Wangyong Li1, Xiaoyan Yang2, Chengfei Shi1, Zhengbo Zhou3. 1. Department of General Surgery, 117908The First People's Hospital of Wenling, Taizhou City, Zhejiang Province, P. R. China. 2. Department of Rehabilitation, 117908The First People's Hospital of Wenling, Taizhou City, Zhejiang Province, P. R. China. 3. Department of Breast Surgery, 518873Shandong Cancer Hospital and Institute, Shandong First Medical University and Shandong Academy of Medical Sciences, Jinan City, Shandong Province, P. R. China.
Abstract
Breast cancer (BrCa) is the most common malignancy in women. Accumulating evidence demonstrated that abnormal circRNA expression is associated with the occurrence and progression of tumors. We analyzed the GSE101123 data and found that the expression of hsa_circ_002178 (circ_002178) was significantly increased in BrCa tissues. However, the role and possible underlying mechanisms of circ_002178 in BrCa still remain unrevealed. In this investigation, the expression levels of circ_002178 in cancer tissues or BrCa cells were significantly upregulated compared with those in paracancer tissues or normal cells. High expression of circ_002178 was correlated with the low survival rate, clinical tumor size, lymph node metastasis, and tumor, nodes, and metastases grade. After microsphere culture, the expression of circ_002178 in SUM149PT and MDA-MB-231 cells was significantly increased. Further investigation exhibited that overexpression of circ_002178 contributed to the formation of microspheres, the elevated protein levels of stemness marker, and the increased activity of ALDH1 in SUM149PT cells. Besides, the overexpression of circ_002178 also significantly promoted the growth, invasion, and migration of BrCa cells. Correspondingly, the knockdown of circ_002178 showed the opposite result in MDA-MB-231 cells. Hsa_circ_002178 was further proved to downregulate the level of miR-1258 and reduce the inhibitory effect of miR-1258 on KDM7A, thus regulating the stem-like characteristics of BrCa cells and promoting the growth and migration of BrCa cells. Taken together, targeting the circ_002178/miR-1258/KDM7A axis may be a prospective strategy for the diagnosis and therapies of BrCa in the future.
Breast cancer (BrCa) is the most common malignancy in women. Accumulating evidence demonstrated that abnormal circRNA expression is associated with the occurrence and progression of tumors. We analyzed the GSE101123 data and found that the expression of hsa_circ_002178 (circ_002178) was significantly increased in BrCa tissues. However, the role and possible underlying mechanisms of circ_002178 in BrCa still remain unrevealed. In this investigation, the expression levels of circ_002178 in cancer tissues or BrCa cells were significantly upregulated compared with those in paracancer tissues or normal cells. High expression of circ_002178 was correlated with the low survival rate, clinical tumor size, lymph node metastasis, and tumor, nodes, and metastases grade. After microsphere culture, the expression of circ_002178 in SUM149PT and MDA-MB-231 cells was significantly increased. Further investigation exhibited that overexpression of circ_002178 contributed to the formation of microspheres, the elevated protein levels of stemness marker, and the increased activity of ALDH1 in SUM149PT cells. Besides, the overexpression of circ_002178 also significantly promoted the growth, invasion, and migration of BrCa cells. Correspondingly, the knockdown of circ_002178 showed the opposite result in MDA-MB-231 cells. Hsa_circ_002178 was further proved to downregulate the level of miR-1258 and reduce the inhibitory effect of miR-1258 on KDM7A, thus regulating the stem-like characteristics of BrCa cells and promoting the growth and migration of BrCa cells. Taken together, targeting the circ_002178/miR-1258/KDM7A axis may be a prospective strategy for the diagnosis and therapies of BrCa in the future.
Entities:
Keywords:
breast cancer; circRNAs; metastasis; miR-1258; stem-like properties; tumorigenesis
Cancer stem cells, also known as tumor stem cells, are cells in tumors that have the ability to self-renew and produce heterogeneous tumor cells. Tumor stem cells play a pivotal role in tumor survival, proliferation, metastasis, and recurrence. Breast cancer (BrCa) is the most frequent malignancy among women[1]. Breast cancer stem cells (BCSCs) play a critical role in the occurrence, progression, metastasis, and recurrence of BrCa[2]. Secondary tumors are primarily caused by the circulation of BCSCs[3]. BCSCs are not sensitive to chemotherapy and can induce tumor recurrence, leading to death[4,5]. Due to the high invasiveness of BCSCs and the lack of effective targeted therapies, the possible underlying mechanism of the characteristics of tumor stem cells has become the focus of research.Circular RNAs (circRNAs) belong to a stable class of noncoding RNAs (ncRNAs)[6]. In recent years, large amounts of circRNAs have been identified in cells[7,8]. circRNAs have been found to be involved in cell growth, apoptosis, and metastasis[9,10]. Aberrant expression of circRNA is associated with tumorigenesis, including BrCa[11]. For example, the downregulation of circ_0011946 inhibited the migration of MCF-7 by sponging RFC3[12], suggesting that circRNAs may be a biomarker for cancers. Therefore, exploring the important role and potential molecular mechanism of circRNAs in tumorigenesis will be helpful for oncotherapy.Micro RNAs (miRNAs) are noncoding single-stranded small RNAs that directly target downstream genes by binding to the 3′ UTR region. The role of miRNAs has been uncovered in various cancers, including oral squamous carcinoma[13], nonsmall cell lung cancer[14], colorectal cancer[15], and BrCa[16]. MiR-1258 an antioncogene was downregulated in BrCa tissues, which was associated with lymph node status, clinical staging, overall survival, and relapse-free survival[16]. In addition, miR-1258 expression was inhibited in highly invasive brain metastatic BrCa cell variants, and the restoration of the expression of miR-1258 directly targeted heparinase to inhibit the occurrence of the brain metastatic BrCa[17]. However, it is still unknown whether miR-1258 interacts with circRNA to regulate the progression and metastasis of BrCa.Herein, we explored the differential expression of circRNA in BrCa and investigated the cross-action between circ_002178 and miR-1258. Moreover, we demonstrated circ_002178 reduced the inhibitory effect of miR-1258 on KDM7A protein expression by competitive for miR-1258 absorption, promoting the growth and metastasis of BrCa in vitro and in vivo. In particular, the present study revealed the role of circ_002178/ miR-1258/KDM7A axis in BrCa. Taken together, targeting the circ_002178/ miR-1258/KDM7A axis may be a prospective strategy for BrCa oncotherapy.
Materials and Methods
Samples
The clinical tissue of BrCapatients was obtained from The First People’s Hospital of Wenling. In this study, tumor and paracancerous tissues were collected from 83 BrCapatients. All patients did not receive any therapies before surgery. All tissues were frozen and preserved at −80°C. The basic information of 83 subjects is summarized in Table 1. The subjects were informed about the study design and purpose in accordance with the Declaration of Helsinki. All patients have signed the written informed consent form. This study was authorized by the Ethics Committee of The First People’s Hospital of Wenling.
Table 1.
Relationship between hsa_Circ_002178 and Clinicopathological Parameters.
Parameters
Number of patients
hsa_circ_002178 expression
P-value
Low (<median)
High (≥median)
Number
83
41
42
Age (years)
<Mean (40)
22
13
9
0.289
≥Mean (40)
61
28
33
Menopause
Yes
57
29
28
0.690
No
26
12
14
Tumor size
<2
40
30
10
<0.001
≥2
43
11
32
Tumor node metastasis stage
I
36
28
8
<0.001
II-III
47
13
34
Lymph node status
Positive
42
6
36
<0.001
Negative
41
35
6
Tumor grade
I
29
18
11
0.091
II-III
54
23
31
ER
Positive
51
23
28
0.323
Negative
32
18
14
HER2
Positive
16
6
10
0.289
Negative
67
35
32
Molecular subtype
TNBC
26
10
16
0.178
Non-TNBC
57
31
26
TNBC: triple-negative breast cancer.
Relationship between hsa_Circ_002178 and Clinicopathological Parameters.TNBC: triple-negative breast cancer.
Microarray Analysis
Eighty-three pairs of BrCa tissues and paracarcinoma tissues were detected by circRNA microarray. Data were analyzed by a commercial institution (Kang Cheng, Shanghai, China). Labeled cRNAs were hybridized onto the Arraystar Human circRNA Array V2 (8 × 15 K, Arraystar). Agilent Scanner G2505C was employed to scan the arrays, and the images were analyzed using Agilent’s feature extraction software (version 11.0.1.1).
Identification of circRNAs and Analysis of GEO Datasets
The circRNAs expression profiles with accession GSE101123 were acquired from the GEO datasets. The differential expression of circRNAs with accession number GSE101123 was obtained through bioinformatic analysis. Accession number GSE101123 was with distinct differences in circRNAs expression profiles in tumor tissue and paracarcinoma tissue. The most significantly different hsa_circ_002178 was selected for subsequent experiments.
Cell Culture and Transfection
Human normal immortalized mammary epithelial cell lines MCF10A and BrCa cell lines (SUM149PT, SUM159PT, HCC1806, MDA-MB-231, and MDA-MB-468) were purchased from American Type Culture Collection (ATCC; VA, USA). MCF10A cells were used as a normal breast cell model and maintained in Mammary Epithelial Cell Growth Medium (MEGM; Lonza, Morristown, NJ, USA) with 5% fetal bovine serum (FBS, Gibco, Grand Island, CA, USA), 100 U/ml penicillin/streptomycin, and 100 ng/ml cholera toxin. TheBrCa cell lines were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, New York, USA) containing 5% FBS, 100 U/ml penicillin, and 100 mg/mL streptomycin at 37°C with 5% carbon dioxide (CO2).
Quantitative reverse transcription PCR (RT-qPCR)
Total RNA from SUM149PT and MDA-MB-231 cells was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reversely transcribed to cDNA with Sensiscript II reverse transcriptase (Qiagen, Hilden, Germany). RT-qPCR was carried out by the SYBR Green PCR master mix (Qiagen) using the Roche LightCycle 96 qRT-PCR System. For circ_002178, the mRNA levels were normalized using β-actin. The primers used in the study are as follows: circ_002178: 5′-CCAATGCTACAGTCGTTACG-3′ (R) and 5′-CCGGCTTTAACGTCGACCTG-30 (S), β-actin: 5′-TTCAAACGTCACCTGACGT-3′ (R) and 5′-GAACTAAACTGTGCCTTACT-3′ (S). For miR-1258, U6 was employed as the internal control. The primers are as follows: miR-1258: 5′-AACGTAAACTCGTGACGATC-3′ (R) and 5′-CTTAAGGCTGCAACTGCTT-3′ (S), U6: 5′-TTCACCGTAAACGCTGCAAC-3′ (R) and 5′-TTCGTACAGTCGACTGAAC-3′ (S). The relative levels of circ_002178 and miR-1258 were calculated using the 2−ΔΔCT method.
Ribonuclease R (RNase) Digestion
Total RNA was acquired from SUM149PT and MDA-MB-231 cells as described above and determined by the NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, New York, CA, USA). Subsequently, RNAs were incubated with RNase R (TaKaRa, Dalian, China) at 37°C for 15 min and purified with RNeasy MinElute cleaning Kit (Qiagen, Germany). The mRNA level of RPPH1 and hsa_circ_002178 was measured by RT-qPCR.
RNA-Fluorescence in Situ Hybridization (FISH)
The circRNA/microRNA interaction was predicted using the StarBase website (http://starbase.sysu.edu.cn/starbase2/). As described previously, in situ hybridization was performed according to the manufacturer’s instructions[18,19]. A biotin-labeled circ-002178 probe and a digoxin-labeled miR-1258 (Exiqon, Vedbaek, Denmark) probe were used for hybridization. The probe sequences of circ-002178 and miR-1258 are as follows: circ_002178, sequence: TGCATGCTAGCTGAAACTGGCATGCCGTTAGCTGACCGATAGCTGC; miR-1258, 5′-AACTCGACTGACCGAAACGTGC-3′. Nuclei were restained with 4′,6-diamidino-2-phenylindole (Life Technologies, Carlsbad, CA, USA) and photographed using a confocal laser scanning microscope (LSM800, Carl Zeiss AG, Germany).
Microsphere Culture
Sphere formation was carried out in ultra-low attachment plates (Corning) with DMEM/F-12 (Invitrogen, New York, USA) supplemented with B27 (2%), basic fibroblast growth factor (20 ng/ml), and epidermal growth factor (20 ng/ml). SUM149PT and MDA-MB-231 cells were seeded (2 cells/μl) and incubated at 37°C with 5% CO2 for 14 days. Thereafter, spheres (>50 μm) were counted at 40× magnification using an Olympus microscope. Cells without microsphere culture were used as controls. The expression of circ_002178 in spheroid and monolayer was measured by RT-qPCR.
RNA Transfection
The circ_002178 overexpression plasmid, specific short hairpin RNA (shRNA) against circ_002178 (shRNA1# or shRNA2#), miR-1258 mimic, miR-1258 inhibitor, and KDM7A overexpression plasmid were obtained from RiboBio (Shanghai, China). Empty vector and shRNA negative control (shNC) were used as the negative control. All transfections were performed using Lipofectamine 2000 (Invitrogen, New York, USA) according to the instructions. MOCK-transfected cells were also used as the negative control. Specific shRNA against circ_002178 (shRNA1# or shRNA2#) was transfected into MDA-MB-231 cells to knockdown circ_002178.
Western Blotting
Cells and tissues were harvested, and protein was extracted using radioimmunoprecipitation assay lysis buffer (Beyotime, Shanghai, China) with phosphatase inhibitors (Abcam, Cambridge, UK). Then, the protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. The samples were blocked with 2% BSA and incubated overnight at 4°C with primary antibodies ALDH1 (#54135, 1:1000; Cell Signaling Technology [CST], Danvers, MA, USA), CD44 (#37259, 1:1000; CST, Danvers, MA, USA), NANOG (#4903, 1:1000; CST), Oct4 (#2750, 1:1000;CST), β-actin (#4970, 1:1000; CST), KDM7A (Thermo Fisher Scientific, New York, CA, USA). The antirabbit IgG-HRP (#7074, 1:2000; CST) was applied as the secondary antibody. The bands were determined using a Bio-Rad GelDoc XR (Bio-Rad, Hercules, CA, USA).
ALDH1 Assay
Aldehyde Dehydrogenase-Based Cell Detection Kit (STEMCELL, Vancouver, Canada) was applied to determine ALDH1 activity. Briefly, cells (1 × 106) were added in ALDEFLUOR Assay Buffer with ALDEFLUOR ReagentBODIPYTM (1.25 µl) supplemented. The cells were then incubated at 35°C for 30 min and determined using BD FACScan flow cytometer (BD Biosciences, New York, CA, USA).
Cell-Counting Kit-8 (CCK-8) Assay
CCK-8 assay was performed to measure the viability of cells. Briefly, SUM149PT cells were transfected with mock and circRNA. MDA-MB-231 cells were transfected with mock, circRNA, shNC + Vector, shRNA2# + Vector, or shRNA2# + KDM7A. After that, stably transfected cells (2 × 103 in total) were inoculated in 96-well plates, and 10 µl of CCK-8 reagent was added. Thereafter, the cells were cultured at 37°C with 5% CO2 for 2 h, and the optical density value (450 nm) was read using Microplate Reader.
Colony Formation Assay
SUM149PT and MDA-MB-231 cells (100 cells/well) in logarithmic growth were seeded in a 6-well plate and grown at 37°C with 5% CO2. After centrifugation, the supernatant was removed, and the cells were washed with phosphate-buffered saline (PBS). Thereafter, the cells were fixed with paraformaldehyde and stained with crystal violet. Finally, the colonies were photographed under an inverted fluorescence microscope.
Wound Healing Assay
Cells in logarithmic growth were grown at 37°C until the formation of monolayers. The monolayer cell was scraped with a sterile pipette tip, and the cells were washed with PBS to remove debris. After 24 h, the microscopic images were taken at 0 and 24 h, respectively. The distance was measured using ImageJ software. Briefly, (1) import the picture File-open with Image J; (2) convert the image format Image-Type-8-bit; (3) find the scratch edges Process-Find Edges; (4) strengthen the contrast Process-Sharpen; (5) adjust the threshold Image-Adjust-Threshold; repeat step 3; and (6) analyze and quantify Analyze-Analyze Particles.
Transwell Assay
SUM149PT and MDA-MB-231 cells were cultured in a serum-free medium and then added to the upper chamber covered with Matrigel. The lower chamber was filled with 600 µl of complete medium. Then the cells were grown overnight at 37°C. After incubation for 24 h, the residual cells were removed using a cotton swab, and the cells on the lower surface of the upper chamber were stained with crystal violet and observed under a light microscope.
Dual-Luciferase Reporter Assay
MiRDB (http://mirdb.org) was used to predict the targets of miR-1258. The target binding sites were determined by the dual-luciferase reporter gene. The DNA sequence of the KDM7A 3′-UTR (miR-1258 target gene) was integrated into the pmirGLO vector (Promega, Madison, WI, USA). At the same time, the KDM7A 3′-UTR mutant sequence was also integrated into the pmirGLO vector (Promega). SUM149PT and MDA-MB-231 cells were co-transfected with newly constructed luciferase reporter vector (300 ng) and miR-1258 inhibitor or negative control inhibitor (100 nM) using Lipofectamine 2000, respectively. After 48 h, luciferase activity was measured using the dual-luciferase reporter assay system (Promega).
Animal Model
This study was conducted in accordance with the National Institutes of Health guidelines for the care and use of laboratory animals (NIH publication NO. 8023) and was approved by the ethics committee of The First People’s Hospital of Wenling. Nonobese diabetic-severe combined immunodeficiency (NOD-SCID) mice (female, 6 to 8 weeks) were purchased from Shanghai Experimental Animal Center (Shanghai, China) and raised in constant temperature and humidity with food and water administered ad libitum. The mice were divided into two groups (n = 10): shNC and shcircRNA. In the NOD-SCID model, MDA-MB-231 cells were orthotopically implanted into the mammary glands of NOD-SCID mice to produce primary tumors. Mice treated with 2% isoflurane were surgically implanted into MDA-MB-231 cells transfected with NC shRNA or circRNA. After 30 days, the mice were euthanized. The tumors were excised and weighed, and pulmonary nodules were examined with hematoxylin and eosin (HE) staining.
Immunohistochemistry
The expression of KDM7A, Ki67, and E-cadherin was examined by immunohistochemistry. Briefly, tissues were sliced into sections (4 μm). The sections were dewaxed and rehydrated with gradient ethanol. Subsequently, the sections were blocked in goat serum and incubated overnight at 4°C with specific anti-KDM7A, Ki67 (#12202, 1:400, CST, Danvers, MA, USA), and E-cadherin (#3195, 1:400, CST, Danvers, MA, USA) antibodies. After that, the sections were hybridized with the second antibody (CST, Danvers, MA, USA) at 37°C for 1 h and detected by 3,3′-diaminobenzidine detection kit (Sangon Biotech, Shanghai, China). KDM7A, Ki67, and E-cadherin were analyzed by an automatic digital pathological scanner (Aperio, Vista, CA, USA).
HE Staining
Paraffin-embedded tissues were treated as described above. The tissue was stained with hematoxylin and restained with a 0.25% eosin dye solution. The tissue was then dehydrated in gradient ethanol and observed under an optical microscope (200×).
Statistical Analysis
The experimental data were presented as mean ± SD. The t-test or one-way analysis of variance following post hoc was used for statistical analysis using GraphPad Prism 5 software. The overall survival curve was plotted by the Kaplan–Meier method, and the expression correlation was expressed using Pearson correlation analysis. Each test was repeated at least three times independently. P < 0.05 was identified as statistical significance.
Results
The Expression of Circ_002178 was Upregulated in BrCa Tissues and Cells
The expression of circRNAs in BrCa tissues was analyzed by microarray. The data of GSE101123 were extracted; the quantized normalization of the acquired array images was performed, and then the heat map and volcano map analysis were drawn (Fig. 1A, B). Circ_002178 level was significantly upregulated in cancer tissues compared with paracarcinoma tissues. The results of microarray analysis were verified by RT-qPCR (Figs. 1C, D). Besides, the high expression of circ_002178 was associated with the low survival rate and clinical tumor size, lymph node metastasis, and tumor, nodes, and metastases (TNM) stage (Fig. 1E, Table 1). In addition, RNA-FISH analysis showed that the circ_002178 level in tumor tissues was obviously higher than that in paracarcinoma tissues (Fig. 1F). In vitro experiments revealed that compared with MCF-10A, the circ_002178 level in BrCa cell lines was significantly higher (Fig. 1G). Rnase R analysis found that the level of the linear gene RPPH1 in SUM149PT and MDA-MB-231 cells was obviously decreased, while the level of circular circ_002178 was not obviously changed, indicating that circ_002178 is a stable circRNA (Fig. 1H). Notably, circ_002178 level in SUM149PT and MDA-MB-231 cells was increased significantly after microsphere culture, suggesting that the high circ_002178 level may be associated with the stem-like property of BrCa cells (Fig. 1I). Taken together, these results indicated that the circ_002178 level was upregulated in BrCa tissues and cells.
Fig. 1.
The expression of circ_002178 was upregulated in BrCa tissues and cells. (A) Volcano map. (B) Heat map. (C and D) The expression of circ_002178 in cancer tissues and paracarcinoma tissues (n = 83; **P < 0.01 vs normal). (E) Survival rate of patients with high or low expression of circ_002178. (F) Localization of circRNA in cancer tissues and paracarcinoma tissues was analyzed using RNA in situ hybridization. (G) The expression of circ_002178 in MCF10A, SUM149PT, SUM159PT, HCC1806, MDA-MB-231, and MDA-MB-468 cells was measured by RT-qPCR (**P < 0.01 vs MCF10A). (H) The expression of RPPH1 and hsa_circ_002178 in SUM149PT and MDA-MB-231 cells treated with MOCK or RNase R was measured by RT-qPCR (**P < 0.01 vs MOCK). (I) The expression of circ_002178 in SUM149PT and MDA-MB-231 cells was measured by RT-qPCR after microsphere culture (**P < 0.01 vs monolayer). circRNA: circular RNA; RT-qPCR: quantitative reverse transcription PCR.
The expression of circ_002178 was upregulated in BrCa tissues and cells. (A) Volcano map. (B) Heat map. (C and D) The expression of circ_002178 in cancer tissues and paracarcinoma tissues (n = 83; **P < 0.01 vs normal). (E) Survival rate of patients with high or low expression of circ_002178. (F) Localization of circRNA in cancer tissues and paracarcinoma tissues was analyzed using RNA in situ hybridization. (G) The expression of circ_002178 in MCF10A, SUM149PT, SUM159PT, HCC1806, MDA-MB-231, and MDA-MB-468 cells was measured by RT-qPCR (**P < 0.01 vs MCF10A). (H) The expression of RPPH1 and hsa_circ_002178 in SUM149PT and MDA-MB-231 cells treated with MOCK or RNase R was measured by RT-qPCR (**P < 0.01 vs MOCK). (I) The expression of circ_002178 in SUM149PT and MDA-MB-231 cells was measured by RT-qPCR after microsphere culture (**P < 0.01 vs monolayer). circRNA: circular RNA; RT-qPCR: quantitative reverse transcription PCR.
Circ_002178 Contributed to the Maintenance of Stem Cell Characteristics in BrCa Cells
To explore the effect of circ_002178 on the stem-like property of BrCa cells, circ_002178 was overexpressed in SUM149PT cells, but knocked down in MDA-MB-231 cells (Fig. 2A). Overexpression of circ_002178 contributed to the formation of microspheres in SUM149PT cells, while low expression of circ_002178 inhibited the formation of microspheres in MDA-MB-231 cells (Fig. 2B). Besides, overexpression of circ_002178 promoted the expression of stem-like marker proteins (ALDH1, CD44, NANOG, and Oct4) in SUM149PT cells at mRNA and protein level, whereas low expression of circ_002178 showed the opposite effects in MDA-MB-231 cells (Fig. 2C, D). Flow cytometric analysis demonstrated that the number of ALDH1 positive cells was increased in SUM149PT cells while decreased in MDA-MB-231 cells (Fig. 2E). The above results show that circ_002178 was conducive to maintain the stem cell characteristics in BrCa cells.
Fig. 2.
circ_002178 facilitated BrCa cells to maintain stem cell characteristics. SUM159PT cells were transfected with MOCK or circRNA, while MDA-MB-231 cells were transfected with shNC, shRNA1#, or shRNA1#. (A) The expression of circ_002178 in SUM149PT and MDA-MB-231 cells was measured by RT-qPCR. (B) Microsphere (**P < 0.01 vs MOCK or shNC). (C and D) The expression of stem-like marker proteins (ALDH1, CD44, NANOG, and Oct4) in SUM149PT and MDA-MB-231 cells was measured by RT-qPCR and Western blotting (**P < 0.01 vs MOCK or shNC). (E) ALDH1 activity was measured by flow cytometry (**P < 0.01 vs MOCK or shNC). BrCA: breast cancer; circRNA: circular RNA; shRNA: short hairpin RNA; RT-qPCR: quantitative reverse transcription PCR.
circ_002178 facilitated BrCa cells to maintain stem cell characteristics. SUM159PT cells were transfected with MOCK or circRNA, while MDA-MB-231 cells were transfected with shNC, shRNA1#, or shRNA1#. (A) The expression of circ_002178 in SUM149PT and MDA-MB-231 cells was measured by RT-qPCR. (B) Microsphere (**P < 0.01 vs MOCK or shNC). (C and D) The expression of stem-like marker proteins (ALDH1, CD44, NANOG, and Oct4) in SUM149PT and MDA-MB-231 cells was measured by RT-qPCR and Western blotting (**P < 0.01 vs MOCK or shNC). (E) ALDH1 activity was measured by flow cytometry (**P < 0.01 vs MOCK or shNC). BrCA: breast cancer; circRNA: circular RNA; shRNA: short hairpin RNA; RT-qPCR: quantitative reverse transcription PCR.
Circ_002178 Promoted the Growth and Migration of BrCa Cells
This study investigated the effect of circ_002178 on the growth and migration of BrCa cells. As shown in Fig. 3A, B, the overexpression of circ_002178 significantly increased the survival rate and the number of clones of SUM149PT cells, while the low expression of circ_002178 demonstrated the opposite results in MDA-MB-231 cells. Furthermore, the overexpression of circ_002178 facilitated the migration and invasion of SUM149PT cells, but the low expression of circ_002178 inhibited the migration and invasive activity of MDA-MB-231 cells (Fig. 3C, D). Taken together, these findings indicated that circ_002178 contributed to the growth and migration of BrCa cells.
Fig. 3.
circ_002178 facilitated the growth and motility of BrCa cells. SUM159PT cells were transfected with MOCK or circRNA, while MDA-MB-231 cells were transfected with shNC, shRNA1#, or shRNA1#. (A) Cell viability was measured by cell counting kit-8 assay (**P < 0.01 vs MOCK or shNC). (B) Cell growth was measured by colony formation assay. (C) Cell migration was measured by wound healing assay. (D) Cell invasion was measured by transwell assay (**P < 0.01 vs MOCK or shNC). BrCA: breast cancer; circRNA: circular RNA; shRNA: short hairpin RNA.
circ_002178 facilitated the growth and motility of BrCa cells. SUM159PT cells were transfected with MOCK or circRNA, while MDA-MB-231 cells were transfected with shNC, shRNA1#, or shRNA1#. (A) Cell viability was measured by cell counting kit-8 assay (**P < 0.01 vs MOCK or shNC). (B) Cell growth was measured by colony formation assay. (C) Cell migration was measured by wound healing assay. (D) Cell invasion was measured by transwell assay (**P < 0.01 vs MOCK or shNC). BrCA: breast cancer; circRNA: circular RNA; shRNA: short hairpin RNA.
Circ_002178 Plays a Role in BrCa by Targeted Binding to miR-1258
This study explored the potential mechanism of circ_002178 in BrCa. The targeted binding of hsa_circ_002178 to miR-1258 was predicted by the StarBase website (http://starbase.sysu.edu.cn/starbase2/index.php). It was found that miR-1233, miR-1258, miR-1296, miR-146b-3p, and miR-521 had a potential targeting relationship with circ_002178 (Fig. 4A). Overexpression of circ_002178 in SUM149PT cells significantly decreased the mRNA level of miR-1258, miR-146b-3p, and miR-521, while low expression of circ_002178 in MDA-MB-231 cells reversely increased them. Among these microRNAs, the expression of miR-1258 was the greatest affected by the abnormal expression of circ_002178. Therefore, miR-1258 was selected as the target gene of circ_002178 for the subsequent studies (Fig. 4B). Besides, RNA-FISH analysis was used to detect the co-localization of circ_002178 and miR-1258 in SUM149PT and MDA-MB-231 cells. As shown in Fig. 4C, circ_002178 and miR-1258 were mainly co-located in the cytoplasm, which provided the possibility for the mechanism of cRNA. The dual-luciferase report assay further verified the targeted regulatory relationship between circ_002178 and miR-1258 (Fig. 4D). In addition, the miR-1258 level in 83 tissue samples was further detected. The miR-1258 level was significantly decreased in cancer tissues compared with paracancerous tissues, and the expression of miR-1258 was negatively correlated with tumorigenesis (Fig. 4E, F). In summary, circ_002178 plays an important role in BrCa by targeted binding to miR-1258.
Fig. 4.
Circ_002178 plays a role in BrCa by adsorbing miR-1258. (A) The targeted binding of hsa_circ_002178 to miR-1258 was predicted by StarBase. (B–C) SUM159PT cells were transfected with MOCK or circRNA, while MDA-MB-231 cells were transfected with shNC or shRNA1#. (B) The expression of miRNAs (miR-1233, miR-1258, miR-1296, miR-146b-3p and miR-521) in SUM149PT and MDA-MB-231 cells was measured by RT-qPCR (*P < 0.05, **P < 0.01 vs MOCK or shNC). (C) Localization of circRNA and miR-1258 in SUM149PT and MDA-MB-231 cells was analyzed using RNA in situ hybridization. (D) SUM159PT cells were transfected with NC inh or miR-1258 inhibitor (miR-1258 inh), while MDA-MB-231 cells were transfected with miR-NC or miR-1258. The target relationship was confirmed by double luciferase report analysis (**P < 0.01 vs NC inh or miR-NC). (E) The expression of miR-1258 in cancer tissues and paracarcinoma tissues was measured by RT-qPCR (n = 83; **P < 0.01 vs normal). (F) The expression correlation between hsa_circ_002178 and miR-1258 was analyzed using Pearson’s correlation analysis. circRNA: circular RNA; NC inh: negative control inhibitor; RT-qPCR: quantitative reverse transcription PCR.
Circ_002178 plays a role in BrCa by adsorbing miR-1258. (A) The targeted binding of hsa_circ_002178 to miR-1258 was predicted by StarBase. (B–C) SUM159PT cells were transfected with MOCK or circRNA, while MDA-MB-231 cells were transfected with shNC or shRNA1#. (B) The expression of miRNAs (miR-1233, miR-1258, miR-1296, miR-146b-3p and miR-521) in SUM149PT and MDA-MB-231 cells was measured by RT-qPCR (*P < 0.05, **P < 0.01 vs MOCK or shNC). (C) Localization of circRNA and miR-1258 in SUM149PT and MDA-MB-231 cells was analyzed using RNA in situ hybridization. (D) SUM159PT cells were transfected with NC inh or miR-1258 inhibitor (miR-1258 inh), while MDA-MB-231 cells were transfected with miR-NC or miR-1258. The target relationship was confirmed by double luciferase report analysis (**P < 0.01 vs NC inh or miR-NC). (E) The expression of miR-1258 in cancer tissues and paracarcinoma tissues was measured by RT-qPCR (n = 83; **P < 0.01 vs normal). (F) The expression correlation between hsa_circ_002178 and miR-1258 was analyzed using Pearson’s correlation analysis. circRNA: circular RNA; NC inh: negative control inhibitor; RT-qPCR: quantitative reverse transcription PCR.
Circ_002178 Increased KDM7A Expression Through miR-1258
In order to investigate the potential molecular mechanism between circ_002178 and miR-1258, the TargetScan website (http://www.targetscan.org/vert_72/) was applied, and KDM7A was predicted as the target for miR-1258 (Fig. 5A). Besides, the luciferase activity in SUM149PT cells increased significantly after the co-transfection of negative control inhibitor (NC inh) and KDM7A-wt, while the luciferase activity in MDA-MB-231 cells decreased significantly after co-transfection of miR-NC and KDM7A-wt, suggesting the targeted relationship between miR-1258 and KDM7A (Fig. 5B). Western blotting results showed that the low miR-1258 level significantly increased the expression of KDM7A in SUM149PT cells, while the overexpression of miR-1258 reduced KDM7A level in MDA-MB-231 cells (Fig. 5C). Besides, this study also explored the expression of KDM7A in cancer tissues and paracancerous tissues of clinical samples. As shown in Fig. 5D, E, KDM7A level in cancer tissues was significantly higher than that in paracancerous tissues. Pearson’s correlation analysis showed a positive correlation between the expression of circ_002178 and KDM7A while a positive correlation between the expression of miR-1258 and KDM7A (Fig. 5F). In vitro studies showed that the expression of KDM7A was significantly increased in SUM149PT cells that overexpressed circ_002178 but inhibited in MDA-MB-231 cells that low-expressed circ_002178 (Fig. 5G). In summary, the above results demonstrated that circ_002178 contributed to KDM7A expression through miR-1258.
Fig. 5.
Circ_002178 facilitated KDM7A expression through miR-1258. (A) The targeted binding of miR-1258 to KDM7A was predicted by TargetScan. (B and C) SUM159PT cells were transfected with NC inh or miR-1258 inh, while MDA-MB-231 cells were transfected with miR-NC or miR-1258. (B) The target relationship was confirmed by double luciferase report analysis (**P < 0.01 vs NC inh or miR-NC). (C) The expression of KDM7A was measured by Western blotting (**P < 0.01 vs NC inh or miR-NC). (D) The expression of KDM7A in cancer tissues and paracarcinoma tissues was measured by Western blotting. (E) The expression of KDM7A in cancer tissues and paracarcinoma tissues was measured by RT-qPCR (**P < 0.01 vs normal). (F) The expression correlation of hsa_circ_002178 and KDM7A or miR-1258 and KDM7A was analyzed using Pearson’s correlation analysis. (G) SUM159PT cells were transfected with miR-NC or/and miR-1258, while MDA-MB-231 cells were transfected with shRNA2# or/ and miR-1258 inh (**P < 0.01 vs mock + miR-NC or circRNA + miR-NC or shNC + NC inh or shRNA2# + NC inh). circRNA: circular RNA; NC inh: negative control inhibitor; RT-qPCR: quantitative reverse transcription PCR.
Circ_002178 facilitated KDM7A expression through miR-1258. (A) The targeted binding of miR-1258 to KDM7A was predicted by TargetScan. (B and C) SUM159PT cells were transfected with NC inh or miR-1258 inh, while MDA-MB-231 cells were transfected with miR-NC or miR-1258. (B) The target relationship was confirmed by double luciferase report analysis (**P < 0.01 vs NC inh or miR-NC). (C) The expression of KDM7A was measured by Western blotting (**P < 0.01 vs NC inh or miR-NC). (D) The expression of KDM7A in cancer tissues and paracarcinoma tissues was measured by Western blotting. (E) The expression of KDM7A in cancer tissues and paracarcinoma tissues was measured by RT-qPCR (**P < 0.01 vs normal). (F) The expression correlation of hsa_circ_002178 and KDM7A or miR-1258 and KDM7A was analyzed using Pearson’s correlation analysis. (G) SUM159PT cells were transfected with miR-NC or/and miR-1258, while MDA-MB-231 cells were transfected with shRNA2# or/ and miR-1258 inh (**P < 0.01 vs mock + miR-NC or circRNA + miR-NC or shNC + NC inh or shRNA2# + NC inh). circRNA: circular RNA; NC inh: negative control inhibitor; RT-qPCR: quantitative reverse transcription PCR.
Circ_002178 Regulated the Characteristics of BCSC and Promoted Growth and Migration Through KDM7A
To further confirm whether KDM7A is involved in the regulation of circ_002178 in BrCa, the effects of KDM7A on the spheroidization, growth, and motility of BrCa cells were studies in this part. As shown in Fig. 6A, the spheroidization of BrCa cell was obviously inhibited when circ_002178 was knockdown. But this inhibitory effect was reversed when KDM7A was overexpressed. Similar results were also displayed in the growth and migration capacity of BrCa cells (Fig. 6B-D). Moreover, the Western blotting analysis showed that compared with shNC + Vector group, circ_002178 knockdown significantly inhibited the expression of related proteins (KDM7A, ALDH1, CD44, NANOG, and Oct4), while overexpression of KDM7A reversed the inhibitory effect mentioned above (Fig. 6E). In summary, these results indicated that circ_002178 regulated the characteristics of BCSC and promoted the growth and migration through KDM7A.
Fig. 6.
Circ_002178 regulated BrCa stem cell characteristics and facilitated growth and migration through KDM7A. (A) MDA-MB-231 cells were transfected with shNC or shRNA2# and Vector or KDM7A. (A) Microsphere. (B) Cell viability was measured by cell counting kit-8 assay. (C) Cell migration was measured by wound healing assay. (D) Cell invasion was measured by transwell assay. (E) The expression of KDM7A, ALDH1, CD44, NANOG, and OCT4 was measured by Western blotting (**P < 0.01 vs shNC + Vector or shRNA2# + Vector). BrCa: breast cancer; shRNA: short hairpin RNA.
Circ_002178 regulated BrCa stem cell characteristics and facilitated growth and migration through KDM7A. (A) MDA-MB-231 cells were transfected with shNC or shRNA2# and Vector or KDM7A. (A) Microsphere. (B) Cell viability was measured by cell counting kit-8 assay. (C) Cell migration was measured by wound healing assay. (D) Cell invasion was measured by transwell assay. (E) The expression of KDM7A, ALDH1, CD44, NANOG, and OCT4 was measured by Western blotting (**P < 0.01 vs shNC + Vector or shRNA2# + Vector). BrCa: breast cancer; shRNA: short hairpin RNA.
Circ_002178 Knockdown Inhibited Tumor Growth and Metastasis In Vivo
In order to investigate the effect of circ_002178 on the tumorigenesis and metastasis of BrCa in vivo, MDA-MB-231 cells transfected with NC shRNA or shcircRNA were surgically transplanted into the mammary glands of NOD-SCID mice, and the tumor volume was measured. After 30 days, the mice were sacrificed, and the tumor was taken out, photographed, and weighed. As shown in Fig. 7A, the tumor volume and tumor weight in mice transfected with MDA-MB-231 that expressed low circ_002178 level were obviously reduced compared with the shNC group. Immunohistochemical analysis showed that the number of KDM7A, Ki67, and E-cadherin positive cells in tumor tissues of mice with low circ_002178 expression was significantly lower than that of the shNC group (Fig. 7B). Besides, similar results were also obtained in terms of the number of pulmonary nodules by HE staining (Fig. 7C), indicating that the low circ_002178 level prevented lung metastasis of breast cancer. Taken together, the current results demonstrated that circ_002178 knockdown inhibited tumor growth and metastasis in vivo.
Fig. 7.
Circ_002178 knockdown reduced tumor growth and metastasis in vivo. The mice were grouped into two groups (n = 10): shNC and shcircRNA. NOD-SCID mice treated with 2% isoflurane were surgically implanted into MDA-MB-231 cells transfected with NC shRNA or circRNA. (A) Tumor image. (B) Volume (*P < 0.05 vs shNC) (C) Weight (*P < 0.05 vs shNC). (D) The expression of KDM7A, Ki67, and E-cadherin was measured by immunohistochemical analysis. (E) The number of pulmonary metastatic nodules was measured by hematoxylin and eosin staining. circRNA: circular RNA; NOD-SCID: nonobese diabetic-severe combined immunodeficiency.
Circ_002178 knockdown reduced tumor growth and metastasis in vivo. The mice were grouped into two groups (n = 10): shNC and shcircRNA. NOD-SCID mice treated with 2% isoflurane were surgically implanted into MDA-MB-231 cells transfected with NC shRNA or circRNA. (A) Tumor image. (B) Volume (*P < 0.05 vs shNC) (C) Weight (*P < 0.05 vs shNC). (D) The expression of KDM7A, Ki67, and E-cadherin was measured by immunohistochemical analysis. (E) The number of pulmonary metastatic nodules was measured by hematoxylin and eosin staining. circRNA: circular RNA; NOD-SCID: nonobese diabetic-severe combined immunodeficiency.
Discussion
BrCa is one of the most common malignant tumors, ranking the second highest cancer mortality in women[20]. BCSCs play an important role in tumorigenesis, progression, and metastasis of breast cancer[21,22]. Moreover, the potential of multidirectional differentiation as well as chemotherapy resistance was also observed in BCSCs[23-25]. Recurrent tumors are characterized as highly invasive, easily metastases, great drug resistance, and poor prognosis.[26] Therefore, it is necessary to explore the stemness of BCSCs in order to prevent and treat BrCa. In this study, circ_002178 and miR-1258 were found to be the important molecular markers that regulated the stemness, growth, and migration of BCSCs. The negative correlation between circ_002178 and miR-1258 has also been verified. Clinically, the high level of circ_002178 is positively related with the survival rate, tumor size, lymph node metastasis, and TNM stage of tumorpatients.As one of the newly discovered ncRNA types, circRNAs are distinguished from other ncRNAs by their unique biogenesis, high stability, and unique function[27]. Previous studies demonstrated that circRNAs play an important regulatory role in cancers[28,29]. In recent years, circRNA has also been studied in BrCa[30,31]. For example, Ye et al showed that since circFBXW7 was downregulated in triple-negative breast cancer (TNBC) cell lines, it was regarded as an independent prognostic factor for TNBC patients. In terms of molecular mechanism, circFBXW7 suppressed the progress of TNBC by targeting to miR-197-3p and promoting the expression of FBXW7-185aa[32]. Liang et al found the novel function of CIRC-ABCB10 in BrCa. It is also clarified that CIRC-ABCB10 regulated the tumorigenesis and progression of BrCa through sponging miR-1271, which provided a new perspective for the pathogenesis of BrCa[33]. Besides, the differentially expressed circRNA in BrCa and the downstream targets of these circRNAs in BrCa progression were found by Xie et al[34]. Similarly, this study also identified the new functions of circ_002178 in BrCa. In our study, overexpression of circ_002178 was found to promote the formation of microspheres, the levels of stemness marker proteins, and the activity of ALDH1 in SUM149PT cells. Besides, the upregulated circ_002178 also contributed to the growth, invasion, and migration of BrCa cells. Hsa_circ_002178 was further proved to downregulate the level of miR-1258, which has solid evidence of antitumor effects[35-37], and reduces the inhibitory effect of miR-1258 on KDM7A, thus, regulating the stem-like characteristics of BrCa cells and promoting the growth and migration of BrCa cells.It is well-known that KDM7A played an important role in the occurrence, progression, and metastasis of tumors. In the condition of nutritional starvation, KDM7A inhibited tumor growth by blocking angiogenesis[38]. However, Lee et al found that KDM7A level was obviously upregulated in prostate cancer tissues and claimed that KDM7A may be a good therapeutic target for prostate cancer drugs[39]. In BrCa, KDM7A was defined as a tumor promoter. In an in situ BrCa model, low-expression of KDM7A suppressed tumor growth. In vitro study revealed that silencing KDM7A significantly reduced the survival rate of BCSCs and the formation of microsphere[40]. Consistent with the above results, the level of KDM7A in tumor tissues of BrCapatients was also found to be significantly higher than that in paracarcinoma tissues and positively correlated with the expression of circ_002178, but negatively correlated with miR-1258.In conclusion, this study disclosed the differential expression level of circRNA in BrCa and investigated the interaction between circ_002178 and miR-1258 in BrCa. In particular, we found that circ_002178 facilitated tumorigenesis by reducing the inhibitory effect of miR-1258 on KDM7A by competitive targeting to miR-1258. In short, the circ_002178/miR-1258/KDM7A axis may be a promising target for the therapy of BrCa in the future.