The calmodulin redox sensor controls myogenesis.

Muscle aging is accompanied by blunted muscle regeneration in response to injury and disuse. Oxidative stress likely underlies this diminished response, but muscle redox sensors that act in regeneration have not yet been characterized. Calmodulin contains multiple redox sensitive methionines whose oxidation alters the regulation of numerous cellular targets. We have used the CRISPR-Cas9 system to introduce a single amino acid substitution M109Q that mimics oxidation of methionine to methionine sulfoxide in one or both alleles of the CALM1 gene, one of three genes encoding the muscle regulatory protein calmodulin, in C2C12 mouse myoblasts. When signaled to undergo myogenesis, mutated myoblasts failed to differentiate into myotubes. Although early myogenic regulatory factors were present, cells with the CALM1 M109Q mutation in one or both alleles were unable to withdraw from the cell cycle and failed to express late myogenic factors. We have shown that a single oxidative modification to a redox-sensitive muscle regulatory protein can halt myogenesis, suggesting a molecular target for mitigating the impact of oxidative stress in age-related muscle degeneration.

Introduction

Aging causes a decline in muscle power and speed due to muscle atrophy and weakness; by the age of 80, humans lose 40% of muscle mass and 50% of muscle power [1]. The primary alteration in aged muscle is a disproportionate decrease in protein synthesis, increase in protein breakdown [2], and functional dysregulation of muscle proteins [3-6]. Exercise is a potent modulator of muscle physiology and can prevent some, but not all, of the negative impacts of aging on muscle strength [2, 7]. In healthy adults, injured or overused muscle is regenerated through muscle satellite cells. These are stem cells in the myoblast stage of differentiation that can differentiate into myotubes, which fuse with existing fibers to repair damage. A predominant feature of muscle aging is the diminished ability to regenerate muscle fibers after injury or wasting associated with cancer, congestive heart failure, and broken bones [8, 9]. Not only are there fewer satellite cells in aged muscle, their capacity for proliferation, activation, and differentiation is reduced [9]. Aged muscle satellite cells experience higher levels of oxidative stress, reduced antioxidant capacity, disrupted protein homeostasis, epigenetic alterations, and reduced mitochondrial activity [10]. Oxidative stress is known to adversely influence myoblast survival and ability to repair damaged muscle [11]. Indeed, in vitro myogenesis is impaired by oxidative stress and supported by a reducing environment [12-16]. Although it is clear that signaling via reactive oxygen species (ROS) regulates myogenesis at numerous points [17], it is imperative to identify specific protein redox sensors that are targets of cellular oxidation and serve to propagate redox signals throughout metabolic and transcriptional networks, orchestrating changes in muscle physiology that ultimately define human healthspan.

Proteomics approaches have been useful in identifying muscle regulatory and contractile proteins that are oxidatively modified with aging [18, 19]. Systematic biochemical approaches by our group and others have shown that these oxidative modifications impact muscle protein structure and function [20-23]. Two decades of work suggest that the muscle regulatory protein calmodulin (CaM) is poised to act as a key redox-sensitive modulator of muscle physiology. CaM is the brilliant conductor of the cellular orchestra that plays in response to intracellular Ca2+, playing pivotal roles in Ca2+ dynamics and signaling, muscle contraction and remodeling, metabolism, autophagy, cell proliferation, and cell death [24-26]. There is evidence that CaM modulates its response to Ca2+ according to cellular redox status. CaM has unusually high methionine (Met) content, including 46% of the hydrophobic residues in its binding pockets, which are crucial for CaM binding to hundreds of diverse targets. CaM’s nine Met are susceptible and functionally sensitive to cellular oxidants [27-29]. CaM isolated from aged brains cannot fully activate the plasma membrane Ca2+ ATPase due to age-related Met oxidation that blocks productive association between CaM and the Ca2+ ATPase [30, 31]. Progressively oxidized CaM (in vitro) cannot fully activate CaMKII [32, 33], adenylyl cyclase [34], or nitric oxide synthase [35]. CaM’s C-terminal Mets, particularly Met 109 and Met 124, are crucial for ryanodine receptor (RyR) channel regulation [36, 37]. Our group has delineated the molecular structural mechanism by which oxidation of CaM’s C-terminal Met (M109 and M124, see Fig 1B) trigger changes in CaM conformational dynamics [20, 38]. Thus far, biochemical investigations of CaM-target protein interactions and biophysical investigations of CaM conformational dynamics indicate that CaM is poised to act as a potent cellular redox sensor. However, nobody has characterized the site-specific impact of CaM Met oxidation on muscle physiology.

Fig 1

CALM1 gene editing in mouse myoblasts.

(A) Methionine can be oxidized to methionine sulfoxide by cellular oxidants; glutamine substitution mimics methionine sulfoxide. (B) Structural models of CaM (blue) bound to the RyR peptide (tan) with four bound Ca2+ atoms (orange); CaM Met 109 and Met 124 sidechains are shown (PDB: 1BCX). (C) CRISPR-Cas 9 editing of C2C12 myoblasts. Sanger sequencing of the target region in CALM1 for the 2A4 and 3C2 cell lines. The wild type (WT) sequence, donor DNA sequence, and the mutant sequences are shown (antisense). Mutations are indicated in red. Nucleotides encoding M109(Q) are underlined in red.

Muscle regeneration occurs when muscle satellite cells undergo myogenesis, a precisely orchestrated process that includes (1) the activation of muscle-specific transcription factors, (2) phenotypic differentiation that includes the expression of muscle contractile and regulatory proteins, (3) and fusion of muscle cells to form a mature, multinucleated myotube. Myogenic regulatory factors (MRFs) including MyoD, Myf5, myogenin, and MRF4, are basic helix-loop-helix (bHLH) transcription factors that direct progenitor cells to commit to the muscle cell lineage and carry out the differentiation program [39]. MyoD and Myf5 are expressed in undifferentiated, proliferating myoblasts, while myogenin and MRF4 are induced after cell cycle withdrawal during later phases of differentiation [40, 41]. Myoblast commitment to the differentiation pathway is marked by myogenin expression. The myogenin promoter is regulated via two distinct enhancer regions, an A/T rich element recognized by MEF2 transcription factors and an E-box recognized by MyoD [42]. MyoD is involved not only in myoblast proliferation and the transcriptional cascade that promotes muscle cell differentiation, but paradoxically, also triggers cell cycle arrest. MyoD drives the expression of at least three cell cycle inhibitors that include p21, a cyclin-dependent kinase inhibitor that blocks entry to the cycle cell at S phase [43], retinoblastoma growth suppressor (Rb) [44], and cyclin D3 [45], which together induce terminal cell cycle withdrawal. Once the myoblast has withdrawn from the cell cycle and committed to differentiation, structural and contractile proteins are expressed, and myoblasts fuse with damaged fibers.

Ca2+ is a crucial component of the muscle differentiation medium [46], and Ca2+ signaling pathways are now implicated at every step of myogenesis [47]. Downstream effectors of Ca2+ are numerous, but Ca2+-bound CaM (CaCaM), CaCaM-dependent kinases, and the CaCaM-calcineurin complex play key roles in facilitating myogenesis [48]. Given CaM’s central role in Ca2+ signaling and CaM’s structural and functional sensitivity to oxidation, we hypothesize that CaM serves as a muscle redox sensor that blocks myogenesis when the redox balance tips toward oxidative stress. We have used the CRISPR-Cas9 system to knock-in a single amino acid mutation that mimics the oxidative modification of a single Met to Met sulfoxide (M109Q) in one or both alleles of the CALM1 gene, one of three genes encoding the muscle regulatory protein CaM in mammalian cells. We have shown that a single oxidative modification to a redox-sensitive muscle regulatory protein can halt myogenesis, suggesting a molecular target for mitigating the impact of oxidative stress in age-related muscle degeneration.

Methods

C2C12 cell culture and differentiation

C2C12 cells from American Type Cell Collection (Manassas, VA, USA) were cultured in DMEM growth medium (GM) containing 25 mM glucose, 4 mM L-alanyl-glutamine (GlutaMax), 10% fetal bovine serum (FBS), and 1% penicillin/streptomycin (ThermoFisher, USA) at 37°C and 5% CO2. Cells were passed at 75% confluency using 0.25% trypsin to lift adherent cells; cells were discarded after 20 passages. Differentiation was induced by removing FBS from the growth medium and replacing it with 2% horse serum (ThermoFisher). The addition of differentiation medium (DM) is defined as day 1 of differentiation. Cells were typically differentiated for 96 hours, with medium replacement every 48 hours.

CRISPR gene editing, clonal isolation, and sequencing

The Alt-R CRISPR-Cas 9 system (Integrated DNA Technologies, USA) was used to introduce a point mutation in the mouse CALM1 gene (Gene ID: 12313). The gRNA was composed of a complex of a crispr RNA (crRNA) that directs Cas9 to the cut site and a transactivating RNA (tracrRNA) that serves as a scaffold for attaching the crRNA to Cas9. Several crRNAs were assayed for cutting efficiency. A long (60 bp) single-stranded DNA oligo was synthesized by Integrated DNA Technologies to be used as a donor DNA (dDNA) to knock-in mutations near the cut site (Fig 1C). The gRNA was made by incubating 5 μM crRNA with an equimolar amount of tracrRNA in nuclease-free duplex buffer at 95°C for 5 mins. The Cas9:gRNA ribonucleoprotein (RNP) complex was made by incubating 1 μg/μL Cas9, 5 μM (170 ng/μL) gRNA, and Cas9 PLUS reagent in OptiMem (ThermoFisher) for 5 mins at 25°C. RNP complexes were prepared for transfection by incubating the RNP complex and dDNA in CRISPRMAX lipofectamine (ThermoFisher) for 15 mins at 25°C. Cells were transfected by seeding 105 cells in DMEM with 10% FBS, but no antibiotics, followed by immediate addition of the prepared lipofectamine/RNP/dDNA mix while cells were still suspended. Cells grew under normal conditions for 24 h before they were harvested for both clonal isolation and a genomic cleavage detection assay (Integrated DNA Technologies) to estimate cutting efficiency.

Genomic cleavage detection assay

Genomic DNA was prepared from CRISPR-treated C2C12 cells using QuickExtract (Lucigen, Madison, WI, USA). The targeted region of CALM1 (400 bp) was PCR amplified using AmpliTaq Gold (ThermoFisher). The PCR amplicons were heated to 95°C and then slowly re-annealed so that mismatches would occur between native (unmutated DNA) and CRISPR-edited DNA. Mismatches were detected using T7 endonuclease (New England Biolabs, Ipswich, MA, USA), which cuts mismatched regions of duplex DNA, including single base mismatches. The extent of T7 cutting was quantified using gel electrophoresis.

Screening for CRISPR-edited cells

CRISPR-edited cells were diluted to 12 cells/mL and used to seed a 96-well plate to isolate individual transfected cells. Colonies which grew from isolated cells, identified by phase contrast microscopy, were expanded for 2–3 weeks. Genomic DNA was prepared from approximately 200 expanded clonal isolates using QuickExtract (Lucigen). The targeted region of CALM1 (400 bp) was PCR amplified and treated with BspHI (New England Biolabs), which cut native dsDNA, but not CRISPR-edited dsDNA. DNA from approximately 40 samples that passed the screen were sequenced via Sanger sequencing (Eton Bioscience, USA).

Immunofluorescence labeling and microscopy

Cells were differentiated in 96-well plates and then fixed at time-points with 5% formaldehyde (ThermoFisher) for 15 min, permeabilized with 0.5% Triton-X 100 (ThermoFisher) for 15 min, and blocked with 5% w/v BSA in PBS for 1 h. Primary antibodies include anti-MyoD G-1 (1:250, Santa Cruz Biotechnology, USA), anti-p21 F-5 (1:50, Santa Cruz Biotechnology), anti-p53 DO-1 (1:50, Santa Cruz Biotechnology), anti-phospho-p53 Ser 315 (1:50, Santa Cruz Biotechnology), anti-myogenin F5D (1:250, ThermoFisher), and anti-MHC MF20 (1:50, R&D Systems, USA). All primary antibodies were diluted in 5% w/v BSA in PBS and applied to blocked myotubes for 1 h. All primary antibodies were visualized using 1:200 Alexa Fluor 488 goat anti-mouse IgG (ThermoFisher). Nuclei were stained using NucBlue Live Cell Stain (ThermoFisher) for 15 min, and samples were preserved using Prolong Gold Antifade (ThermoFisher). All experiments were performed in triplicate. Images were acquired using an Eclipse Ts2R inverted fluorescence microscope (Nikon, Melville, NY, USA), a Zyla sCMOS camera (Andor, Belfast, UK), and NIS Elements basic research software (Nikon).

Live cell imaging

Cells were imaged in Live Cell Imaging Solution (ThermoFisher) in cell culture flasks or plates. MitoTracker Red and LysoTracker Deep Red (ThermoFisher) were used as recommended by the manufacturer.

Image analysis

CellProfiler [49] was used to detect and quantify nuclei and myotubes. Myogenin abundance was quantified as a ratio of nuclei expressing myogenin to total nuclei. Myotube abundance was quantified as a ratio of the number of nuclei in multinucleated myotubes to total nuclei [50].

Cell proliferation assay

Cells were seeded in a 96-well plate at a density of 104 cells in 100 μL of media. At each time-point, 20 μL CellTiter 96 Aqueous One Solution (Promega, Madison, WI, USA) was added to wells, incubated at 37°C and 5% CO2 for 2 h, and then absorbance at 490 nm was measured using a SpectroMax 190 plate reader (Molecular Devices, San Jose, CA, USA). Triplicate wells were read for each time-point.

RT-qPCR

Total RNA was isolated from differentiated C2C12 cells at various time-points using the PureLink RNA Mini Kit (ThermoFisher). Reverse transcription of RNA was performed with iScript (Bio-Rad, Hercules, CA, USA) using 1 μg of RNA. The following mouse transcripts were analyzed: beta actin (Actb, Gene ID 11461); cyclin-dependent kinase inhibitor 1A (p21, Gene ID 12575); retinoblastoma tumor suppressor (Rb1, Gene ID 19645); myogenin (MyoG, Gene ID 17928); myogenic differentiation 1 (MyoD, GeneID 17927); myocyte enhancer factor 2C (MEF2C, Gene ID 17260); myogenic factor 6 (Myf6, MRF4 Gene ID 17878); mouse calmodulin 1 (CALM1, GeneID 12313; mouse calmodulin 2 (CALM2, GeneID 12314); mouse calmodulin 3 (CALM3, GeneID 12315); inhibitor of DNA-binding 3 (Id3, Gene ID 15903); inhibitor of DNA-binding 2 (Id2, Gene ID 15902; and early growth response 1 (Egr-1, Gene ID: 13653). Beta-actin was used as a reference gene. Real-time PCR was performed using CFX96 Touch Real-Time PCR Detection System (Bio-Rad) and the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Reactions were performed using 50 ng of cDNA and included a preincubation (95°C for 5 min), 45 amplification cycles, and melting curve analysis for verification of specific product.

Western blotting

Lysate preparation

Cell lysates were prepared by resuspending 5 x 106 pelleted cells in 1X RIPA buffer (ThermoFisher) containing 5X Halt Protease Inhibitor (ThermoFisher) on ice for 15 min, followed by centrifugation at 14,000 x g for 10 min to clear the lysate. Protein concentration was quantified using the BCA Protein Quantification Kit (ThermoFisher). Samples were prepared by mixing 100 μg of lysate with 10 μL 2X Laemmli buffer (Sigma-Aldrich, USA) containing 1 μL beta-mercaptoethanol (Sigma-Aldrich). After adding Milli-Q water to 20 μL, samples were incubated at 95°C for 5 min.

SDS-PAGE and transfer

SDS-PAGE was performed using Mini-PROTEAN TGX Precast Gels (Bio-Rad) and the Mini-PROTEAN Tetra Cell system (Bio-Rad) at 90V. Transfer of protein from the gel to a PVDF membrane were performed using a Trans-Blot Turbo Transfer System (Bio-Rad), a PowerPac Basic (Bio-Rad) power supply, and a Trans-Blot Turbo RTA Transfer Kit (Bio-Rad). Precision Plus Protein Dual Color Standard (Bio-Rad) was used to monitor electrophoresis and to detect transfer to the PVDF membrane. A biotinylated protein ladder (Cell Signaling Technology, Danvers, MA, USA) was detectable during chemiluminecent imaging.

Antibodies

The PVDF membrane was blocked in 5% w/v nonfat dry milk in 1X TBS and 0.1% Tween 20 (TBST, Bio-Rad) for 1 h prior to antibody incubations. Actin was probed using a pan-actin D18C11 Rabbit mAb (1:1000, Cell Signaling Technology) diluted in 5% w/v BSA and 1X TBST (Bio-Rad), followed by an anti-rabbit IgG HRP-linked Ab (1:2000, Cell Signaling Technology) diluted in 5% w/v nonfat dry milk and 1x TBST (Bio-Rad), both for 1 h at room temperature. MyoD was detected using the same antibody as used for immunofluorescence. The biotinylated ladder was probed using an anti-biotin HRP-linked Ab (1:2000, Cell Signaling Technology) diluted in 5% w/v nonfat dry milk and 1X TBST (Bio-Rad) for 1 hour at 25C. The membrane was washed three times with TBST for 15 min between each antibody incubation.

Detection

HRP-conjugated secondary antibodies were visualized via chemiluminescence using SignalFire ECL Reagent (Cell Signaling Technology) and the ChemiDoc MP gel documentation system (Bio-Rad).

Results and discussion

CALM1 gene editing in mouse myoblasts

Given the importance of Ca2+ signaling in myogenesis and the central role of CaM in interpreting the Ca2+ signal, we hypothesized that the muscle regulatory protein CaM acts as a cellular redox sensor that blocks myogenesis in response to oxidative stress. To test this hypothesis, we used the CRISPR-Cas9 system coupled with a long single-stranded donor DNA [51, 52] to knock-in a biophysically and biochemically well-characterized [20, 38] single amino acid mutation that mimics the oxidative modification of a single Met to Met sulfoxide (M109Q, Fig 1A and 1B). This was done in one or both alleles of the CALM1 gene, one of three genes that encodes the muscle regulatory protein CaM in mouse C2C12 myoblasts. C2C12 myoblasts are a standard model for muscle myogenesis; the mononuclear myoblasts undergo myogenesis into multinucleated myotubes within days of mitogen withdrawal from the growth medium [53].

We tested the only three potential CRISPR cut sites within 50 bp of M109 for cutting efficiency and we found that one, corresponding to crRNA 5′ CGCCACGTCATGACAAACTT 3′ reliably cut with greater than 50% efficiency. There are no predicted off-target cut sites (< 3 mismatches) for this crRNA in the mouse genome. Myoblasts at a low passage number (< 3 passages) were transfected with gRNA-dDNA-Cas9 complexes. After 24 h, individual cells were isolated and grown to confluency. A restriction assay was used to screen for clonal isolates with mutations near the cut site. About 20% of the 200 clonal isolates screened contained cut site alterations and were sequenced. Of these, only three clonal isolates contained the desired mutations, which included the M109Q mutation and four silent mutations purposefully introduced near the cut site to prevent re-cutting, and no other mutations. The cell line 2A4 contained the desired mutations in both alleles, and the 3C2 and 3C3 cell lines contained the desired mutations in only one allele (Fig 1C). We did not pursue whole genome sequencing to confirm the absence of unwanted mutations because there were no predicted off-target cutting sites and the probability that three independent cell lines would contain both the desired mutation and the same off-target mutation would be < 0.01% given an optimistic cutting efficiency of 20%. All three cell lines produced identical phenotypes (described below), indicating that the mutation is dominantly expressed.

The calmodulin redox sensor halts myogenesis

We treated myoblasts with H2O2 concentrations over which CaM and other targets are expected to be significantly oxidized. When rat ventricular myocytes were exposed to 50 μM H2O2, there was a 50% reduction in free thiols and a 50% decrease in CaM binding to RyR, an effect attributed to oxidation of both RyR and CaM; pre-treating CaM with 50 μM H2O2 before perfusion into myocytes (without additional H2O2-treatment) produced a 20% decline in RyR binding [54]. We found that when the differentiation medium contained 100 μM H2O2, myogenin expression decreased from 22% to 13% and myotube formation decreased from 29% to 11% in wild type (WT) myoblasts on day 4 of differentiation relative to untreated cells (Fig 2A and 2B), consistent with previous studies using 25 μM H2O2 to treat C2C12 cells [13]. Myoblasts with the CALM1 M109Q mutation, either in one allele (2A4) or both alleles (32C or 3C3), could not form myotubes, nor did they express detectable myogenin or myosin heavy chain by day 4 of differentiation (Fig 2C). CALM1 M109Q myoblasts had normal fibroblast-like morphology, but proliferated at roughly twice the rate of WT cells in growth medium (GM) (Fig 2D). In differentiation medium (DM), WT cells ceased to proliferate; in contrast, CALM1 M109Q myoblasts proliferated at the same rate in DM as in GM (Fig 2D), indicating that the cell cycle inhibition that normally precedes myogenin expression and terminal differentiation did not occur for CALM1 M109Q myoblasts. We found that 25 μM H2O2 enhanced cell proliferation for intermediate time points, but as the H2O2 concentration approached 100 μM, cells stopped proliferating entirely (Fig 2E), consistent with observations that H2O2 can enhance proliferation at low concentrations, arrest growth at high concentrations, and elicit apoptosis at even higher concentrations [55].

Fig 2

CRISPR-edited myoblasts fail to exit the cell cycle or produce myotubes.

(A) Proliferating myoblasts are signaled to initiate differentiation by serum withdrawal, followed by myogenin expression, marking commitment to differentiation and permanent cell cycle exit. Muscle-specific proteins are expressed, and myoblasts fuse into multinucleated myotubes. (B) Wild type (WT) C2C12 cells on day 4 of differentiation with chronic exposure to H2O2 in the differentiation medium (DM). Percentage of nuclei expressing myogenin and the percentage of nuclei in multinucleated myotubes were calculated using Cell Profiler [49] (n = 4). Data are represented as the mean ± SD; **P < 0.01; ***P < 0.001. (C) WT and CRISPR-edited C2C12 cells lines 2A4, 3C2, and 3C3 containing the CALM1 M109Q mutation in one (3C2, 3C3) or both alleles (2A4) on day 4 of differentiation (n = 4). No myotubes were detected. (D) Proliferation assays for WT, 2A4, and 3C2 myoblasts in GM or DM (n = 2). (E) Proliferation assays for WT myoblasts in GM with H2O2 (n = 2). (F) Live cell imaging of WT and 2A4 myoblasts stained with MitoTracker Red or LysoTracker Deep Red and DAPI. (G) Percentage of nuclei expressing myogenin in WT and 2A4 myoblasts treated with dorsomophin or STO-609 at the indicated concentrations in the DM (n = 1). STO-609 was toxic to cells at 25 μM. Data are represented as the mean ± SD; *P < 0.1, **P < 0.01.

We investigated mitochondrial structure and lysosome distribution in CALM1 M109Q myoblasts with live-cell imaging using MitoTracker and LyosTracker to detect redox-regulated alterations to metabolism or autophagy, but didn’t observe any differences between WT and 2A4 cells (Fig 2F), even with glucose starvation (not shown). The AMPK nutrient-sensing pathway, which involves Ca2+ release and multiple CaM-dependent targets, negatively regulates myogenesis [56, 57], so we hypothesized that inhibitors of this pathway might recover myogenesis in CALM1-M109Q myoblasts. We found that although the AMPK inhibitor dorsomorphin and the CaMKKβ inhibitor STO-609 both boosted myogenesis in WT myoblasts, they failed to recover myogenesis in 2A4 cells (Fig 2G).

Immunofluorescence microscopy was used to detect and localize key myogenic regulatory factors in WT and CALM1 M109Q cells (2A4) undergoing myogenesis. Myosin heavy chain is a marker of phenotypic differentiation, and was expressed in multinucleated WT myotubes by day 2 of differentiation, but was never expressed in 2A4 cells, which failed to produce any multinucleated cells (Fig 3A). Myogenin, the transcription factor that drives phenotypic differentiation, was also present in the nuclei of WT myotubes by day 2 of differentiation, but was never detectable in 2A4 cells. MyoD is a transcription factor that drives exit from the cell cycle at early stages of differentiation, and induces myogenin expression at later stages of differentiation. MyoD was strongly localized to the nuclei of WT myoblasts on day 0 and its presence and nuclear localization persisted to day 3 in both myoblasts and myotubes. In 2A4 myoblasts, MyoD was present and strongly localized to the nuclei of myoblasts from days 0–4. Quantification of fluorescence intensity of MyoD in nuclei (Fig 3B) and western blotting (Fig 3C) indicated that MyoD protein disappeared from WT nuclei on day 4, consistent with its degradation by the 26S proteasome [58], while MyoD protein level was highest at day 4 in 2A4 nuclei. Despite high and persistent levels of MyoD in 2A4 cells, myogenin expression and phenotypic differentiation did not occur. The same regulatory signature was observed in a study using 25 μM H2O2 treatment to mimic oxidative stress during C2C12 cell differentiation, which caused a steep decline in myogenin expression, but no change in the expression of MyoD or other early transcription factors [13]. As with oxidative stress, the CALM1 M109Q mutation inhibited the later stages of myogenesis.

Fig 3

Expression and localization of myogenic regulatory factors in wild type and CRISPR-edited C2C12 myoblasts during myogenesis.

(A) Immunofluorescence to determine the localization of MyoD, p-p53, p21, myogenin, and MHC in differentiating myoblasts. (B) Average fluorescence intensity of MyoD within nuclei of WT and 2A4 cells on days 0 to 4 of differentiation (average of 10 cells per field, n = 2). Data are represented as the mean ± SD; ***P < 0.001. (C) Western blot of WT and 2A4 cell lysates on days 1 to 4 of differentiation (n = 1) to measure MyoD protein level. (D) Fold-change in gene expression measured by RT-qPCR for the indicated genes, calculated as the ratio of gene expression on day 4 to day 1 for WT and 2A4 cells (top panel) and as the ratio of WT to 2A4 cells on day 4 of differentiation (bottom panel) (n = 3). Data are represented as the mean ± SD.

We surmised that myogenin expression and MyoD activity might depend on exit from the cell cycle, so we examined the localization and expression of cell cycle inhibitors (Fig 3D). The cell cycle inhibitor p21 is transcriptionally regulated by phosphorylated p53 and MyoD, and drives terminal exit from the cell cycle prior to phenotypic differentiation. Phosphorylated p53 was present in nuclei of both WT and 2A4 myoblasts and myotubes on days 0–4 of differentiation. The cell cycle inhibitor p21 was present in the nuclei of WT myotubes, starting on day 2 and persisting through day 4, but was not detectable in the nuclei of 2A4 cells at any point.

Despite the presence of MyoD and phosphorylated p53 in 2A4 myoblasts, p21 was not expressed, which is consistent with the observation that 2A4 cells continued to proliferate in differentiation medium depleted of mitogens. We hypothesized that MyoD, although present in the nucleus of 2A4 cells, is in state that prevents it from transcriptionally activating p21 and myogenin. To test this hypothesis, we examined the RNA levels of MyoD, p21, myogenin, and two negative regulators of myogenesis, Id2 and Id3 (inhibitors of differentiation 2 and 3). Id proteins antagonize basic helix-loop-helix (bHLH) transcription factors such as MyoD, and sequester them in an inactive conformation [59]. The Id genes are under the control of the transcription factor Egr-1, which is negatively regulated by the CaM-calcineurin complex during myogenesis [60, 61]. Indeed, we found that by day 4 of differentiation, WT myoblasts upregulated myogenin by 4-fold, p21 by 14-fold, and Rb by 7-fold; 2A4 myoblasts failed to upregulate myogenin, p21, or Rb (Fig 3D). MyoD expression level was only slightly upregulated with differentiation for both WT and 2A4 myoblasts, which contrasts immunofluorescence results (Fig 3), which indicates that MyoD protein disappears from WT myotubes on day 4, suggesting that MyoD protein is degraded by day 4 of differentiation in WT myotubes, but not in 2A4 myoblasts. As expected, the Id genes were both downregulated (2-fold) in WT myoblasts undergoing differentiation, which would relieve myogenesis suppression. In 2A4 myoblasts, however, the Id genes were upregulated 2-fold, which may indicate that the Id proteins remained available to antagonize MyoD, halting the differentiation program.

CALM1 M109Q results in a dominant negative expression pattern

In humans, identical CaM proteins are encoded by three genes including CALM1, CALM2, and CALM3, located at distinct loci on three different chromosomes [62]. CaM is remarkably conserved among vertebrates, and there are very few evolutionarily tolerated mutations [63]. The three CaM genes are not redundant in the sense that they ensure fine-tuning of CaM expression according to cell type; even slight dysregulation leads to aberrant physiology [62].

We found that the M109Q mutation in one or both alleles of CALM1 leads to complete inhibition of myogenesis. How this dominant negative pattern of expression arises is puzzling, but is characteristic of CaM mutations. From 2012 to 2018, twenty-six pathogenic CaM mutations were described in the literature [63]; all CaM mutations with known pathology cause severe cardiac dysfunction, nearly all occur within Ca2+ coordination sites in the C-terminal lobe, and all result in a dominant phenotype even though only 1/6 of the CaM pool contains the mutation [24]. As with the M109Q mutation, most of these mutations impact RyR activation and inhibition [64], leading to dysregulated Ca2+ handling. No CaM mutations have been linked to pathological consequences apart from cardiac manifestations; with large-scale human genome sequencing on the horizon [65], it will be possible to discern broader consequences of human CaM mutations.

RyR mutations, too, give rise to cardiac dysfunction with a dominant phenotype. Because the RyR complex assembles as a tetramer, a single RyR mutation will result in nearly every complex containing at least one mutated RyR monomer, which destabilizes the entire complex, resulting in Ca2+ leakage and ultimately, arrythmia [24]. A similar argument could be made for CaM: since many CaM targets (such as RyR) are multimers, a single mutant CaM could conceivably destabilize an entire multimeric complex. For example, CaMKII is a dodecameric complex that binds CaCaM in a highly cooperative manner, leading to sustained CaMKII activation through autophosphorylation; the cooperativity of CaCaM binding fine-tunes the frequency-dependent response of CaMKII activity to cellular Ca2+ oscillations [66, 67]. In a dodecameric complex, if 1/6 of the CaM pool were mutated, on average, each dodecameric CaMKII complex would associate with two mutant CaMs, which could strongly alter cooperativity. We hypothesize that the CALM1 M109Q mutation produces a dominant phenotype because of its association with multimeric complexes.

Direct in-cell measurements of RyR and CaMKII activity are not yet experimentally accessible, so right now we are not able to directly measure the impact of CALM1-M109Q on cellular RyR and CaMKII activation. Biochemical assays of RyR function in SR vesicles based on [3H]ryanodine binding indicate that CaM-M109Q cannot activate the RyR at low Ca2+ and oxidized CaM cannot activate purified CaMKII at high Ca2+ [32, 64]. Of course, it is imperative to understand RyR and CaMKII activation by CaM within the context of a muscle cell. The development of in-cell biochemical and biophysical measurements is therefore a priority, and progress has already been made in developing FRET-based assays for CaMKII within cells and RyR within SR vesicles [68, 69].

Redox sensitive CaM pathways

Ca2+ is a crucial component of the muscle differentiation medium [46], and Ca2+ signaling pathways are now implicated at every step of myogenesis [47]. Downstream effectors of Ca2+ are numerous, but CaCaM, CaCaM-dependent kinases, and CaCaM-calcineurin complexes play key roles in facilitating myogenesis [48]. Many of the kinases, phosphatases, pumps, channels, and regulatory proteins within these pathways have biochemically well-characterized redox sensitivities [54, 70–72], but nobody has reported the cellular impact of oxidizing a specific protein residue within one of these pathways until now. By using (1) a biochemically well-characterized mutation for mimicking methionine oxidation (Met to Gln), and (2) the CRISPR-Cas9 system to introduce point mutations directly into the genome, we were able to find that CaM acts as a potent cellular redox sensor that regulates myogenesis (Fig 4). We don’t yet understand the precise mechanism through which CaM exerts its regulatory role, but we hypothesize that CaM’s role as a redox sensor is coupled to its regulatory roles in the CaMKII and calcineurin pathways.

Fig 4

CaM acts as a potent cellular redox sensor that regulates myogenesis.

The CALM1 M109Q mutation, which mimics methionine oxidation at M109, blocks myogenesis before myoblasts exit from the cell cycle and commit to differentiation.

Calcineurin contributes critically to the activity of the transcription factors MEF2, MyoD, and NFAT, which together drive transcription of myogenin [48, 60]. Calcineurin activates MEF2 via dephosphorylation in a signalosome complex localized to the nuclear envelope [73] and activates MyoD by decreasing the expression of the myogenic inhibitory factors Id1 and Id3 via transcriptional inactivation of Egr-1 [60, 61]. Here, we found that the Id genes are both downregulated 2-fold in WT myoblasts undergoing differentiation, but not in CALM1 M109Q myoblasts, indicating that suppression of calcineurin activity might contribute to the myogenesis defect in mutant myoblasts. It isn’t known whether CaM M109Q can bind or activate calcineurin, but biophysical data suggests that CaM M109Q doesn’t populate the “active” Ca2+-bound structure that activates most target proteins [38].

CaM-dependent kinase II (CaMKII) activity is required for the release of MEF2 from class II histone deacetylases, which bind MEF2 in an inactive complex [74]. Phosphorylation of the HDAC4/HDAC5 heterodimer by CaMKII directs their nuclear export [75], releasing MEF2, and relieving transcriptional repression of myogenin. An HDAC5 mutant lacking CaMK phosphorylation sites is resistant to CaMK-mediated nuclear export and acts as a dominant inhibitor of myogenesis [74]. It is conceivable that CaM M109Q blocks the multimeric CaMKII complex from facilitating HDAC4/HDAC5 nuclear export, which would prevent MEF2 from activating myogenin expression and result in dominant inhibition of myogenesis.

Since CaM is a regulatory node in multiple Ca2+ sensitive pathways, it is possible that the CALM1 M109Q mutation exerts a strong influence along multiple coordinated paths, ultimately blocking myogenesis. CaM Met oxidation is reversible by the Met sulfoxide reductase enzymes [76] so that when the cellular redox environment is restored to normal, the inhibitory effect of CaM Met oxidation is relieved. With chronic oxidative stress, as occurs with age-related degenerative disease, CaM’s regulatory influence is likely to contribute to blunted muscle regeneration, weakness, and morbidity. We have shown for the first time that a single oxidative modification to a redox-sensitive muscle regulatory protein can halt myogenesis, suggesting a molecular target for mitigating the impact of oxidative stress in age-related muscle degeneration.

Limitations of the study

C2C12 myoblasts are a suitable model system for exploring early hypotheses relating site-specific muscle protein oxidation and muscle function, but they can’t entirely recapitulate the function of muscle satellite cells. While a mouse model would clarify the impact of muscle protein oxidation on muscle aging, freshly isolated muscle satellite cells or human induced pluripotent stem cells (iPSCs) could be edited and re-grafted onto human muscle to more directly understand the impact of muscle protein oxidation (or blocking oxidation) on human muscle physiology [77]. Indeed, the current work establishes the rational for using gene-editing to create better models of age-related degenerative disease and for using gene-editing to alleviate these conditions.

Western blots for Fig 3C.

(PDF)

Click here for additional data file.

Differentiation assays.

Percentage of nuclei expressing myogenin and percentage of nuclei in myotubes for wild type (WT) and CALM1 M109Q (2A4, 3C2, and 3C3) C2C12 cells treated with hydrogen peroxide treatment and various metabolic inhibitors.

(XLSX)

Click here for additional data file.

Cell proliferation assays.

Cell proliferation measured by the MTS assay for wild type (WT) and CALM1 M109Q (2A4 and 3C2) C2C12 cells in growth or differentiation medium and with hydrogen peroxide treatment.

(XLSX)

Click here for additional data file.

Immunofluorescence images.

Representative immunofluorescence images acquired for various myogenic factors and muscle proteins on days 0–4 of differentiation for wild type (WT) and CALM1 M109Q (2A4) C2C12 cells.

(PDF)

Click here for additional data file.

MyoD fluorescence intensity.

Intensity of nuclear MyoD fluorescence in wild type (WT) and CALM1 M109Q (2A4) C2C12 cells on days 0–4 of differentiation.

(XLSX)

Click here for additional data file.

Quantitative PCR.

Cq values for various myogenic factors and muscle proteins in wild type (WT) and CALM1 M109Q (2A4) cells on day 0 and day 4 of differentiation.

(XLSX)

Click here for additional data file.

18 Feb 2020

PONE-D-20-00434

The calmodulin redox sensor controls myogenesis

PLOS ONE

Dear Dr. Klein,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Apr 03 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Atsushi Asakura, Ph.D

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The study aimed to address the question of the role of a redox-sensitive CAM1 in aging muscle. The CRISPR-Cas9 method was used to generate a CAM1-M109Q mutant that mimicked the oxidative modification of one of 9 methonines in one or both alleles of the three expressed CaM genes in C2C12 mouse myoblast. A potentially important conclusion was that the modification of a single methione was sufficient to halt myogenesis in aging muscle.

Using a skeletal muscle mouse line, the authors investigated the functional effects of a CAM mutant that mimics the oxidation of a methionine to methionine sulfoxide. By using immunofluorescence, cell proliferation and RT-PCR assays, they then showed that the mutant inhibited the expression of late myogenic factors in C2C12 cells. Overall, the cellular studies seem to have been well done, however, they are limited in scope. The study is largely correlative and is limited to one of the multiple mechanisms under the cellular control of CaM. As stated by the authors, methionine oxidation impairs the regulation of numerous target proteins. CaM mutants including the CaM-M109Q have been shown to disrupt the function of the ryanodine receptor and it is surprising that this was not addressed. Performing these experiments is strongly recommended.

Second, a potential experimental limitation of CRISPR-Cas9 method is that secondary unwanted mutations are introduced, leading to the observed disruptive events. I miss a clear description of why this did not occur in the present study.

Fig. 1B, show also the structure of CaM-M109Q

Fig. 2 C and D and Fig. 3B , number of independent experiments should be shown.

Fig. 2D in text?

Reviewer #2: Manuscript Number: PONE-D-20-00434

“The calmodulin redox sensor controls myogenesis” by Klein J. et al.

Skeletal muscle regeneration is largely dependent on resident muscle stem cells that are quickly activated and differentiated in response to muscle injury. However, the capacity of skeletal muscle to regenerate declines with aging. Oxidative stress is one of the central mechanisms for the blunted muscle regeneration with aging. In this manuscript, the authors focus on one of muscle redox sensors, calmodulin in C2C12 mouse myoblasts. The authors use the CRISPR-Cas9 system to induce a single amino acid substitution of calmodulin that mimics oxidation of methionine in calmodulin. Mutated calmodulin in C2C12 myoblasts negatively affects the myogenic differentiation with low late myogenic markers such as myogenin and myosin heavy chain. This is an interesting concept that describes the single amino acid substitution of calmodulin inhibits the differentiation of C2C12 myoblasts. However, there are some major considerations that should be addressed.

Essential revisions:

1. The authors describe that 2A4 line contains the mutation on both alleles, on the other hand, 3C2 and 3C3 lines contain the desired mutation in only one allele. In the manuscript, the authors have concluded that all three lines are identical phenotypes. However, data about all three line is only Figure 2C (IF for myogenin). The authors should include at least one of cell lines with one allele mutation (3C2 or 3C3) in revised version of Figure 2D and Figure 3A, B.

2. Is there any evidence that mutated calmodulin in C2C12 myoblasts cannot fully function? The authors should show the data about the point, for example, the activation of CaMKII between WT vs mutant myoblasts, etc.

3. According to Figure 3A, it seems that MyoD signals in 2A4 cells are much stronger than those in WT at day 4, which make sense to me if the mutant myoblasts fail to withdraw from the cell cycle and keep proliferating (Figure 2D). However, mRNA expression of MyoD in 2A4 cells is lower than WT in Figure 3B. The contradictory result should be clarified by performing western blot (WB) analysis. In addition to this, results of Figure 3A (differentiation defect with low late myogenic factors) would be strengthened by WB, at least for Myogenin and MyHC.

4. I’m not in favor of reporting q-PCR in Figure 3B by normalizing to the day 0 condition. It is better to compare the expression of each gene between WT vs 2A4 at day 4. I recommend that the authors include either 3C2 or 3C3 lines containing the one allele mutation in the revised figure as I mentioned above.

5. H2O2 treatment inhibits the myogenic differentiation according to Figure 2B, does this condition induce the oxidation of methionine in calmodulin? The author should clarify this point.

6. The mutated myoblasts proliferate faster than WT myoblast in both GM and DM conditions as shown in Figure 2D. Does H2O2 treatment also increase the proliferation of C2C12 myoblasts?

7. Which results support the Figure 4A and 4B? I think none of these data described in this manuscript support Figure 4A and 4B. The data described in this paper could only lead a conclusion that the single amino acid mutation in muscle redox sensor calmodulin fails to withdraw the cell cycle and directly/indirectly suppresses the late myogenic factors such as myogenin. If the authors want to support the conclusion as shown in Figure 4A-B, the authors should perform to investigate the transcriptional activity of these genes by luciferase assay in the proper condition. I recommend that the authors delete and replace it with another graphical summary which explains what you found in this study.

Minor points:

8. Page 11, “The calmodulin redox sensor halts myogenesis”, the authors should check the numerical order of Figure 2. There are a lot of mislabeling.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

15 Aug 2020

August 7, 2020

Dear Editor,

The reviewer comments were extremely helpful in creating a manuscript that more clearly describes our results and more carefully contextualizes them. We apologize for the delay as our research lab has been closed since the second week of March due to COVID and has not yet reopened, nor have any students returned to campus. Our response to each reviewer comment is below. The reviewer comment/question is followed by our response and a description of changes we made to the manuscript. Because of some significant additions to our figures, we have had to make additions to the methods section. All changes within the actual manuscript have been highlighted in yellow and changes have been tracked.

Reviewer #1:

• The study is largely correlative and is limited to one of the multiple mechanisms under the cellular control of CaM. As stated by the authors, methionine oxidation impairs the regulation of numerous target proteins.

Since oxidized CaM has been recovered from aged tissue, our earliest investigations were focused on cell mechanisms known to be altered by aging. We added these results as Figure 2F that includes an investigation of whether the CALM1-M109Q mutation alters mitochondrial structure or lysosome distribution and dynamics, both of which are redox regulated cell processes involving CaM. We didn’t observe any impact due to CALM1-M109Q. In addition to Figure 2F, we added the following text to a new (second) paragraph of the results section entitled The calmodulin redox sensor halts myogenesis:

We investigated mitochondrial structure and lysosome distribution in CALM1 M109Q myoblasts with live-cell imaging using MitoTracker and LyosTracker to detect redox-regulated alterations to metabolism or autophagy, but didn’t observe any differences between WT and 2A4 cells (Fig. 2F), even with glucose starvation (not shown).

Early on, we hypothesized that the myogenesis defect was due to over-activation of the AMPK nutrient-sensing pathway, which involves multiple CaM-dependent targets and Ca2+ release from the RyR, a pathway that is dysregulated with aging. We attempted to rescue the myogenesis defect using inhibitors and activators of the AMPK pathway including dorsomorphin (AMPK inhibitor), STO-609 (CaMKK inhibitor), and EX-528 (Sirt1 inhibitor), but none of these interventions recovered myogenesis. In addition to Figure 2G, we added the following text to a new (second) paragraph of the results section entitled The calmodulin redox sensor halts myogenesis:

The AMPK nutrient-sensing pathway, which involves Ca2+ release and multiple CaM-dependent targets, negatively regulates myogenesis (Fulco et al., 2008; Williamson et al., 2009), so we hypothesized that inhibitors of this pathway might recover myogenesis in CALM1-M109Q myoblasts. We found that although the AMPK inhibitor dorsomorphin and the CaMKKβ inhibitor STO-609 both boosted myogenesis in WT myoblasts, they failed to recover myogenesis in 2A4 cells (Fig. 2G).

We embarked on this study with an interest in characterizing Ca2+ dynamics in myotubes, as the Ca2+ transient is the complex result of the coordination of the pumps, channels, and kinases that CaM regulates. Regrettably, the CaM-M109Q mutation prevented the formation of myotubes. Myoblasts don’t produce Ca2+ transients because they don’t express the machinery for it. Therefore, a future study will include measuring the impact of CaM-M109Q on Ca2+ dynamics in myotubes, perhaps using a regulated promoter so that CaM-M109Q expression can be turned on after myogenesis.

• CaM mutants including the CaM-M109Q have been shown to disrupt the function of the ryanodine receptor and it is surprising that this was not addressed. Performing these experiments is strongly recommended.

We’ve clarified the state of in-cell protein function assays for CaM-dependent channels and proteins so that it is clear what has been done already and what is not yet possible in a new, fourth paragraph in the section entitled “CALM1 M109Q results in a dominant negative expression pattern:”

Direct in-cell measurements of RyR and CaMKII activity are not yet experimentally accessible, so right now we are not able to directly measure the impact of CALM1-M109Q on cellular RyR and CaMKII activation. Biochemical assays of RyR function in SR vesicles based on 3H ryanodine binding indicate that CaM-M109Q cannot activate the RyR at low Ca2+ and oxidized CaM cannot activate purified CaMKII at high Ca2+ (Balog et al., 2003; Robison et al., 2007). Of course, it is imperative to understand RyR and CaMKII activation by CaM within the context of a muscle cell. The development of in-cell biochemical and biophysical measurements is therefore a priority, and progress has already been made in developing FRET-based assays for CaMKII within cells and RyR within SR vesicles (Ardestani et al., 2019; Rebbeck et al., 2017).

Collaborators are working to develop FRET-based assays for both RyR and CaMKII using a new, high-throughput transient time-resolved fluorescence instrument that we hope to apply to this project very soon. The ability to make these in-cell functional measurements has been directly coupled to recent innovations in fluorescence detection.

• Second, a potential experimental limitation of CRISPR-Cas9 method is that secondary unwanted mutations are introduced, leading to the observed disruptive events. I miss a clear description of why this did not occur in the present study.

We clarified our reasoning for not pursuing whole genome sequencing by adding the following to the second paragraph of the section entitled CALM1 gene editing in mouse myoblasts:

We did not pursue whole genome sequencing to confirm the absence of unwanted mutations because there were no predicted off-target cutting sites in the mouse genome and the probability that three independent cell lines would contain both the desired mutation and the same off-target mutation would be < 0.01% given an optimistic cutting efficiency of 20%.

Also, whole genome sequencing easily misses large-scale chromosomal deletions, insertions, and rearrangements that could occur near the on-target region, but these alterations would have resulted in the loss of a primer binding site or would produce an amplicon too large to be amplified, so our amplicon-based selection procedure would have selected against cells with these alterations.

• Fig. 1B, show also the structure of CaM-M109Q

Unfortunately, there are no crystal structures for CaM-M109Q. Other biophysical methods such as circular dichroism suggest that CaM secondary and tertiary structure do not change as a result of the M109Q mutation. We published a computational study that indicated that the M109Q mutation doesn’t grossly alter CaM structure, but does strongly alter the conformational transition and equilibrium between CaM’s open and closed states. We’ve clarified this point in the second paragraph of the introduction to now read as follows:

Our group has delineated the molecular structural mechanism by which oxidation of CaM’s C-terminal Met (M109 and M124, see Fig. 1B) trigger changes in CaM conformational dynamics without changing the secondary or tertiary structure of CaM (McCarthy et al., 2015; Walgenbach et al., 2018).

• Fig. 2C and D and Fig. 3B , number of independent experiments should be shown.

The number of independent experiments is now described in the legend for Figure 2 and Figure 3 as follows: Fig. 2B, n=4; Fig. 2C, n=4, Fig. 2D, n=2; and Fig. 3B, n=3.

• Fig. 2D in text?

References to figures in the text were corrected.

Reviewer #2

Essential revisions:

• The authors describe that 2A4 line contains the mutation on both alleles, on the other hand, 3C2 and 3C3 lines contain the desired mutation in only one allele. In the manuscript, the authors have concluded that all three lines are identical phenotypes. However, data about all three line is only Figure 2C (IF for myogenin). The authors should include at least one of cell lines with one allele mutation (3C2 or 3C3) in revised version of Figure 2D and Figure 3A, B.

We have now included data for cell line 3C2 in Fig. 2D. With the continued closure of my research lab due to COVID, we are not able to acquire new data for Fig. 3.

• Is there any evidence that mutated calmodulin in C2C12 myoblasts cannot fully function? The authors should show the data about the point, for example, the activation of CaMKII between WT vs mutant myoblasts, etc.

We added panels Fig. 2F and Fig. 2G that include investigations of whether the CALM1-M109Q mutation alters mitochondrial structure or lysosome distribution, and whether the myogenesis defect could be rescued by inhibiting the AMPK pathway, as described above.

• According to Figure 3A, it seems that MyoD signals in 2A4 cells are much stronger than those in WT at day 4, which make sense to me if the mutant myoblasts fail to withdraw from the cell cycle and keep proliferating (Figure 2D). However, mRNA expression of MyoD in 2A4 cells is lower than WT in Figure 3B. The contradictory result should be clarified by performing western blot (WB) analysis. In addition to this, results of Figure 3A (differentiation defect with low late myogenic factors) would be strengthened by WB, at least for Myogenin and MyHC.

We have now included western blots for MyoD in what is now Fig. 3C. We also quantified the fluorescence intensity due to MyoD in nuclei in Fig. 3B. Indeed, we did find that MyoD protein levels are higher in 2A4 cells than WT cells on day 4 of differentiation.

We added the following text to the results section entitled The calmodulin redox sensor halts myogenesis:

Paragraph three:

Quantification of fluorescence intensity of MyoD in nuclei (Fig. 3B) and western blotting (Fig. 3C) indicated that MyoD protein disappeared from WT nuclei on day 4, consistent with its degradation by the 26S proteasome (Abu Hatoum et al., 1998), while MyoD protein increased by day 4 in 2A4 nuclei.

Paragraph five:

MyoD expression level was unchanged with differentiation for both WT and 2A4 myoblasts, which contrasts immunofluorescence results that indicate MyoD protein is degraded by day 4 of differentiation in WT myotubes, but not in 2A4 myoblasts.

• I’m not in favor of reporting q-PCR in Figure 3B by normalizing to the day 0 condition. It is better to compare the expression of each gene between WT vs 2A4 at day 4. I recommend that the authors include either 3C2 or 3C3 lines containing the one allele mutation in the revised figure as I mentioned above.

Fig. 3B is now Fig. 3D and has been changed so that the fold change between WT and 2A4 at day 4 is presented, in addition to the original presentation, as we found both to be helpful.

• H2O2 treatment inhibits the myogenic differentiation according to Figure 2B, does this condition induce the oxidation of methionine in calmodulin? The author should clarify this point.

We have not quantified the extent of calmodulin methionine oxidation with H2O2 treatment as this requires sophisticated mass spectrometry techniques inaccessible to us. However, collaborators have estimated the extent of CaM and RyR oxidation by H2O2 and the resulting functional decline in myocytes, so we’ve included this information in the results section entitled The calmodulin redox sensor halts myogenesis:

We treated myoblasts with H2O2 concentrations over which CaM and other targets are expected to be significantly oxidized. When rat ventricular myocytes were exposed to 50 µM H2O2, there was a 50% reduction in free thiols on RyR and a 50% decrease in CaM binding to RyR, an effect attributed to oxidation of both RyR and CaM; pre-treating CaM with 50 µM H2O2 before perfusion into myocytes (without additional H2O2-treatment) produced a 20% decline in RyR binding (Oda et al., 2015).

• The mutated myoblasts proliferate faster than WT myoblast in both GM and DM conditions as shown in Figure 2D. Does H2O2 treatment also increase the proliferation of C2C12 myoblasts?

We have included panel Fig. 2E that includes cell proliferation data for WT H2O2-treated C2C12 cells and have included a response to the reviewer question in the first paragraph of the results section entitled The calmodulin redox sensor halts myogenesis:

We found that 25 �M H2O2 enhanced cell proliferation for intermediate time points, but as the H2O2 concentration approached 100 µM, cells stopped proliferating entirely (Fig. 2E). It has been observed that H2O2 can enhance proliferation at low concentrations, arrest growth at high concentrations, and elicit apoptosis at even higher concentrations (Giorgio et al., 2007).

• Which results support the Figure 4A and 4B? I think none of these data described in this manuscript support Figure 4A and 4B. The data described in this paper could only lead a conclusion that the single amino acid mutation in muscle redox sensor calmodulin fails to withdraw the cell cycle and directly/indirectly suppresses the late myogenic factors such as myogenin. If the authors want to support the conclusion as shown in Figure 4A-B, the authors should perform to investigate the transcriptional activity of these genes by luciferase assay in the proper condition. I recommend that the authors delete and replace it with another graphical summary which explains what you found in this study.

We have replaced Figure 4A and 4B with a graphical summary that doesn’t overstate our conclusion.

• Minor points:

8. Page 11, “The calmodulin redox sensor halts myogenesis”, the authors should check the numerical order of Figure 2. There are a lot of mislabeling.

References to figures in the text have been corrected.

Thank you for your consideration of this much improved manuscript.

Sincerely,

Jennifer Klein

31 Aug 2020

The calmodulin redox sensor controls myogenesis

PONE-D-20-00434R1

Dear Dr. Klein,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Atsushi Asakura, Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: There are no comments for the authors. There are no comments for the auithors. There are no comments for the authors.

how many characters are needed?

Reviewer #2: I have read with interest the revised version of the manuscript, which has been improved by the additional requested evidence. I therefore recommend publication on PLOS ONE.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

8 Sep 2020

PONE-D-20-00434R1

The calmodulin redox sensor controls myogenesis

Dear Dr. Klein:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Atsushi Asakura

Academic Editor

PLOS ONE