobeoka-shi, Miyazaki Prefecture | 32°39′15.8″ N, 131°41′14.3″ E | 38 | 29 | 224 | 5.201 | 4 | 0.018 | 0.613 | 0.615 | 0.023 |
| Mean | 251 | 27 | 241 | 5.600 | 6.3 | 0.026 | 0.629 | 0.632 | 0.007 | ||
| Pooled populations | 81 | 302 | 7.503 | 34 | 0.113 | 0.628 | 0.648 | 0.015 | |||
EV, elevation of sampling site (meter); N, number of individuals; NA, number of alleles; AR, allelic richness; PA, number of private alleles; Priv, private allelic rate; HO, observed heterozygosity number of alleles; HE, expected heterozygosity; SE, standard error; FIS, inbreeding coefficient.
Probability of a bottleneck estimated using the program BOTTLENECK for six populations of Quercus gilva, based on the two-phase model (TPM) or stepwise mutation model (SMM).
| Population | Wilcoxon Test | Mode Shift | |
|---|---|---|---|
| TPM | SMM | ||
| Jeju Island | |||
| k-GU | 0.476153 | 0.988818 | No |
| k-JJ | 0.465576 | 0.991747 | No |
| k-SG | 0.294988 | 0.925049 | No |
| Kyushu | |||
| j-GM | 0.383349 | 0.974584 | No |
| j-MY | 0.292696 | 0.982035 | No |
| j-NB | 0.135276 | 0.765987 | No |
Figure 2Genetic composition and a genetic barrier of Quercus gilva geographic populations using 40 microsatellite loci. Genetic composition is based on STRUCTURE clustering results (K = 2). The genetic barrier is marked with a thick purple line, estimated by BARRIER. The gray shading represents exposed coastal areas and sea basins during times of glacially induced alterations in sea levels during the Late Pleistocene.
Figure 3Plots generated in STRUCTURE Harvester (a) Evanno’s delta K statistic; (b) the mean log-likelihood of the data L(K). Genetic structure of Quercus gilva populations based on Bayesian assignment tests performed in STRUCTURE. (c) Genetic structural plot of Q. gilva populations at K = 2. Each individual is represented by a single vertical line that represents the individual’s estimated membership fractions in these two clusters.
Figure 4Neighbor-joining (N-J) tree based on Fst genetic distance among populations. Figures in tree branches are percentage bootstrap values estimated from 1000 reiterations. The square marks indicate the overall genotype assignment for each population to particular genetic clusters based on STRUCTURE analysis.
Figure 5Principal coordinates analysis based on Nei’s genetic distance calculated from the allele frequencies of the 158 individuals for Quercus gilva. The orange symbols indicate individuals of Jeju region, and the yellow ones indicate Kyushu region. Six subgroups indicate each populations of Q. gilva.
Figure 6The genetic differentiation for the six populations of Quercus gilva. (a) Mantel tests between F values and geographical distance among populations; (b) distance matrix of pairwise F between populations.
Figure 7Potential distributions of Quercus gilva during (a) the present; (b) the Last Glacial Maximum, LGM. Distributions predicted by ecological niche modeling; potential distribution during the LGM was averaged from three general circulation models. HKC 1 indicates the main track of the Kuroshio Current during the LGM proposed by Ujiie et al. [66], Kao et al. [67], and Zheng et al. [68]. HKC 2 is the hypothetical Kuroshio Current during the LGM suggested by Vogt-Vincent and Mitarai [69].