Literature DB >> 32945380

Role of the HIF‑1α/SDF‑1/CXCR4 signaling axis in accelerated fracture healing after craniocerebral injury.

Yonghua Xue1, Zhikun Li2, Yi Wang2, Xiaodong Zhu2, Ruixi Hu2, Wei Xu2.   

Abstract

The hypoxic state of the brain tissue surrounding craniocerebral injury induces an increase in the secretion of HIF‑1α during the healing process. HIF‑1α can promote mesenchymal stem cell (MSC) migration to ischemic and hypoxic sites by regulating the expression levels of molecules such as stromal cell‑derived factor‑1 (SDF‑1) in the microenvironment. Stem cells express the SDF‑1 receptor C‑X‑C chemokine receptor type 4 (CXCR4) and serve a key role in tissue repair, as well as a number of physiological and pathological processes. The present study aimed to determine the role of HIF‑1α/SDF‑1/CXCR4 signaling in the process of accelerated fracture healing during craniocerebral injury. Cultured MSCs underwent HIF‑1α knockdown to elucidate its effect on the proliferative ability of MSCs, and the effect of SDF‑1 in MSCs was investigated. It was also determined whether HIF‑1α could promote osteogenesis via SDF‑1/CXCR4 signaling and recruit MSCs. The results indicated that HIF‑1α knockdown suppressed MSC proliferation in vitro, and SDF‑1 promoted cell migration via binding to CXCR4. Furthermore, HIF‑1α knockdown inhibited MSC migration via SDF‑1/CXCR4 signaling. Considering the wide distribution and diversity of roles of SDF‑1 and CXCR4, the present results may form a basis for the development of novel strategies for the treatment of craniocerebral injury.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32945380      PMCID: PMC7453606          DOI: 10.3892/mmr.2020.11361

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Fracture healing is a multi-level and multi-path process regulated by systemic and local factors, involving numerous types of cells and growth factors, such as mesenchymal cells and transforming growth factor-β1 (TGF-β1) (1–3). Fracture non-union or delayed union is a common complication in orthopedics that causes physical and mental pain, as well as a notable economic burden to patients and society. Long-term clinical studies have revealed that, in the process of fracture healing, callus volume and formation rate are higher in patients with fractures combined with traumatic brain injury than in patients with simple fractures. Heterotopic ossification occurs in patients with craniocerebral trauma combined with a fracture, and fracture healing is accelerated (4,5). Numerous cytokines and neuropeptide factors, such as bone morphogenetic protein (BMP), TGF-β1, vascular endothelial growth factor, insulin-like growth factor, fibroblast growth factor and calcitonin gene-related peptides, can significantly promote osteoblast proliferation, thereby accelerating fracture healing (6–9). Although there have been advances in the study of osteoblasts in accelerated fracture healing, the underlying mechanisms remain unclear. Elucidating the mechanism by which fracture healing is accelerated may facilitate the development of effective clinical treatments for patients with delayed fracture healing. During craniocerebral injury, hypoxia promotes the expression of hypoxia-inducible factor-1α (HIF-1α), which can increase cell viability, and promote adhesion, migration and angiogenesis. HIF-1α is the most important hypoxia receptor and hypoxia-induced transcription factor known at present (10,11). An increase in HIF-1α activity can increase the viability of cells in hypoxic environments and promote cell adhesion, migration and angiogenesis (12,13). HIF-1α can promote stem cell migration to ischemic and hypoxic sites by regulating the expression levels of surface molecules as a result of interaction between a number of ligands and receptors including stromal cell-derived factor-1 (SDF-1), a downstream gene of HIF-1α, which binds to its specific receptor C-X-C chemokine receptor type 4 (CXCR4) to form a pair of coupling molecules (14,15). SDF-1 is a CXC-type chemokine produced by mesenchymal stem cells (MSCs). SDF-1 and its unique receptor CXCR4 constitute the biological axis of SDF-1/CXCR4 (16). SDF-1 and CXCR4 are expressed in numerous types of cells and tissues, where they serve a key role in tissue repair and a variety of physiological and pathological processes, including organogenesis, revascularization and response to tissue injury (17,18). However, their role in the process of accelerated fracture healing during craniocerebral injury and the regulatory effect of HIF-1α on SDF-1/CXCR4 in MSCs remains unclear. In the present study, MSCs, which serve a key role in fracture healing, were used as a model to investigate the role of the HIF-1α/SDF-1/CXCR4 signaling axis in accelerated fracture healing during craniocerebral injury in vitro.

Materials and methods

Mouse bone marrow mesenchymal stem cell (BMSC) culture

A total of 10 C57 mice (male; age, 4 weeks; weight, 18–20 g) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. Mice were housed in specific-pathogen-free conditions at room temperature (22±1°C) with relative humidity (50±5%), 12-h light/dark cycles, and free access to food and water. BMSCs were isolated as previously described (19). C57 mice were sacrificed via cervical dislocation and soaked in 75% alcohol for 10 min at room temperature. Under sterile conditions, the bilateral leg bones were extracted and separated from the surrounding muscle. The harvested tissue was placed in cold complete DMEM/F12 (DMEM/F12+10% FBS+1% penicillin/streptomycin/amphotericin B solution; Gibco; Thermo Fisher Scientific, Inc.). The culture medium was aspirated repeatedly with a needle and syringe to rinse the marrow cavity. Cells were dispersed by repeated pipetting, and the cell suspension was passed through a 400-mesh sterile mesh and centrifuged at 200 × g for 3 min, after which the supernatant was discarded. The cells were resuspended in complete DMEM/F12, and the density was adjusted to 5×105 cells/ml. Subsequently, the cell suspension (4 ml) was inoculated into a T-25 flask and cultured in a 5% CO2 incubator at 37°C. After 24 h, the flask was shaken horizontally to suspend unattached cells and the supernatant was discarded. Fresh medium was then added to the culture flask and changed every 2–3 days until the primary cells grew to a confluence of 80–90%. Cells were then sub-cultured as follows: Supernatant media was aspirated, and the cells were washed with 1 ml PBS and treated with 1 ml 0.25% trypsin for 2 min at 37°C. Cell morphology was observed by light microscopy (magnification, ×100). When the cells were rounded, 1 ml complete medium was added to terminate digestion, and the cells were gently pipetted to detach them from the bottom of the bottle completely. The cell suspension was transferred to a centrifuge tube and centrifuged at 200 × g for 3 min at room temperature, and the supernatant was removed. The cells were resuspended in complete DMEM/F12 and inoculated into a new culture flask at a ratio of 1:2. After passage, the cells were cultured in the same manner as the primary culture until the next generation.

Flow cytometry and MSC sorting

Third generation MSC cells were digested with 0.25% trypsin for 2 min at 37°C, and a single cell suspension was obtained by adjusting the cell density to 1×106 cells/ml. The cell suspension was incubated for 30 min at room temperature with PBS, anti-CD29-FITC (1.5 µl; cat. no. ab21845; Abcam), anti-CD44-FITC (2 µg; cat. no. ab25064; Abcam) or anti-CD45-FITC (10 µl; cat. no. ab27287; Abcam), and analyzed using a Coulter Epics XL-MCL flow cytometer (BD Biosciences) with EXPO32 software (version 1.2; BD Biosciences).

HIF-1α siRNA transfection

MSC cells were seeded in 6-well culture plates (5×105 cells/well) overnight. The inoculated cells were washed twice with PBS, and 500 µl serum-free DMEM/F12 (Gibco; Thermo Fisher Scientific, Inc.) was added. The HilyMax-HIF-1α siRNA transfection mixture (Dojindo Molecular Technologies, Inc.) and siRNA control were premixed (0.2 µg/µl), added to the MSCs and mixed. siRNA and siRNA control were obtained from Sangon Biotech Co., Ltd. After incubating the cells in the cell culture incubator for 6 h at 37°C, the medium was replaced with fresh medium. The cells were trypsinized and collected for subsequent experiments after transfection for 48 h. The sequences of siRNAs used are presented in Table I.
Table I.

Sequences of siRNA.

siRNASequence (5′→3′)
HIF-1α-Mus-762F: CUGAUAACGUGAACAAAUATT
R: UAUUUGUUCACGUUAUCAGTT
HIF-1α-Mus-1102F: CAUUCCUCAUCCGUCAAAUTT
R: AUUUGACGGAUGAGGAAUGTT
HIF-1α-Mus-1238F: GGCCGCUCAAUUUAUGAAUTT
R: AUUCAUAAAUUGAGCGGCCTT

siRNA, small interfering RNA; F, forward; R, reverse.

Reverse transcription-quantitative (RT-q) PCR analysis

Total RNA was extracted from cells with TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). cDNA synthesis was performed using the TOYOBO ReverTra Ace qPCR RT kit, according to the manufacturer's protocol. qPCR was performed using the KAPA SYBR-Green Supermix PCR kit (Kapa Biosystems). RT-qPCR primers were obtained from Sangon Biotech Co., Ltd.; sequences are listed in Table II. The reaction was started at 95°C for 5 min, followed by 40 cycles of 95°C for 30 sec, 61°C for 30 sec, and 72°C for 30 sec. Relative gene expression levels were measured using the cycle threshold values and the 2−ΔΔCq method (20).
Table II.

Sequences of reverse transcription-quantitative PCR primers.

GeneSequence (5′→3′)
Stromal cell-derivedF: GCATCAGTGACGGTAAACCA
factor-1R: TCTTCAGCCGTGCAACAATC
C-X-C chemokineF: CTAAGGAGCATGACGGACAA
receptor type 4R: ATTTCCCAAAGTACCAGTCAGC
GAPDHF: TGACCTCAACTACATGGTCTACA
R: CTTCCCATTCTCGGCCTTG

F, forward; R, reverse.

Western blotting and antibodies

Cells treated with siRNA were harvested for protein extraction using the RIPA reagent (Pierce; Thermo Fisher Scientific, Inc.). The protein concentration was determined via BCA protein assay reagent. After measuring protein concentration, 50–100 µg protein was subjected to 10% SDS-PAGE gel and transferred to a PVDF membrane. The membrane was blocked with 5% non-fat milk powder for 1 h at room temperature and incubated with primary antibodies against HIF-1α (1:1,000; cat. no. ab179483; Abcam), SDF-1 (1:1,000; cat. no. ab25117; Abcam), and CXCR4 (1:1,000; cat. no. ab124824; Abcam) at 4°C overnight, followed by goat-anti-rabbit (1:2,000; cat. no. ab205718; Abcam) secondary antibody for 1 h at 37°C. The chemiluminescent signaling was detected via ECL reagents (Pierce; Thermo Fisher Scientific, Inc.).

Cell proliferation assay

Cell proliferation was assessed using Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc.). Briefly, MSCs were seeded on 96-well microplates at a density of 1×104 cells/well. The cells were transfected with HilyMax-siRNA and cultured for 0, 24 or 48 h at 37°C. A total of 5 µl CCK-8 solution was then added to each well and incubated at 37°C for an additional 2 h. Optical density (OD) was determined at a wavelength of 450 nm.

Migration assay

Migration assays were performed using 24-well plate with permeable Transwell inserts (pore size 0.4 mm; Corning, Inc.). BMSCs were suspended in serum-free DMEM/F12 medium (5×104 cells/well) and equal amounts of cell suspension (200 µl) was added to the upper chambers on the migration plate. The same amount (200 µl) of complete medium (DMEM/F12+10% FBS) with different treatment was added to the lower chamber of the migration plate separately. There were two sets of experiments. In the first, cells were divided into the following treatment groups for 24 h at 37°C: 0 ng/ml SDF-1+0 µM AMD3100 (a specific antagonist that blocks the binding of SDF-1 to CXCR4; cat. no. A5602; Sigma-Aldrich; Merck KGaA); 10 ng/ml SDF-1+0 µM AMD3100; 100 ng/ml SDF-1+0 µM AMD3100; 100 ng/ml SDF-1+1 µM AMD3100; and 100 ng/ml SDF-1+10 µM AMD3100. For the second experiment, cells were divided into the following treatment groups for 24 h at 37°C: NC (siRNA-NC), siRNA (HIF-1α-siRNA), SDF-1 (siRNA-NC+100 ng/ml SDF-1), and siRNA and SDF-1 group (HIF-1α siRNA+100 ng/ml SDF-1). After 24 h, the migrated cells on the bottom of the insert were fixed with 4% paraformaldehyde solution for 24 h at room temperature and stained with crystal violet (1%) for 15 min at room temperature. The cells were processed as described in the cell migration assay, and migrated cells were counted, and the relative number was calculated with light microscopy (magnification, ×100).

Statistical analysis

Results are representative of three independent experiments. GraphPad Prism (version 7.0; GraphPad Software, Inc.) and SPSS software (version 19; IBM Corp.) were used for statistical analysis of cell proliferation, as well as the results of the Transwell assay and RT-qPCR. Differences between two groups were analyzed using an unpaired t-test. Comparisons between multiple groups were analyzed using one-way ANOVA followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Morphological identification of MSCs

The present study determined whether the HIF-1α/SDF-1/CXCR4-axis serves a role in fracture combined with traumatic brain injury in an in vitro BMSC model. MSCs exhibited a typical spindly morphology (Fig. 1A). Cells in the third passage were characterized via flow cytometry. The results demonstrated that the expression levels of CD29 and CD44 on the surface of BMSCs were >95%, whereas the expression level of the hematopoietic stem cell marker CD45 was <5% (Fig. 1B), which was consistent with the characteristics of BMSCs.
Figure 1.

Cell morphology and characterization. Morphology of mouse MSCs at passage 3. (A) MSC morphology observed after one week of primary culture. (B) Immunophenotype of MSCs at passage 3 determined via flow cytometric analysis of CD45, CD29 and CD44 expression levels. MSC, mesenchymal stem cell; NC, negative control.

HIF-1α knockdown suppresses MSC proliferation in vitro

Next, the effects of HIF-1α on the migration of MSCs were investigated. In order to assess the effect of HIF-1α knockdown on cell proliferation, CCK-8 was used to detect proliferation at different time-points. The OD value of HIF-1α-knockdown cells was significantly decreased at 450 nm (Fig. 2), indicating that HIF-1α knockdown inhibits MSC proliferation.
Figure 2.

HIF-1α knockdown inhibits MSC proliferation. (A) HIF-1α mRNA levels decreased after siRNA-762, siRNA-1102 or siRNA-1238 was transfected into MSCs. The results are representative of three independent experiments. (B) A CCK-8 assay was performed to determine the effects of HIF-1α knockdown on MSC proliferation. *P<0.05, **P<0.01. MSC, mesenchymal stem cell; siRNA, small interfering RNA; CCK-8, Cell Counting Kit-8; NC, negative control; OD, optical density.

SDF-1 promotes cell migration by binding to CXCR4

In order to confirm the effect of SDF-1 in MSCs, its impact on cell migration was analyzed. Treatment of MSCs with various concentrations of SDF-1 caused a dose-dependent increase in cell migration (Fig. 3A). Cell migration induced by SDF-1 was abrogated by AMD3100, indicating that AMD3100 inhibits MSC migration via obstructing SDF-1 binding with CXCR4 (Fig. 3B). Collectively, these results indicated that SDF-1 promoted MSC migration via binding to CXCR4, which was impaired by AMD3100.
Figure 3.

SDF-1 binding to C-X-C chemokine receptor type 4 promotes MSC migration. (A) MSC migration ability was studied via Transwell assay. MSCs were exposed to 0, 10 or 100 ng/ml SDF-1 for 24 h, and migration was observed. (B) MSC migration following exposure to 100 ng/ml SDF-1+1 µM AMD3100 or 100 ng/ml SDF-1+10 µM AMD3100. (C) Graph revealing the average number of migrated cells per field. *P<0.05, ***P<0.001. SDF-1, stromal cell-derived factor-1; MSC, mesenchymal stem cell.

HIF-1α knockdown inhibits MSC migration via SDF-1/CXCR4 signaling

It was then determined whether knockdown of HIF-1α impairs the chemotactic function of SDF-1/CXCR4 signaling in MSCs. The mRNA and protein levels of SDF-1 and CXCR4 were decreased in MSCs stably transfected with siHIF-1α compared with NC group (Fig. 4A). Moreover, HIF-1α knockdown inhibited MSC migration; replenishment of SDF-1 increased cell migration (Fig. 4B and C). Thus, HIF-1α likely regulates MSC migration via SDF-1/CXCR4 signaling.
Figure 4.

HIF-1α knockdown inhibits MSC migration via SDF-1/CXCR4 signaling. (A) SDF-1 and CXCR4 in MSCs were identified via western blotting and reverse transcription-quantitative PCR. (B) Migration ability was studied via Transwell assays; MSCs were exposed to siRNA-NC, HIF-1α-siRNA, siRNA-NC+100 ng/ml SDF-1, or HIF-1α siRNA+100 ng/ml SDF-1. (C) Graph revealing the average number of migrated cells per field. *P<0.05, **P<0.01. MSC, mesenchymal stem cell; SDF-1/CXCR4, stromal cell-derived factor-1/C-X-C chemokine receptor type 4; siRNA, small interfering RNA; NC, negative control.

Discussion

In the present study, the proliferation rate of MSCs transfected with HIF-1α siRNA significantly decreased at 24 and 48 h. MSCs are essential for the repair of bone defects, and improving the effects of MSCs in bone is of clinical interest. In patients with skull injuries, ischemia and hypoxia surrounding brain tissue often occur, and the skull bone repair process must be adapted to the hypoxic environment (10,21). HIF-1α can maintain homeostasis of oxygen under hypoxia, allowing the body to adapt to hypoxia (22). HIF-1α can induce the formation of blood vessels and bone tissue via numerous factors, including vascular endothelial growth factor, angiopoietin, platelet growth factor and transforming growth factor, making it a potential candidate for the treatment of bone defects and other types of disease (23,24). HIF-1α is a regulator of BMP2-induced chondrogenic differentiation, osteogenic differentiation and endochondral bone formation (25). HIF-1α and BMP2 have been revealed to synergistically induce MSC differentiation and promote the expansion of the proliferating chondrocyte zone (25). HIF-1 also serves an important role in coupling osteogenesis and angiogenesis during skeletal development and bone regeneration, and HIF-1α overexpression may represent a therapeutic option to improve cellular functions of MSCs in the treatment of critical-sized bone defects (26). Thus, HIF-1α may improve the cellular functions of MSCs; however, the underlying molecular mechanisms are still unclear. SDF-1 is a protein secreted primarily by MSCs. When SDF-1 specifically binds to CXCR4 on a number of types of cell surface, activated SDF-1/CXCR4 can stimulate downstream signaling pathways associated with the regulation of stem cell mobilization and migration (27), induce MSC migration to the damaged site and participate in injury repair (28,29). Activation of the ERK-AKT pathway mediates SDF1-induced cell migration. SDF1/CXCR4 signaling is required for MSC homing and retention to their niche in the bone marrow (30). Secretion of SDF-1 has been revealed to increase during bone regeneration, allowing CXCR4-expressing MSCs to enter the stretch region with the concentration gradient of SDF-1 following induction via the SDF-1/CXCR4 molecular axis, and to participate in new bone formation and cardiovascular generation (31–33). In order to confirm the effect of SDF-1 in MSCs, the present study analyzed the chemotactic effect of the SDF-1/CXCR4 axis on MSCs. SDF-1 was demonstrated to promote the migration of MSCs in a dose-dependent manner. This result is similar to that reported by Zhou et al (25), who demonstrated that HIF-1α can regulate cell migration by influencing the expression levels of CXCR4. Additionally, by using AMD3100 to block the binding of SDF-1 to CXCR4, SDF-1-induced cell migration in the present study was abrogated, indicating that AMD3100 inhibits MSC migration by obstructing SDF-1 binding with CXCR4. Therefore, the SDF-1/CXCR4 axis serves a key role in MSC function. SDF-1/CXCR4 signaling has been revealed to play an important role in cell migration, chemotaxis as well as other biological behaviors. SDF-1-induced transendothelial behavior has been revealed to be positively associated with the density of cell surface receptor CXCR4 and is affected by a number of factors (34). HIF-1α is a central transcription factor of hypoxia-specific gene expression levels (30). HIF-1α can bind to the SDF-1 promoter and specifically regulate the expression levels of SDF-1 (30,35). Hypoxia can upregulate the expression levels of CXCR4 in human monocytes and macrophages, as well as endothelial and tumor cells, via the activation of HIF-1α (36). The hypoxia/HIF-1α/CXCR4 pathway may be a mechanism of regulating the migration of different types of cells under hypoxia (37). A number of CXCR4-positive stem cells are involved in angiogenesis in locally damaged areas in a hypoxic environment. The adhesion, migration and homing of these CXCR4-positive stem cells are initiated via binding of SDF-1, containing hypoxia response elements, to CXCR4; the expression levels of SDF-1 are regulated by HIF-1α (38). The present study therefore determined whether HIF-1α can recruit MSCs and promote osteogenesis via the SDF-1/CXCR4 molecular axis. Following HIF-1α knockdown, it was demonstrated that the mRNA and protein levels of SDF-1 and CXCR4 in MSCs were significantly decreased. HIF-1α gene silencing inhibited the migration of MSCs (P<0.05). This confirmed that SDF-1 promotes the migration of MSC cells and indicated that HIF-1α acts on MSCs via the SDF-1/CXCR4 molecular axis. However, further investigation is required to elucidate the mechanisms underlying the effect of HIF-1α on oxidative stress in the healing process of skull injury, which may involve complex signaling pathways. During craniocerebral injury healing, the hypoxic state of surrounding brain tissue induces an increase in the secretion of HIF-1α (39), which accelerates the fracture repair process via chemotaxis due to the SDF-1/CXCR4 axis. In the present study, a gene silencing plasmid was successfully constructed based on the HIF-1α gene sequence, and the regulatory association between HIF-1α and SDF-1/CXCR4 was elucidated. Silencing of HIF-1α decreased MSC migration, as well as the mRNA and protein levels of SDF-1 and CXCR4 in MSCs. Due to the wide distribution and diversity of roles of SDF-1 and CXCR4, they may represent prognostic biomarkers or therapeutic targets for a number of neurological diseases.
  39 in total

1.  SDF-1α and CXCR4 as therapeutic targets in cardiovascular disease.

Authors:  Jessica Wen; Jian-Qing Zhang; Wei Huang; Yigang Wang
Journal:  Am J Cardiovasc Dis       Date:  2011-12-15

Review 2.  Biological perspectives of delayed fracture healing.

Authors:  K D Hankenson; G Zimmerman; R Marcucio
Journal:  Injury       Date:  2014-06       Impact factor: 2.586

3.  Hypoxia promotes chondrogenesis in rat mesenchymal stem cells: a role for AKT and hypoxia-inducible factor (HIF)-1alpha.

Authors:  Manoj Kanichai; Damien Ferguson; Patrick J Prendergast; Veronica A Campbell
Journal:  J Cell Physiol       Date:  2008-09       Impact factor: 6.384

4.  Leukocyte-endothelium interaction promotes SDF-1-dependent polarization of CXCR4.

Authors:  Jaap D van Buul; Carlijn Voermans; Jose van Gelderen; Eloise C Anthony; C Ellen van der Schoot; Peter L Hordijk
Journal:  J Biol Chem       Date:  2003-05-23       Impact factor: 5.157

5.  Tissue-specific muscle, neural and liver stem/progenitor cells reside in the bone marrow, respond to an SDF-1 gradient and are mobilized into peripheral blood during stress and tissue injury.

Authors:  Magda Kucia; Janina Ratajczak; Ryan Reca; Anna Janowska-Wieczorek; Mariusz Z Ratajczak
Journal:  Blood Cells Mol Dis       Date:  2004 Jan-Feb       Impact factor: 3.039

6.  Interactions of chemokines and chemokine receptors mediate the migration of mesenchymal stem cells to the impaired site in the brain after hypoglossal nerve injury.

Authors:  Jun Feng Ji; Bei Ping He; S Thameem Dheen; Samuel Sam Wah Tay
Journal:  Stem Cells       Date:  2004       Impact factor: 6.277

7.  The effect of low-level diode laser therapy on early differentiation of osteoblast via BMP-2/TGF-β1 and its receptors.

Authors:  Francisco J Manzano-Moreno; Rosa Medina-Huertas; Javier Ramos-Torrecillas; Olga García-Martínez; Concepción Ruiz
Journal:  J Craniomaxillofac Surg       Date:  2015-09-09       Impact factor: 2.078

8.  MicroRNA-141-3p Negatively Modulates SDF-1 Expression in Age-Dependent Pathophysiology of Human and Murine Bone Marrow Stromal Cells.

Authors:  Sudharsan Periyasamy-Thandavan; John Burke; Bharati Mendhe; Galina Kondrikova; Ravindra Kolhe; Monte Hunter; Carlos M Isales; Mark W Hamrick; William D Hill; Sadanand Fulzele
Journal:  J Gerontol A Biol Sci Med Sci       Date:  2019-08-16       Impact factor: 6.053

Review 9.  Mesenchymal Stem Cells in Bone Regeneration.

Authors:  M Noelle Knight; Kurt D Hankenson
Journal:  Adv Wound Care (New Rochelle)       Date:  2013-07       Impact factor: 4.730

10.  Regulation of the chemokine receptor CXCR4 by hypoxia.

Authors:  Tiziana Schioppa; Badarch Uranchimeg; Alessandra Saccani; Subhra K Biswas; Andrea Doni; Annamaria Rapisarda; Sergio Bernasconi; Simona Saccani; Manuela Nebuloni; Luca Vago; Alberto Mantovani; Giovanni Melillo; Antonio Sica
Journal:  J Exp Med       Date:  2003-11-03       Impact factor: 14.307

View more
  6 in total

1.  p53 deficiency promotes bone regeneration by functional regulation of mesenchymal stromal cells and osteoblasts.

Authors:  Toshimichi Nagashima; Tadashi Ninomiya; Yoshiki Nakamura; Shirabe Nishimura; Akiko Ohashi; Junya Aoki; Toshihide Mizoguchi; Morio Tonogi; Tomihisa Takahashi
Journal:  J Bone Miner Metab       Date:  2022-02-23       Impact factor: 2.626

2.  Sevoflurane but not propofol enhances ovarian cancer cell biology through regulating cellular metabolic and signaling mechanisms.

Authors:  Cong Hu; Bincheng Wang; Zhigang Liu; Qiling Chen; Masashi Ishikawa; Han Lin; Qingquan Lian; Jun Li; Jia V Li; Daqing Ma
Journal:  Cell Biol Toxicol       Date:  2022-10-08       Impact factor: 6.819

Review 3.  Sinking Our Teeth in Getting Dental Stem Cells to Clinics for Bone Regeneration.

Authors:  Sarah Hani Shoushrah; Janis Lisa Transfeld; Christian Horst Tonk; Dominik Büchner; Steffen Witzleben; Martin A Sieber; Margit Schulze; Edda Tobiasch
Journal:  Int J Mol Sci       Date:  2021-06-15       Impact factor: 5.923

4.  Chronic Intermittent Hypobaric Hypoxia Enhances Bone Fracture Healing.

Authors:  Li Zhang; Lin Jin; Jialiang Guo; Kai Bao; Jinglue Hu; Yingze Zhang; Zhiyong Hou; Liping Zhang
Journal:  Front Endocrinol (Lausanne)       Date:  2021-02-16       Impact factor: 5.555

5.  Impact of High-Altitude Hypoxia on Early Osseointegration With Bioactive Titanium.

Authors:  Yarong Wang; Zekun Gan; Haibin Lu; Ziyi Liu; Peng Shang; Jian Zhang; Wuwei Yin; Hongxing Chu; Renlei Yuan; Yingxin Ye; Pei Chen; Mingdeng Rong
Journal:  Front Physiol       Date:  2021-11-18       Impact factor: 4.566

6.  Downregulation of miR-221-3p by LncRNA TUG1 Promoting the Healing of Closed Tibial Fractures in Mice.

Authors:  Laiyou Liu; Yinpeng Yuan
Journal:  Biomed Res Int       Date:  2022-08-26       Impact factor: 3.246

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.