| Literature DB >> 32947947 |
Lara Pérez-Etayo1, David González1,2, José Leiva3, Ana Isabel Vitas1,2.
Abstract
Due to the global progress of antimicrobial resistance, the World Health Organization (WHO) published the list of the antibiotic-resistant "priority pathogens" in order to promote research and development of new antibiotics to the families of bacteria that cause severe and often deadly infections. In the framework of the One Health approach, the surveillance of these pathogens in different environments should be implemented in order to analyze their spread and the potential risk of transmission of antibiotic resistances by food and water. Therefore, the objective of this work was to determine the presence of high and critical priority pathogens included in the aforementioned list in different aquatic environments in the POCTEFA area (North Spain-South France). In addition to these pathogens, detection of colistin-resistant Enterobacteriaceae was included due its relevance as being the antibiotic of choice to treat infections caused by multidrug resistant bacteria (MDR). From the total of 80 analyzed samples, 100% of the wastewater treatment plants (WWTPs) and collectors (from hospitals and slaughterhouses) and 96.4% of the rivers, carried antibiotic resistant bacteria (ARB) against the tested antibiotics. Fifty-five (17.7%) of the isolates were identified as target microorganisms (high and critical priority pathogens of WHO list) and 58.2% (n = 32) of them came from WWTPs and collectors. Phenotypic and genotypic characterization showed that 96.4% were MDR and resistance to penicillins/cephalosporins was the most widespread. The presence of bla genes, KPC-type carbapenemases, mcr-1 and vanB genes has been confirmed. In summary, the presence of clinically relevant MDR bacteria in the studied aquatic environments demonstrates the need to improve surveillance and treatments of wastewaters from slaughterhouses, hospitals and WWTPs, in order to minimize the dispersion of resistance through the effluents of these areas.Entities:
Keywords: ESBL; WWTPs; antibiotic resistance bacteria; antibiotic resistance gene; collectors; rivers
Year: 2020 PMID: 32947947 PMCID: PMC7565385 DOI: 10.3390/microorganisms8091425
Source DB: PubMed Journal: Microorganisms ISSN: 2076-2607
Figure 1Geographical location of sampling. (A) POCTEFA area (North Spain and South France). (B) Sampling points of rivers (ASE: Ebro Basin; ASC: Cantabrian Basin; ASA: Adour-Garonne Basin); (C) Sampling points of wastewater treatment plants (WWTPs) and collectors in the Navarra region (ARDe: Discharge of wastewater entering the treatment plant. ARDs: Discharge of wastewater leaving the treatment plant. ARH: Discharge of hospital wastewater. ARM: Discharge of slaughterhouse wastewater).
Primers and conditions used for the amplification of the different β-lactamases genes.
| Target | Primer | Sequence (5′–3′) | Amplicon Size (bp) | Conditions |
|---|---|---|---|---|
|
| GCTGCTCAAGGAGCACAGGAT | 520 | Initial denaturation at 94 °C for 3 min; 25 cycles of amplification: denaturation at 94 °C for 30 s, hybridization at 64 °C for 30 s and extension at 72 °C for 1 min; final elongation at 72 °C for 7 min. | |
| CACATTGACATAGGTGTGGTGC | ||||
|
| TGGCCAGAACTGACAGGCAAA | 462 | ||
| TTTCTCCTGAACGTGGCTGGC | ||||
|
| AACTTTCACAGGTGTGCTGGGT | 405 | ||
| CCGTACGCATACTGGCTTTGC | ||||
|
| AACAGCCTCAGCAGCCGGTTA | 346 | ||
| TTCGCCGCAATCATCCCTAGC | ||||
|
| TCGGTAAAGCCGATGTTGCGG | 302 | ||
| CTTCCACTGCGGCTGCCAGTT | ||||
|
| AACATGGGGTATCAGGGAGATG | 190 | ||
| CAAAGCGCGTAACCGGATTGG | ||||
|
| AGGATTGACTGCCTTTTTG | 392 | Initial denaturation at 94 °C for 5 min; 32 cycles of amplification: denaturation at 94 °C for 30 s, hybridization at 54 °C for 30 s and extension at 72 °C for 1 min; final elongation at 72 °C for 10 min. | |
| ATTTGCTGATTTCGCTCG | ||||
|
| ATCAGCAATAAACCAGC | 516 | ||
| CCCCGAAGAACGTTTTC | ||||
|
| ATATCTCTACTGTTGCATCTCC | 619 | ||
| AAACCCTTCAAACCATCC | ||||
|
| AAAAATCACTGGCCAGTTC | 415 | Initial denaturation at 94 °C for 5 min; 30 cycles of amplification: denaturation at 94 °C for 45 s, hybridization at 55 °C for 30 s and extension at 72 °C for 1 min; final elongation at 72 °C for 6 min. | |
| AGCTTATTCATCGCCACGTT | ||||
|
| CGACGCTACCCCTGCTATT | 552 | ||
| CCAGCGTCAGATTTTTCAGG | ||||
|
| CAAAGAGAGTGCAACGGATG | 205 | ||
| ATTGGAAAGCGTTCATCACC | ||||
|
| TCGCGTTAAGCGGATGATGC | 666 | ||
|
| GCACGATGACATTCGGG | 327 | ||
|
| AACCCACGATGTGGGTAGC | 666/327 |
Fw: Forward, Rv: Reverse.
Primers and conditions used for the amplification of the mcr genes.
| Target | Primer | Sequence (5′–3′) | Amplicon Size (bp) | Conditions |
|
| CGGTCAGTCCGTTTGTTC | 309 | 20 cycles of amplification at 94 °C for 30 s, 58 °C for 90 s, 72 °C for 1 min and final 72 °C for 10 min | |
| CTTGGTCGGTCTGTAGGG | ||||
|
| TGTTGCTTGTGCCGATTGGA | 567 | 33 cycles of amplification at 95 °C for 3 min, 65 °C for 30 s, 72 °C for 1 min and final 72 °C for 10 min. | |
| AGATGGTATTGTTGGTTGCTG | ||||
|
| TTGGCACTGTATTTTGCATTT | 542 | 30 cycles of amplification at 95 °C for 30 s, 50 °C for 30 s, 72 °C for 45 s and final 72 °C for 7 min. | |
| TTAACGAAATTGGCTGGAACA | ||||
|
| ATTGGGATAGTCGCCTTTTT | 487 | 20 cycles of amplification at 94 °C for 30 s, 58 °C for 90 s, 72 °C for 1 min and final 72 °C for 10 min | |
| TTACAGCCAGAATCATTATCA | ||||
|
| ATGCGGTTGTCTGCATTTATC | 1644 | 30 cycles of amplification at 95 °C for 30 s, 50 °C for 30 s, 72 °C for 95 s and final 72 °C for 5 min. | |
| TCATTGTGGTTGTCCTTTTCTG |
Fw: Forward, Rv: Reverse.
Isolation of resistant bacteria in selective culture media (red: presence; green: absence). 1st SE, 2nd SE: first and second sampling events; ASE: Ebro Basin; ASC: Cantabrian Basin; ASA: Adour-Garonne Basin; ARDe: Discharge of wastewater entering the treatment plant; ARDs: Discharge of wastewater leaving the treatment plant; ARH: Discharge of hospital wastewater; ARM: Discharge of slaughterhouse wastewater; CPD (Cefpodoxime); FOX (Cefoxitin); VA (Vancomycin); CARB (Carbapenem); COL (Colistin).
| Sample point | CPD 1st SE | CPD 2nd SE | FOX 1st SE | FOX 2nd SE | VA 1st SE | VA 2nd SE | CARB 1st SE | CARB 2nd SE | COL 1st SE | COL 2nd SE | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1_ASE | ||||||||||||||
| 2_ASE | ||||||||||||||
| 3_ASE | ||||||||||||||
| 4_ASE | ||||||||||||||
| 5_ASE | ||||||||||||||
| 6_ASE | ||||||||||||||
| 7_ASE | ||||||||||||||
| 8_ASE | ||||||||||||||
| 9_ASE | ||||||||||||||
| 10_ASE | ||||||||||||||
| 11_ASE | ||||||||||||||
| 12_ASE | ||||||||||||||
| 13_ASE | ||||||||||||||
| 14_ASE | ||||||||||||||
| 15_ASE | ||||||||||||||
| 16_ASE | ||||||||||||||
| 17_ASE | ||||||||||||||
| 18_ASE | ||||||||||||||
| 19_ASE | ||||||||||||||
| 20_ASE | ||||||||||||||
| 21_ASC | ||||||||||||||
| 22_ASC | ||||||||||||||
| 23_ASA | ||||||||||||||
| 24_ASA | ||||||||||||||
| 25_ASA | ||||||||||||||
| 26_ASA | ||||||||||||||
| 27_ASA | ||||||||||||||
| 28_ASA | ||||||||||||||
| 29_ARD1e | ||||||||||||||
| 30_ARD1s | ||||||||||||||
| 31_ARD2e | ||||||||||||||
| 32_ARD2s | ||||||||||||||
| 33_ARD3e | ||||||||||||||
| 34_ARD3s | ||||||||||||||
| 35_ARD4e | ||||||||||||||
| 36_ARD4s | ||||||||||||||
| 37_ARH | ||||||||||||||
| 38_ARM | ||||||||||||||
| 39_ARM | ||||||||||||||
| 40_ARM |
Percentage of positive rivers and WWTPs and collectors for each antibiotic in both sampling events and the number of resistant strains isolated.
| Antimicrobial Resistance | % Positive Rivers | % Positive WWTP/C | N Total Isolates | N of Confirmed Target ARB (%) | Target ARB | ||||
|---|---|---|---|---|---|---|---|---|---|
| 1st SE | 2nd SE | 1st SE | 2nd SE | Rivers | WWTP/C | Rivers | WWTP/C | ||
| Cefpodoxime | 75 | 50 | 83.3 | 100 | 45 | 25 | 18 (40) | 19 (75) | ESBL Enterobacteriaceae |
| Cefoxitin | 71.4 | 75 | 83.3 | 100 | 89 | 39 | 2 (2.3) | 0 | |
| Carbapenems | 32.1 | 92.8 a | 41.6 | 91.6 a | 50 | 27 | 0 | 0 |
|
| 0 | 2 (7.4) |
| |||||||
| 0 | 5 (18.5) | Enterobacteriaceae | |||||||
| Vancomycin | 42.9 | 32.1 | 75 | 91.6 | 8 | 15 | 1 (12.5) | 4 (26.6) |
|
| Colistin | 3.6 | 53.6 b | 8.3 | 66.6 b | 8 | 5 | 2 (25) | 2 (40) | Enterobacteriaceae |
| Total | 200 | 111 | 23 (11.5) | 32 (28.9) | |||||
a and b are the statistically significant differences (p < 0.05) between the 1st and 2nd sampling events (SE); WWTP/C: wastewater treatment plant and collectors; Target ARB: antibiotic resistant bacteria included in the list of high and critical priority pathogens of WHO.
Figure 2Total number of resistant strains isolated from water samples in the POCTEFA area.
Figure 3Genus distribution of isolated Gram negative target resistant bacteria. (A) Penicillins-Cephalosporins; (B) Carbapenems and (C) Colistin.
Characteristics and antibiotic resistance profile of isolated Gram negative bacteria.
| Nº Strain | Samples Code | Species | Resistance Genes | AmpC | Antimicrobial Resistance | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Penicillins | Cephalosporins | Monobactams | β-lactamase Inhibitors | Carbapenems | AminogLycosides | Quinolones | Tetracyclines | Others | MDR | Extensive MDR | |||||
| 1 | 3_ASE |
| TEML-278, CTX-M14 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | AZT | AMS | - | GM, TO | LV, CIP, MXF, NOR | TET | SXT, FOT, CHL | + | + |
| 2 | 3_ASE |
| TEML-278, CTX-M14 | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, FOX, FEP | AZT | AMC, AMS | - | GM, TO | LV, CIP, MXF, NOR | TET | SXT, FOT, CHL | + | + |
| 3 | 4_ASE |
| TEML-278, CTX-M14 | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, FOX, FEP | AZT | AMC, AMS | - | GM, TO | LV, CIP, MXF, NOR | TET | SXT, FOT, CHL | + | + |
| 4 | 6_ASE |
| CTX-M15 | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | AZT | AMC, AMS | MER | - | LV, CIP, MXF, NOR | TET, TIG | SXT, CHL | + | + |
| 5 | 8_ASE |
| TEML-278, CTX-M14 | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | AMS | - | - | LV, CIP, MXF, NOR | TET | - | + | + |
| 6 | 17_ASE |
| CTX-M1 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | - | - | - | - | TET | CHL | + | + |
| 7 | 17_ASE |
| CTX-M1 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | - | - | - | - | TET | CHL | + | + |
| 8 | 29_ARD1e |
| CTX-M1 | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | AMS | - | - | - | TET | - | + | + |
| 9 | 30_ARD1s |
| TEML-278, CTX-M14 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | - | - | - | - | LV, CIP, MXF, NOR | - | - | + | - |
| 10 | 30_ARD1s |
| CTX-M14 | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | AZT | AMS | - | - | - | - | SXT, FOT | + | + |
| 11 | 31_ARD2e |
| CTX-M15 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | - | - | - | - | - | SXT | + | - |
| 12 | 32_ARD2s |
| CTX-M1, SHV-12 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | - | - | - | LV, CIP, MXF, NOR | - | CHL | + | + |
| 13 | 32_ARD2s |
| TEML-278, CTX-M1, SHV-12 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | AMC, AMS, TZP | - | - | LV, CIP, MXF, NOR | TET | SXT, CHL | + | + |
| 14 | 33_ARD3e |
| TEM-171, CTX-M1 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | AMS | - | - | - | - | - | + | - |
| 15 | 34_ARD3s |
| TEML-278, CTX-M14 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | - | AMS | - | GM, TO | - | TET | SXT | + | + |
| 16 | 34_ARD3s |
| TEML-278, CTX-M14 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | - | AMS | - | GM, TO | - | TET | SXT | + | + |
| 17 | 35_ARD4e |
| TEML-278, CTX-M1 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | - | - | GM, TO | LV, CIP, MXF, NOR | TET | SXT, FOT | + | + |
| 18 | 7_ASE |
| TEML-278, SHV-12 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | - | - | - | - | TET | + | - | |
| 19 | 30_ARD1s |
| TEM-171, CTX-M15 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | - | - | - | - | TET | + | - | |
| 20 | 32_ARD2s |
| TEML-278, CTX-M15 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | AMC, AMS | - | - | - | - | FOT | + | + |
| 21 | 35_ARD4e |
| TEM-176, CTX-M15, CTX-M14 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | - | - | - | - | - | - | - | - | |
| 22 | 36_ARD4s |
| OXA-1, CTX-M15 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | AMC, AMS | - | TO | LV, CIP, MXF, NOR | - | SXT | + | + |
| 23 | 40_ARM |
| CTX-M15 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | AMC, AMS | - | - | LV, CIP, MXF, NOR | TET | SXT, CHL | + | + |
| 24 | 7_ASE |
| CTX-M1 | + | AMP, MZ | CZ, CXM, CPD, CTX, CAZ | AZT | AMC | - | - | - | - | - | + | - |
| 25 | 11_ASE |
| - | + | AMP | CZ, CXM, CPD, CTX | - | AMC | - | - | - | - | - | + | - |
| 26 | 11_ASE |
| CTX-M1 | + | AMP | CZ, CXM, CPD, CTX, CAZ | AZT | AMC, AMS | - | - | - | - | - | + | - |
| 27 | 11_ASE |
| CTX-M15 | + | AMP, PIP | CZ, CXM, CPD, CTX | - | AMC, AMS | - | - | MXF | - | FOT | + | + |
| 28 | 20_ASE |
| - | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ | AZT | AMC, AMS | - | - | - | - | - | + | - |
| 29 | 3_ASE |
| TEM-171 | + | AMP | CZ, CXM, CPD, CTX | - | AMC | ETP | - | - | - | - | + | - |
| 30 | 5_ASE |
| TEM-171, ACC | + | AMP, PIP | CZ, CXM, CPD, CTX | - | AMC, AMS, TZP | - | - | - | - | - | + | - |
| 31 | 11_ASE |
| TEM-171 | + | AMP | CZ, CXM, CPD, CTX | - | AMC | - | - | - | - | - | + | - |
| 32 | 39_ARM |
| CTX-M15, ACC | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX | AZT | AMC, AMS | - | - | - | - | COL | + | + |
| 33 | 8_ASE |
| - | + | AMP | CZ, CXM, CPD | - | AMC | - | - | - | - | - | + | - |
| 34 | 33_ARD3e |
| TEM-171, SHV-12, CTX-M1, DHA | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | AZT | AMC, AMS | MER | - | LV, CIP, MXF, NOR | TET | SXT, FOT, CHL | + | + |
| 35 | 35_ARD4e |
| CTX-M14 | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | AZT | AMC, AMS, TZP | MER | - | LV, CIP, MXF, NOR | TET | SXT, FOT, CHL | + | + |
| 36 | 35_ARD4e |
| TEML-278, SHV-12, OXA-1, CTX-M15 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | AMC, AMS | - | TO | LV, CIP, MXF, NOR | - | SXT, CHL | + | + |
| 37 | 11_ASE |
| - | + | AMP | CZ, FOX, FEP | AZT | AMC | - | - | - | - | - | + | - |
| 38 | 33_ARD3e |
| TEML-278, KPC | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, FOX, FEP | AZT | AMC, AMS, TZP | ETP, MER, IMP | - | LV, CIP, MXF, NOR | - | SXT, FOT | + | + |
| 39 | 33_ARD3e |
| TEML-278, KPC | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FEP | AZT | AMC, AMS, TZP | ETP, MER, IMP | TO | LV, CIP, MXF, NOR | - | SXT, FOT | + | + |
| 40 | 36_ARD4s |
| CTX-M1 | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | - | AMC, AMS, TZP | IMP | - | MXF | - | SXT | + | + |
| 41 | 33_ARD3e |
| TEML-278, EBC, DHA, KPC | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | AZT | AMC, AMS, TZP | ETP, MER, IMP | GM, TO | MXF | - | FOT | + | + |
| 42 | 39_ARM |
| TEML-278, EBC, KPC | + | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | AZT | AMC, AMS, TZP | ETP, MER, IMP | GM, TO | NOR | - | FOT | + | + |
| 43 | 33_ARD3e |
| TEML-278 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | AZT | AMC, AMS | MER, IMP | AM, GM, TO | LV, CIP, NOR | TET | SXT, FOT, CHL | + | + |
| 44 | 29_ARD1e |
| - | + | AMP, MZ | CZ, CXM, CPD, CTX, FOX | - | AMC, AMS | ETP, MER, IMP | - | - | TET | SXT, FOT, CHL | + | + |
| 45 | 22_ASC |
| - | - | - | - | - | - | - | - | - | - | COL | - | - |
| 46 | 39_ARM |
| CTX-M15 | - | AMP, PIP, MZ | CZ, CXM, CPD, CTX, CAZ, FOX, FEP | AZT | AMC, AMS, TZP | - | - | - | - | COL, FOT | + | + |
| 47 | 40_ARM |
|
| - | - | - | - | - | - | - | LV, CIP, MXF, NOR | TET | COL, SXT | + | - |
| 48 | 1_ASE |
| - | - | AMP | - | - | - | - | - | - | - | COL, FOT | + | - |
AMP, ampicillin; PIP, piperacillin; MZ, mezlocillin; CZ, cefazolin; CXM, cefuroxime; CPD, cefpodoxime; CTX, cefotaxime; CAZ, ceftazidime; FOX, cefoxitin; FEP, cefepime; AZT, aztreonam; AMC, amoxicillin-clavulanic acid; AMS, ampicillin-sulbactam; TZP, piperacillin-tazobactam; ETP, ertapenem; MER, meropenem; IMP, imipenem; GM, gentamicin; TO, tobramycin; LV, levofloxacin; CIP, ciprofloxacin; MXF, moxifloxacin; NOR, norfloxacin; TET, tetracycline; TIG, tigecycline; SXT, trimethoprim-sulfamethoxazole; COL, colistin; FOT, fosfomycin; CHL, chloramphenicol.
Figure 4Prevalence (percentage) of β-lactamase genes in Gram negative isolates.
Characteristics and antibiotic resistance profile of isolated Gram positive bacteria.
| Nº Strain | Samples Code | Species | Resistance Genes | Antimicrobial Resistance | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Penicillins | Cephalosporins | Carbapenems | Glycopeptides | Aminoglycosides | Macrolides | Quinolones | Tetracyclines | Others | MDR | Extensive MDR | ||||
| 49 | 14_ASE |
|
| OX | CXM, FEP | ETP, MER | VA | GM | ERY | - | TET | FA, Cd, FOT, SYN | + | + |
| 50 | 40_ARM |
|
| - | CXM, FEP | - | VA | - | ERY | - | - | FA, MUP, DAP, Cd, FOT | + | + |
| 51 | 29_ARD1e |
|
| OX | CXM, FEP | ETP, MER | VA | GM, TO | ERY | LV, CIP, MXF | TET | FA, SXT, Cd, FOT, SYN | + | + |
| 52 | 33_ARD3e |
|
| P, OX | CXM, FEP | ETP, MER | VA | GM, TO | ERY | LV, CIP, MXF | TET | FA, SXT, DAP, Cd, FOT, RA, FD, SYN | + | + |
| 53 | 40_ARM |
|
| OX | CXM, FEP | ETP, MER | VA | GM | ERY | LV, CIP, MXF | TET | FA, SXT, Cd, FD, SYN | + | + |
| 54 | 4_ASE |
|
| AMP, P, OX | CXM, FOX, FEP | ETP, MER, IMP | - | - | AZI, ERY | - | - | MUP, Cd, FOT | + | + |
| 55 | 15_ASE |
| - | AMP, P, OX | FOX | - | VA, TEC | - | ERY | - | - | LZ, DAP, Cd, SYN | + | + |
AMP, ampicillin; P, Penicillin; OX, oxacilin; CXM, cefuroxime; FOX, cefoxitin; FEP, cefepime; ETP, ertapenem; MER, meropenem; IMP, imipenem; VA, vancomycin; TEC, teicoplanin GM, gentamicin; TO, tobramycin; AZI, azithromycin; ERY, erythromycin; LV, levofloxacin; CIP, ciprofloxacin; MXF, moxifloxacin; TET, tetracycline; FA, fusidic acid; SXT trimethoprim-sulfamethoxazole; Lz, Linezolid; MUP mupirocin; DAP, Daptomycin; Cd, clindamycin; FOT, fosfomycin; RA, rifampicin; FD, nitrofurantoin; SYN, synercid.
Figure 5Resistance rate to each antibiotic according to the isolates origin. (A) Gram negative strains and (B) Gram positive strains. AMP (ampicillin); CPD (cefpodoxime); CTX (cefotaxime); FEP (cefepime); AZT (aztreonam); AMC (amoxicillin-clavulanic acid); MER (meropenem); GM (gentamicin); CIP (ciprofloxacin); TET (tetracycline); COL (colistin); SXT (trimethoprim-sulfamethoxazole); OX (oxacilin); CXM (cefuroxime); VA (vancomycin); SYN (synercid). (*, p < 0.05, **, p < 0.01).