Literature DB >> 32945453

Novel compound heterozygous nonsense variants, p.L150* and p.Y3565*, of the USH2A gene in a Chinese pedigree are associated with Usher syndrome type IIA.

Jiewen Fu1, Jingliang Cheng1, Qi Zhou2, Md Asaduzzaman Khan1, Chengxia Duan2, Jiangzhou Peng3, Hongbin Lv2, Junjiang Fu4.   

Abstract

Usher syndrome refers to a group of genetically and clinically heterogeneous autosomal recessive diseases with retinitis pigmentosa (RP) and hearing deficiencies. The association between Usher syndrome‑causative genes and resultant Usher syndrome phenotypes in patients are highly variable. In the present study, a Chinese family with Usher syndrome was recruited, and targeted next‑generation sequencing, Sanger sequencing and segregation analysis were performed. The expression profiles and functional effects of the pathogenic variants of USH2A identified were analyzed. Novel nonsense compound heterozygous variants, c.T449G (p.L150*) and c.T10695A (p.Y3565*), were identified in the USH2A gene, which showed co‑segregation with the disease phenotype causing Usher syndrome type IIA in the recruited Chinese pedigree. The p.L150* variant was predicted to produce a truncated protein which lacked almost all the functional domains of USH2A, whereas the p.Y3565* variant is located in one of the fibronectin type 3 domains, resulting in the loss of several fibronectin type 3 domains at the C‑terminus of USH2A by producing the truncated protein. It was shown that Ush2a mRNA expression levels were higher in the retina compared with those in the eye tissues (lens, sclera and cornea), uterus, ovary, breast, testis, spleen, kidney, liver, intestine, brain, skeletal muscle and blood. Additionally, the protein structure was shown to be highly conserved by comparing Homo sapiens USH2A to eight other species. To the best of our knowledge, the present study is the first to identify two novel pathogenic variants, c.T449G (p.L150*) and c.T10695A (p.Y3565*), in the USH2A gene in a patient with Usher syndrome type IIA, thereby expanding the known spectrums of USH2A causative mutations. The present discovery may assist in understanding the molecular pathogenesis underlying the development of RP and Usher syndrome type IIA, and in the development of diagnostic, therapeutic and genetic counseling strategies in patients with Usher syndrome type IIA disease.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32945453      PMCID: PMC7453661          DOI: 10.3892/mmr.2020.11400

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Usher syndrome is a group of genetically and clinically heterogeneous autosomal recessive diseases with progressive retinitis pigmentosa (RP) and sensorineural hearing deficiencies, including Usher syndrome types I, II and III (1–4). Patients with Usher syndrome type II (USH2) present with mild hearing impairments but normal vestibular responses, and type II is the most common type amongst the three types (1). Usher syndrome type II is genetically heterogeneous, including USH2A, USH2C and USH2D. Usher syndrome type IIA (USH2A locus) (OMIM, 276901) is the result of mutations of the USH2A gene (OMIM, 608400) (5), whereas USH2C (OMIM, 605472) is the result of mutations of the ADGRV1 gene (OMIM, 602851) (1,6) or by digenic mutations of both ADGRV1 and PDZD7 genes (OMIM, 612971) (7) and USH2D (OMIM, 611383) can be caused by mutations of the whirlin (WHRN) gene (OMIM, 607928) (8). As Hmani-Aifa et al (9) identified mutations of the adhesion G-protein coupled receptor V1 gene in an Usher II syndrome pedigree which had been previously mapped to the USH2B locus of chromosome 3p23-p24.2, the designation for the USH2B locus was withdrawn. Aliases for the USH2A gene include Usherin, USH2, US2, Usher Syndrome 2A, Usher Syndrome Type-2A Protein, Usher Syndrome Type IIa Protein, DJ1111A8.1 and RP39. This gene maps to chromosome 1q41, encoding a protein 5,202 amino acids in length that is comprised of a pentaxin motif, laminin epidermal growth factor (EGF) motifs and numerous fibronectin type III domains (10). Different isoforms have also been identified (5,10–12). The protein is localized in the basement membrane and serves a vital role in the development and homeostasis of the inner ear and retina (2). Mutations of the USH2A gene have been identified in patients with Usher syndrome type IIA and non-syndromic RP (13). Eudy et al (5) was the first to identify USH2A mutations among patients with Usher syndrome type IIA. The association between the variants in the Usher syndrome-causative genes and the resultant Usher syndrome phenotypes in patients are highly variable (1,3,14). To the best of our knowledge, novel USH2A mutations in patients with Usher syndrome type IIA and association between the genotypes and phenotypes have not been well documented in the Chinese population. In the present study, by using targeted next-generation sequencing (TGS), Sanger sequencing and segregation analysis, novel nonsense, compound heterozygous mutations in the USH2A gene were identified in a Chinese pedigree with Usher syndrome.

Materials and methods

Pedigree and clinical assessment, blood collection, and DNA isolation

The M147 pedigree consisted of a proband and four family members from Sichuan, China (Fig. 1A). The proband was a 35-year-old female, and her parents, husband and son were 71, 60, 36 and 5-years-old, respectively. The blood samples of the proband were collected in June 2013, and TGS analysis was performed in December 2016. The blood samples of the four family members were collected in March 2019 for segregation analysis in our laboratory. For detailed clinical assessments, clinical history and ophthalmic examinations were performed with the proband, including fundoscopy, fundus photographs and fundus fluorescent photographs as previously described (15). Audiometric testing in the proband was also performed using pure-tone audiometry with different frequencies (0.25, 0.5, 1, 2, 4 and 8 kHz) (1). Written informed consent from the participants or guardians was obtained, and the study conformed to the Declaration of Helsinki. Blood samples were taken, and DNA was isolated from the family members (16,17). DNA from blood samples was also taken from 200 healthy controls with an average age of 40.6 years-old (age ranges: 20–66; sex distribution: 2:3 female: Male) from Luzhou city between December 2016 and February 2017 without hearing and vision problems. The DNA integrity was verified by running the DNA sample on a 0.8% agarose gel. Written informed consent was obtained from the patients and healthy controls.
Figure 1.

An M147 pedigree with Usher syndrome type IIA. Normal individuals are shown as a clear circle (female) or squares (males). The filled circle indicates the proband (II: 1, arrow) with the compound heterozygous mutation of the USH2A gene: NM_206933.3: c.T449G, c.T10695A. USH2A, usherin.

TGS

TGS analysis was performed on the proband M147 DNA, according to the manufacturer's protocol (Illumina, Inc.) as described previously (18–20). Library construction, TGS and data analysis were performed according to the manufacturer's protocols and as described previously (19,21).

Sanger validation and segregation analysis

PCR amplification was performed for mutation validation. The primer pairs M147-USH-T10695A and M147-M201-USH were designed using the Primer3 program (http://bioinfo.ut.ee/primer3-0.4.0/) with genomic DNA sequences containing the NM_206933.3: c.T449G and c.T10695A, respectively, of the USH2A gene (Table I). PCR amplification was performed using the aforementioned primer pairs and the amplified PCR products were then sequenced using the Sanger method on an ABI-3500DX sequencer (Thermo Fisher Scientific, Inc.) (22) using M147-USH-T10695A-L and M147-M201-USH-L primers (Table I). Control samples from unrelated, ethnically matched individuals were also amplified using the primer pairs M147-USH-T10695A and M147-M201-USH and sequenced using the primers M147-USH-T10695A-L and M147-M201-USH-L. Segregation analysis in the M147 family was performed based on the sequencing results.
Table I.

Sequences of USH2A PCR primers.

Primer nameSequence, 5′-3′Size, bpMutation site
M147-USH-T10695AF: AGGAACTGCTTGAGACAGCAA346c.T10695A
R: CTGAACCCCTTTTCCCAGAG
M147-M201-USHF: AGGCCTCAGTAGCTGCATCA321c.T449G
R: TTGGGGAAACAACTGGAAGA
RT-ush2aF: CGCTCTGCCTCTCCTCTCTA320N/A
R: TTTATTGGAGGCTGCAAACC
RT-actin-mF: TGTTACCAACTGGGACGACA392N/A
R: TCTCAGCTGTGGTGGTGAAG

F, forward; R, reverse; N/A, not available. RT, reverse transcription.

Prediction of protein structure and bioinformatics analysis

The homologs of the USH2A gene (NM_206933.3) in humans were analyzed using HomoloGene (ncbi.nlm.nih.gov/homologene?Db=homologene&Cmd=Retrieve&list_uids=66151). Conserved domains of the protein structure of USH2A (NP_996816.2) were searched using the NCBI conserved domain database (ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) (23–25).

RNA-sequencing (RNA-seq) profile, RNA isolation and reverse transcription-PCR (RT-PCR)

To determine tissue specificity in humans, USH2A gene expression profiles were analyzed using RNA-seq data which was performed on normal samples from 95 human individuals representing 27 different tissues using: https://www.ncbi.nlm.nih.gov/gene/7399/?report=expression. The above RNA-seq data were collected from a project called HPA RNA-seq normal tissues (BioProject no. PRJEB4337). Total RNA was extracted from tissues in mice using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Experiments involving mice followed the international, national and institutional guidelines for the care and use of laboratory animals (26,27,28) and was reviewed and approved by the Ethics Committee of Southwest Medical University, Sichuan, China. Male and female BALB/c mice (8 weeks old, ~21 g), were purchased from SPF (Beijing) Biotechnology Co., Ltd, China, and housed individually at room temperatures (18–22°C) with 40–60% and with a 12-h light/dark cycle. All mice were negative for pathogens. Mice received food and water ad libitum. At least five healthy mice for eye tissues and one healthy mouse for other tissues were used for RNA sampling. Retinal tissue at developmental stages, including whole embryo eye at 12.5 and 20.5 days before birth, and 2 weeks, 1 month, 2 and 3 months after birth, were used. Pentobarbital sodium (200 mg/kg of body weight) was intraperitoneally injected to mice for euthanasia. Death was verified as absence of vital signs, including no heartbeat, dilated pupils or cervical dislocation after anesthesia. First strand cDNA was then synthesized from 1 µg total RNA with the ReverTra Ace® qPCR RT kit (cat. no. FSQ-201; Toyobo Life Science) according to the manufacturer's instructions and semi-quantitative RT-PCR was performed as described in our previous study (29,30). Briefly, the PCR reaction system consisted of 5 µl 2X Taq PCR MasterMix (Tiangen Biotech Co.), 1 µl 2.5 µM RT primers, 1 µl RT products and 3 µl double distilled H2O. Amplification reactions were performed using the Applied Biosystems® Veriti® 96-Well Thermal Cycler PCR machine (Thermo Fisher Scientific, Inc.) with the following steps: Initial denaturation at 95°C for 90 sec, 28–30 cycles of denaturation at 94°C for 30 sec, annealing at 72°C for 30 sec, extension at 72°C for 30 sec and a final extension step at 72°C for 5 min. Primer pairs for RT-ush2a (RT-ush2a-L and RT-ush2a-R) targeting the mouse Ush2a gene, and the mouse β-actin gene which served as a control, are listed in Table I. RT-PCR products were separated on a 1.2% agarose gel in triplicate, and the gels were visualized by 0.5 µg/ml ethidium bromide (EB) staining. Densitometry was performed using ChemiDoc XR (version 5.2, Bio-Rad Laboratories, Inc.) (17,31).

Results

Proband and clinical characteristics

The patient (Fig. 1A, II: 1) was a 35-year-old Chinese female. She suffered from night blindness since adolescence at age 12 and was first diagnosed with RP at the Yibin local county hospital 7 years ago. Fundus examinations showed bony spicule pigmentation and attenuated retinal vessels in both eyes, characteristic of a typical RP phenotype (Fig. 2A-D). The retinal pigment epitheliums were atrophied, and electroretinography results displayed no amplitude reactions (data not shown). The proband had a right naked eye vision of 0.6 and a left naked eye vision of 0.7, and a visual acuity with correction of 0.8 in the right eye and 0.8+ in the left eye. The logMAR or Snellen measurements were not available for this patient. The proband did not claim to exhibit hearing loss. The proband was characterized as RP. Based on genetic diagnostic results, pure tone audiometry testing was performed and found 65 dB hearing losses of both ears, indicating a moderate-to-severe binaural sensorineural hearing loss across all frequencies (Fig. 2E, left ear; Fig. 2F, right ear). Both the proband's parents and her son was normal. Thus, the proband was diagnosed with possible Usher syndrome type IIA.
Figure 2.

Representative retinal phenotypes and ear audiograms of proband II: 1. (A-D) Representative fundus photographs and fundus fluorescent photographs in patient II: 1 of both eyes. (E and F) Physiological audiograms of both ears of proband II:1.

Results of TGS and co-segregation analysis

Compound heterozygous mutations (c.T449G) in exon 2 and (c.T10695A) in exon 54 in the USH2A gene (NM_206933.3) were identified, leading to the presence of early stop codons (from TTA to TGA and from TAT to TAA, respectively) at amino acid positions 150 (p.L150*) and 3565 (p.Y3565*), respectively, in the USH2A protein (NP_996816.2; Fig. 1A, II: 1). Thus, both USH2A variants (c.T449G, p.L150*) and (c.T10695A, p.Y3565*) resulted in the production of truncated proteins, which were hypothesized to affect protein function. The characteristics of the USH2A variants and disease-causing effects of the proband are shown in Table II. Hence, these nonsense mutations (c.T449G, p.L150*) and (c.T10695A, p.Y3565*) in the USH2A gene affected protein function and supported the diagnosis of Usher syndrome type IIA. Both variants were revealed to be novel by searching the databases for Exome Aggregation Consortium (https://gnomad.broadinstitute.org/) and HGMD (http://www.hgmd.cf.ac.uk/ac/index.php) (Table II).
Table II.

Characteristics of USH2A variants and disease-causing effects in the proband.

Variation

GeneExonNucleotideProteinType of mutationStatusExAC status
USH2A2c.T449Gp.L150*NonsenseHeterozygousNovel
USH2A54c.T10695Ap.Y3565*NonsenseHeterozygousNovel

USH2A, usherin; c, variant at the cDNA level; p, variant at the protein level; ExAC, Exome Aggregation Consortium; *, stop codon.

Sanger sequencing was performed to confirm the variants and analyze co-segregation (Fig. 3). The mutations (c.T449G, c.T10695A) in the USH2A gene were validated to be compound heterozygous in the proband (Fig. 3C and H; pedigree II: 1), of which c.T449G was inherited from her father (Fig. 3A and F; pedigree I: 1) and c.T10695A was inherited from her mother (Fig. 3B and G; pedigree I: 2). The proband's son was revealed to be heterozygous c.T10695A with a normal phenotype (pedigree III: 1; Fig. 3D and I), and the proband's husband had a normal phenotype and with wild-type alleles (Fig. 3E and J; pedigree II: 2). Therefore, these mutations in the USH2A gene and the mutations were co-segregated with this clinical phenotype in this family. Both c.T449G and c.T10695A variants were absent in the blood samples of 200 normal ethnically matched controls. Taken together, this discovery highlighted co-segregation of the variants in this family and pinpointed their roles in the pathogenesis of Usher syndrome type IIA.
Figure 3.

Pyrogram profiles for variant verification using Sanger sequencing. (A-E) Sequencing results pf I: 1 (heterozygous mutant type), I: 2 (WT), II: 1 (heterozygous mutant type), III: 1 (WT), and II: 2 (WT) of variant c.T449G. (F-J) Sequencing results of I: 1 (WT), I: 2 (heterozygous mutant type), II: 1 (heterozygous mutant type), III: 1 (heterozygous), and II: 2 (WT) of variant c.T10695A. The arrows indicate the mutation position of NM_206933.3: c.T449G or c.T10695A in the USH2A gene. USH2A, usherin; WT, wild-type.

Functional effects of the variants c.T449G (p.L150*) and c.T10695A (p.Y3565*) in USH2A

By comparing of Homo sapiens (H. sapiens) USH2A protein to eight other species, including Pan troglodytes, Macaca mulatta, Canis lupus, Bos taurus, Rattus norvegicus, Mus musculus, Gallus gallus and Danio rerio, it was shown that USH2A is highly orthologously conserved (Fig. 4A). USH2A protein in H. sapiens contains a lamG-like jellyroll fold domain, laminin EGF domains, laminin-type EGF-like domains, laminin G domains, laminin N-terminal (Domain VI) and many fibronectin type 3 domains (Fig. 4A and B). The c.T449G (p.L150*) variant is located in the lamG-like jellyroll fold domain (aa.146-aa.283), leading to the production of a truncated protein which had lost almost all the functional domains (Fig. 4B); whereas the c.T10695A (p.Y3565*) variant is located in one of the fibronectin type 3 domains (aa. 3503-aa. 3586), leading to the production of a truncated protein, that lost several fibronectin type 3 domains at the C-terminus of USH2A (Fig. 4B). Together, these results showed that the USH2A pathogenic compound heterozygous variants c.T449G (p.L150*) and c.T10695A (p.Y3565*) may have caused Usher syndrome type IIA disease.
Figure 4.

USH2A comparison, structure and mutant locations between different species. (A) Conservation analysis of USH2A in the indicated species. (B) USH2A domains and mutant positions. Variants p.L150* and p.Y3565* of USH2A are indicated panel B. USH2A, usherin; aa, amino acids. EGF, epidermal growth factor; FN, fibronectin.

mRNA expression profiles of USH2A and Ush2a

USH2A expression analysis in humans indicated that USH2A mRNA expression was highest in the liver, with a reads per kilobase of transcript per million mapped reads value of 1.691±0.096, followed by the testis, and was low or very low in other tissues (Fig. 5A). RNA-seq values in different tissues are presented in Table III. No human eye tissues and developmental retinal stage tissues were available. Thus, the Ush2a expression in mice was studied. Ush2a mRNA expression levels were highly expressed in the retina and other indicated tissues including the lens, sclera and cornea (Fig. 5B); whereas expression was not detected in the tissues, uterus, ovary, testis, breast, spleen, kidney, liver, brain, intestine, skeletal muscle, and blood. Ush2a was also highly expressed in the latter four different developmental retinal stages following birth (Fig. 5C). These results suggested that USH2A may serve a vital role in retinal/eye function based on the very high levels of Ush2a2 expression in the retinal tissue and its highly ubiquitous expression in other eye tissues.
Figure 5.

mRNA expression of USH2A in human tissues and Ush2a in mouse tissues. (A) USH2A mRNA expression in human tissues. The source of the data was derived from the link: https://www.ncbi.nlm.nih.gov/gene/7399/?report=expression. (B) Ush2a mRNA levels in the indicated mouse tissues. (C) Ush2a mRNA levels at the indicated developmental time periods in retinal tissue in mice. Whole embryo eyeballs were obtained at 12.5 days (12d) and 20.5 days (20d). d, days; w, weeks; m, months; nc, no DNA template; muscle, skeletal muscle; RPKM, reads per kilobase of transcript per million mapped reads.

Table III.

Expression of USH2A mRNA in human tissues.

TissueNumber of samplesRPKM valuesCounts
Adrenal30.163±0.04037,820
Appendix30.005±0.002984
Bone marrow40.001±0.001355
Brain30.017±0.0084,671
Colon50.005±0.0044,064
Duodenum20.015±0.0012,072
Endometrium30.005±0.00201,114
Esophagus30.004±0.0021,592
Fat30.011±0.0072,513
Gall bladder30.004±0.0021,546
Heart40.06±0.023030,633
Kidney40.076±0.06821,041
Liver31.691±0.096469,141
Lung50.006±0.0042,714
Lymph node50.003±0.0041,827
Ovary20.009±0.0042,706
Pancreas20.006±0.0021,498
Placenta40.005±0.0052,596
Prostate40.009±0.0062,782
Salivary gland30.015±0.0097,066
Skin30.006±0.0032,279
Small intestine40.007±0.0042,300
Spleen40.003±0.0031,410
Stomach30.009±0.0032,563
Testis70.341±0.222348,396
Thyroid40.003±0.0021,543
Urinary bladder20.006±0.0041,432

RPKM, reads per kilobase of transcript per million mapped reads; USH2A, usherin.

Discussion

The association between the variations in Usher syndrome-causative genes and the resultant Usher syndrome diseases or phenotypes in patients are highly variable; the genotype/phenotype associations are also divergent (1,3,4). Since Eudy et al (5) first identified three mutations in the USH2A gene in patients with Usher syndrome type IIA with RP and hearing loss, additional USH2A mutations have been shown to be associated with Usher syndrome type IIA (10–12,32–39). Patients with autosomal recessive RP (arRP; RP39; OMIM, 613809) without hearing loss were also identified to possess USH2A mutations, highlighting the complexity of genotype/phenotype associations in this disease (4). For example, Rivolta et al (40) identified USH2A mutations in patients with arRP without hearing loss. Zlotogora (41) reviewed examples and identified arRP patients without hearing loss who possessed mutations in the USH2A gene. Compound pathogenic mutations in the USH2A gene in Chinese RP families were also recently identified (42). In the present study, using TGS, Sanger sequencing and co-segregation analysis, compound heterozygous pathogenic nonsense mutations, c.T449G (p.L150*) and c.T10695A (p.Y3565*), were identified in the USH2A gene in a Chinese pedigree. USH2A, very large G-protein coupled receptor 1 (VLGR1), USH1 and electroneutral sodium bicarbonate exchanger 1 (NBC3) are co-expressed in the synaptic terminals in both retinal photoreceptors and inner ear hair cells of mice and rats. The scaffold proteins harmonin, USH2A, VLGR1 and NBC3 interact with each other to assemble a multiprotein complex (43). USH2 and NBC3 proteins are interaction partners in a network in the retina and inner ear (43,44). These p.L150* and p.Y3565* truncated USH2A mutations are hypothesized to affect complex formation (45), thereby elucidating the genetic roles of these USH2A mutant alleles in Usher syndrome type IIA. The patient examined in the present study was first diagnosed as a nonsyndromic RP as she did not claim to suffer from hearing loss. Based on gene diagnostic results, pure tone audiometry testing was performed which presented binaural sensorineural deafness. Thus, USH2A mutations with Usher syndrome type IIA and an association of genotype/phenotype have been successfully linked in the patient of the studied family. Pater et al (46) recently reassigned the diagnosis of Usher syndrome by identifying novel USH2A splicing variants. To the best of our knowledge, the USH2A variants c.T449G (p.L150*), c.T10695A (p.Y3565*) are novel, thereby extending the spectrum of known mutations associated with this disease. By comparing the of H. sapiens USH2A to eight other species, it was demonstrated that the USH2A protein is highly conserved. Ush2a mRNA expression levels in mice were demonstrated to only be highly expressed in the retina, lens, sclera and cornea from the eye tissues, consistent with a previous study (5), suggesting that USH2A serves vital roles in the functions of retina/eye. In addition to its high expression in the retina, USH2A in humans, rat and mice is also expressed in the cochlea (5,47). USH2A was found to a likely component of the interstereocilia ankle which links the inner ear sensory cells (12). Taken together, the present study showed that the USH2A compound heterozygous variant, c.T449G (p.L150*) and c.T10695A (p.Y3565*), resulted in Usher syndrome type IIA. As a rare disorder and the most common inherited form of combined visual and hearing impairment, up to 14 genes (MYO7A, CDH23, USH1C, PCDH15, USH1G and CIB2 for USH I, USH2A, ADGRV1 and WHRN for USH II, CLRN1 and HARS for USH III, and PDZD7, CEP250 and C2orf71 for either type I, II, or III of USH) are associated with Usher syndrome, with USH2A being the most prevalent worldwide (2,48,49). With genetic diagnosis for Usher syndrome, repairing specific mutations using CRISPR/Cas9 editing system may now be possible. For example, Fuster-García et al (48) investigated gene editing to target the mutation in fibroblasts of a USH patient bearing the c.2299delG homozygous variation, highlighting the potential of the CRISPR editing system for the treatment of Usher syndrome. In conclusion, the present study is the first to identify the novel compound heterozygous variants c.T449G (p.L150*) and c.T10695A (p.Y3565*) in the USH2A gene, which caused Usher syndrome type IIA in the examined patient. These mutations expand upon the library of known mutations associated with Usher syndrome. TGS provides a useful gene diagnostic approach (50). The present discovery may assist in understanding the molecular pathogenesis of RP and Usher syndrome type IIA, and in the development of strategies for the prevention, diagnosis, therapy and genetic counseling of patients with Usher syndrome type IIA. Additionally, the recruitment of more patients with Usher syndrome is an aim of future studies.
  49 in total

1.  The roles of USH1 proteins and PDZ domain-containing USH proteins in USH2 complex integrity in cochlear hair cells.

Authors:  Junhuang Zou; Qian Chen; Ali Almishaal; Pranav Dinesh Mathur; Tihua Zheng; Cong Tian; Qing Y Zheng; Jun Yang
Journal:  Hum Mol Genet       Date:  2017-02-01       Impact factor: 6.150

Review 2.  Molecular genetics ‎characterization and homology modeling of the CHM gene mutation: A study on its association with choroideremia.

Authors:  Saber Imani; Iqra Ijaz; Marzieh Dehghan Shasaltaneh; Shangyi Fu; Jingliang Cheng; Junjiang Fu
Journal:  Mutat Res Rev Mutat Res       Date:  2018-02-18       Impact factor: 5.657

3.  Mutation analysis in the long isoform of USH2A in American patients with Usher Syndrome type II.

Authors:  Denise Yan; Xiaomei Ouyang; D Michael Patterson; Li Lin Du; Samuel G Jacobson; Xue-Zhong Liu
Journal:  J Hum Genet       Date:  2009-10-30       Impact factor: 3.172

4.  Identification of 51 novel exons of the Usher syndrome type 2A (USH2A) gene that encode multiple conserved functional domains and that are mutated in patients with Usher syndrome type II.

Authors:  Erwin van Wijk; Ronald J E Pennings; Heleen te Brinke; Annemarie Claassen; Helger G Yntema; Lies H Hoefsloot; Frans P M Cremers; Cor W R J Cremers; Hannie Kremer
Journal:  Am J Hum Genet       Date:  2004-03-10       Impact factor: 11.025

5.  Next-generation sequencing-based molecular diagnosis of 35 Hispanic retinitis pigmentosa probands.

Authors:  Qi Zhang; Mingchu Xu; Jennifer D Verriotto; Yumei Li; Hui Wang; Lin Gan; Byron L Lam; Rui Chen
Journal:  Sci Rep       Date:  2016-09-06       Impact factor: 4.379

6.  A novel homozygous variant of GPR98 causes usher syndrome type IIC in a consanguineous Chinese family by next generation sequencing.

Authors:  Chunli Wei; Lisha Yang; Jingliang Cheng; Saber Imani; Shangyi Fu; Hongbin Lv; Yumei Li; Rui Chen; Elaine Lai-Han Leung; Junjiang Fu
Journal:  BMC Med Genet       Date:  2018-06-11       Impact factor: 2.103

7.  Expressions and significances of the angiotensin-converting enzyme 2 gene, the receptor of SARS-CoV-2 for COVID-19.

Authors:  Jiewen Fu; Baixu Zhou; Lianmei Zhang; Kyathegowdanadoddi Srinivasa Balaji; Chunli Wei; Xiaoyan Liu; Hanchun Chen; Jiangzhou Peng; Junjiang Fu
Journal:  Mol Biol Rep       Date:  2020-05-14       Impact factor: 2.316

8.  Mutation screening of the USH2A gene in retinitis pigmentosa and USHER patients in a Han Chinese population.

Authors:  Lulin Huang; Yao Mao; Jiyun Yang; Yuanfeng Li; Yang Li; Zhenglin Yang
Journal:  Eye (Lond)       Date:  2018-06-13       Impact factor: 3.775

9.  Identification of a novel germline BRCA2 variant in a Chinese breast cancer family.

Authors:  Jingliang Cheng; Jiangzhou Peng; Jiewen Fu; Md Asaduzzaman Khan; Pingping Tan; Chunli Wei; Xiyun Deng; Hanchun Chen; Junjiang Fu
Journal:  J Cell Mol Med       Date:  2019-11-28       Impact factor: 5.310

10.  A novel missense variant c.G644A (p.G215E) of the RPGR gene in a Chinese family causes X-linked retinitis pigmentosa.

Authors:  Jiewen Fu; Jingliang Cheng; Qi Zhou; Chunli Wei; Hanchun Chen; Hongbin Lv; Junjiang Fu
Journal:  Biosci Rep       Date:  2019-10-30       Impact factor: 3.840

View more
  1 in total

1.  PIK3CA hotspot mutations p. H1047R and p. H1047L sensitize breast cancer cells to thymoquinone treatment by regulating the PI3K/Akt1 pathway.

Authors:  Ju Zhou; Saber Imani; Marzieh Dehghan Shasaltaneh; Shuguang Liu; Tao Lu; Junjiang Fu
Journal:  Mol Biol Rep       Date:  2021-11-23       Impact factor: 2.316

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.