Li Ma1, Junyan Wu1,2, Weiliang Qi1,2, Jeffrey A Coulter3, Yan Fang1, Xuecai Li2, Lijun Liu1, Jiaojiao Jin1,2, Zaoxia Niu1,2, Jinli Yue1,2, Wancang Sun1,2. 1. Gansu Provincial Key Laboratory of Aridland Crop Science, Gansu Agricultural University, Lanzhou, China. 2. College of Agronomy, Gansu Agricultural University, Lanzhou, China. 3. Department of Agronomy and Plant Genetics, University of Minnesota, St. Paul, MN, United States of America.
Abstract
Winter rapeseed (Brassica rapa L.) is the main oilseed crop in northern China and can safely overwinter at 35 (i.e., Tianshui, China) to 48 degrees north latitude (i.e., Altai, Heilongjiang, Raohe, and Xinjiang, China). In order to identify stable reference genes to understand the molecular mechanisms of stress tolerance in winter rapeseed, internal reference genes of winter rapeseed under four abiotic stresses were analyzed using GeNorm, NormFinder, BestKeeper, and RefFinder software. The most stable combinations of internal reference genes were β-actin and SAND in cold-stressed leaves, β-actin and EF1a in cold-stressed roots, F-box and SAND in high temperature-stressed leaves, and PP2A and RPL in high temperature-stressed roots, SAND and PP2A in NaCl-stressed leaves, RPL and UBC in NaCl-stressed roots, RPL and PP2A in PEG-stressed leaves, and PP2A and RPL in PEG-stressed roots. Expression profiles of PXG3 were used to verify these results. The stable reference genes identified in this study are useful tools for identifying stress-responsive genes to understand the molecular mechanisms of stress tolerance in winter rapeseed.
Winter rapeseed (Brassica rapa L.) is the main oilseed crop in northern China and can safely overwinter at 35 (i.e., Tianshui, China) to 48 degrees north latitude (i.e., Altai, Heilongjiang, Raohe, and Xinjiang, China). In order to identify stable reference genes to understand the molecular mechanisms of stress tolerance in winter rapeseed, internal reference genes of winter rapeseed under four abiotic stresses were analyzed using GeNorm, NormFinder, BestKeeper, and RefFinder software. The most stable combinations of internal reference genes were β-actin and SAND in cold-stressed leaves, β-actin and EF1a in cold-stressed roots, F-box and SAND in high temperature-stressed leaves, and PP2A and RPL in high temperature-stressed roots, SAND and PP2A in NaCl-stressed leaves, RPL and UBC in NaCl-stressed roots, RPL and PP2A in PEG-stressed leaves, and PP2A and RPL in PEG-stressed roots. Expression profiles of PXG3 were used to verify these results. The stable reference genes identified in this study are useful tools for identifying stress-responsive genes to understand the molecular mechanisms of stress tolerance in winter rapeseed.
Abiotic stresses such as cold, heat, salt, and drought limit plant growth and yield. Plants have developed a variety of mechanisms to respond to the damage caused by these stresses, including complex series of transcriptions and regulation [1]. Real-time quantitative polymerase chain reaction (RT-qPCR) analysis is the most fundamental method for studying gene transcription and regulation, and it is extremely sensitive, specific, reproducible, and cost-effective [2]. However, there are often errors in application of RT-qPCR and interpretation of the results. One of the most common mistakes is inappropriate selection of reference genes for normalizing expression of the target gene [3, 4]. Ideally, reference genes are expressed at constant levels to represent the concentration of cDNA in a sample. However, their expression is usually altered by the effects of experimental treatment, tissue sites, and nucleic acid quality [5]. There are several commonly used reference genes in the literature, but the results often indicate that these used should be selected based on the species and experimental design [2, 6, 7]. In recent years, ICG (http://icg.big.ac.cn) has integrated more than 750 internal reference genetic studies (including 73 species of animals, 115 species of plants, 12 species of fungi, and 9 species of bacteria) to identify reference genes corresponding to specific experimental conditions [8]. Scientists have developed several methods for systematic verification of reference genes, such as NormFinder, Best-keeper, GeNorm, and RefFinder software, which integrate information on the expression of internal reference genes and measure their relative stability by sequencing [9-12]. The best method currently considered to follow the MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) guidelines, using multiple internal reference genes, because the use of a single internal reference gene is considered inappropriate [13].Internal reference gene screening has been conducted in different parts and tissues of multiple plant species subjected to a variety of stresses, including Poa pratensis L. [6], Solanum tuberosum L. [7], Cynodon dactylon L. [12], Triticum Aestivum L. [14], Lactuca sativa Linn. [15], and Populus euphratica [16]. In chicory (Cichorium intybus L.), Delporte demonstrated that TIP41 (TIP41-like protein) was the most stable reference gene in cell cultures under various conditions, and these genes were validated in parallel on their seedlings, and result shown that the best reference gene is Clath (Clathrin adapator complex subunit) [17]. Wang et al. analyzed nine candidate reference genes in leaves of Brassica napus L. and found TIP41 and PP2A to performed best and were applicable under various conditions [18]. However, Brassica napus and winter rapeseed have different ploidy, and their adaptability to environment and planting areas are obviously different, especially in China [19-21].In China, winter rapeseed (Brassica rapa L.) is mainly produced in northern latitudes with harsh growing conditions and frequently experiences abiotic stresses such as cold, heat, drought, and salt [22-24]. This study screened and validated 10 internal reference genes of winter rapeseed under abiotic stresses to more accurately and extensively use RT-qPCR for gene analysis to understand the molecular mechanisms of abiotic stress tolerance in rapeseed.
Methods
Plant material and experimental treatment
In this study, winter rapeseed Longyou-7 (Brassica rapa L.) varieties widely cultivated in northern China were used. Plants were grown in a greenhouse at Gansu Agriculture University in Gansu Province (Lanzhou), China. During March to May 2018, 100 seeds were surface-sterilized in 10% H2O2 (hydrogen peroxide) for 30 min, soaked in distilled water for 10 min, and washed 3 times to remove H2O2. Seeds were germinated on two layers of wet filter paper in a glass petri dish and placed in a plant incubator (22°C with 16 h light/8 h dark cycle) for 2 days. Vigorous plants of the same growth stage were selected and transplanted into plastic seedling pots (mouth diameter × bottom inner diameter × height = 10 × 6 × 7 cm) containing 260 g of a 3:1 (volume:volume) ratio of matrix:vermiculite. One plant was grown in each pot and 200 ml of distilled water was added at the time of transplanting, with the same amount of distilled water added every 2 days. When the seedlings reached the one-leaf stage, 200 mL of 1/2 Hoagland nutrient solution and 200 mL of distilled water were added to each pot every 3 d. Plants were grown under normal conditions (22°C, 16 h light/8 h dark cycle) until the six-leaf stage, when plants of uniform size were selected and divided into four groups for application of four abiotic stresses. The drought stress treatments were imposed by adding 200 mL of a nutrient solution containing 18% PEG 6000 to pots [25], the saltstress treatments were imposed by adding 200 mL of a nutrient solution containing 180 mM NaCl to pots [26]. The cold and heat stress treatments were applied in an incubator set at 4 and 40° C, respectively. Leaves and roots were harvested from all treatments following 0 (CK), 1, 3, 6, 12, 24 and 48 h of stress for all stress treatments, and immediately frozen in liquid nitrogen and stored at -80°C for further analysis. Three separate pots were used as replicates for each stress treatment type and duration.
Total RNA isolation, cDNA synthesis and qPCR
Total RNA was isolated from leaves and roots using the Plant Total RNA Extraction Kit (TaKaRa Biotechnology Co., Ltd., Dalian, China) according to the kit instructions. RNA concentration and mass were evaluated by detection of the A260/A280 and A260/A230 ratios, respectively, using a spectrophotometer (NanoVueTM plus, Wilmington, DE, USA). Genomic DNA contamination removal and first strand cDNA synthesis were performed using the PrimeScriptTM RT kit with gDNA Eraser (TaKaRa Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's instructions. According to the standard that 10 μl reaction system can use up to 500 ng of total RNA, the RNA volume is calculated to ensure that all the added RNA is reverse transcribed into cDNA. Finally, we will dilute the cDNA concentration of all samples to 50 ng/μl according to the method described. The qPCR reaction conditions were as follows: 30 s at 95°C, followed by 40 cycles of 5 s at 95°C and 30 s at 60°C, followed by 65–95°C melting curve detection. The negative reverse transcriptase reaction (no reverse transcriptase) was carried out after DNA contamination was removed by gDNA eraser. The CT value obtained by fluorescence quantitative PCR was compared with that of the negative control.
Candidate reference gene selection and primer design
Ten candidate reference genes (ACT7, GADPH, TIP41, F-box, UBC, SAND, RPL, β-TUB, EF1α, PP2A) have been reported in top 10 internal control genes ranked in ICG (http://icg.big.ac.cn/index.php/ICG:Statistics) and published papers for various plant species [18, 27, 28] and were considered to be potential candidate genes for this study. The coding sequence design of the candidate reference genes was designed using Primer Premier 5.0 (Premier, Canada) software according to the following parameters: melting temperature (Tm) of 58–62°C, ideal Tm of 60°C, GC content of 45–55%, ideal content of 50%; length of 17–24 bp, and amplicon length of 70–250 bp. Primer-specific assays using RT-PCR and pre-qPCR experiment with cDNA of CK, the product with a single expected size DNA band and a single peak in the RT-qPCR dissolution curve (Fig 1). The cDNA of CK was diluted five times in a 10-fold gradient and the slope of the standard curve was calculated after RT-qPCR using the LightCycle 96 (Roche, Basel, Switzerland) system. The amplification efficiency (E) of each reference gene was based on E (%) = [10(-1/slope)-1]×100 calculation [13, 29, 30]. Descriptions of candidate reference genes and primer sequences are shown in Table 1 and S1 Fig, and amplification efficiency was ≥96.3%.
Fig 1
Primer specificity and amplicon size.
Agarose gel (1.5%) electrophoresis indicated the amplification of a single PCR product for 10 genes (lines 1–10: β-actin, GADPH, TIP41, F-box, UBC, SAND, RPL, β-TUB, EF1α, and PP2A, respectively). The left gel is leaf and the right gel is root, M represents a 2000 bp DNA marker.
Table 1
Description of primer sequences.
Gene symbol
Accession ID
Description
Primer sequence (5ʹ-3′) (forward/reverse)
Amplicon length
Product Tm (°C)
RT-qPCR efficiency (%)
β-actin
XM_ 018658258.2
β-Actin-2
TGTGCCAATCTACGAGGGTTT/TTTCCCGCTCGGCTGTTGT
137
84
98.4
GADPH
XM_009125769.3
Glyceraldehyde-3-phosphate Dehydrogenase
CGTCCACTCCATCACTGC/AGAACCTTTCCGACAGCC
132
84.4
103.7
TIP41
XM_009116214.2
TIP41-like protein
TAGCGGAGTTGTTGAGAAAG/AGCCAAAATCGTAAGAGGAG
252
83.1
102.2
F-box
XM_009153742.3
F-box/kelch-repeat protein
GTCTGTCTTTATGCGGTCC/GATGCTCTCTCCCTCGTTC
181
84.2
110.1
UBC
XM_009136845.3
Ubiquitin-conjugating enzyme
TACGCAGGAGGAGTGTTT/TGTTGATGTTTGGGTGGT
106
81.1
96.3
SAND
XM_009135631.3
SAND family protein
ATACCGAGCATACCAGAA/GTGACCCAGCATAGCAGA
108
80.5
101.6
RPL
XM_009148505.3
60S Ribosomal protein L8
CACTCACCACCGCAAGGGC/GGATGACGGAAGGAGACGC
141
87.8
98.1
β-TUB
XM_009125342.3
Tubulin beta-4
CTTGCTAATCCCACTTTTG/ACTGTTGCGACCCTCTTGA
193
85.6
108.9
EF1α
XM_009122323.2
Elongation factor 1-alpha 1
TGCTGTAACAAGATGGATG/CTGAAGTGGGAGACGGAGG
267
86.2
99.9
PP2A
XM_009120007.3
Protein Phosphatase PP2A-2
AGGGCTATCACCTTCTC/ACACATTGGTCCTTCGT
85
80.1
105.2
Primer specificity and amplicon size.
Agarose gel (1.5%) electrophoresis indicated the amplification of a single PCR product for 10 genes (lines 1–10: β-actin, GADPH, TIP41, F-box, UBC, SAND, RPL, β-TUB, EF1α, and PP2A, respectively). The left gel is leaf and the right gel is root, M represents a 2000 bp DNA marker.
Stability analysis of internal reference gene expression
GeNorm [10], NormFinder [9], BestKeeper [11], and RefFinder software programs (http://fulxie.0fees.us/?type=reference) were used to assess the stability of 10 potential reference genes. For the GeNorm and NormFinder programs, the original Cq (quantification cycle) value was converted to a relative Q value using the formula Q = 2-ΔCq, where ΔCq = each corresponding Cq value-minimum Cq value [31, 32]. The Q value was then uploaded in the GeNorm program and the expression stability measurement (M value) was calculated based on the average of the pairwise variation of the candidate reference gene and all other detected genes. The NormFinder program uses an ANOVA-based model to calculate stability values to account for intra- and inter-group changes in candidate reference genes, with the lowest value representing the highest stability. For the BestKeeper program, the raw Cq values were used to calculate the coefficient of variation and standard deviation. The RefFinder program integrates results from the GeNorm (M value), NormFinder (stability value), BestKeeper (CV and SD) programs, along with ΔCq values, and generates a comprehensive ranking [6].
Validation of reference gene stability
Previous studies have shown that Probable peroxygenase 3 (PXG3) may respond to abiotic stress [29, 33]. In order to confirm the reliability of the selected reference genes, PXG3 (Bra022936) was designed to design primers PXG3F: TTCAACCCAATCTCCTG, PXG3R: GTGATGGCAACCAACTC, and the relative expression profiles of Longyou-7 of leaves under drought and cold stress were detected and normalized. The most stable and unstable reference gene identified by the RefFinder program was used to calculate relative expression data using the 2-△△Cq method [34] for three biological replicates.
Results
Expression level and variation of candidate reference genes
RT-qPCR detection of expression levels of 10 candidate reference genes showed that Cq values of all candidate reference genes under different treatments ranged from 16.8 to 29.1 (Fig 2). EF1α had the highest expression level, with an average Cq of 19.7, a range of 16.8–22.6, and a coefficient of variation of 7.6%. β-actin had an average Cq of 20.5 with the narrowest range among candidate reference genes (17.9–23.3), and a coefficient of variation of 5.4%. SAND and TIP41 had the lowest expression levels, with an average Cq of 27.8 and 27.2, respectively, and a coefficient of variation of 2.6 and 3.3%, respectively. In all treatments, EF1α and β-TUB showed the greatest variability, with a coefficient of variation of 7.6 and 5.5%, respectively, while PP2A, SAND and TIP41 exhibited the smallest variation, with a coefficient of variation of 3.7, 2.6, and 3.3%, respectively.
Fig 2
Cq value of candidate reference genes across all treatments under four abiotic stresses.
The dashed horizontal line within a box-plot represents the median. The lower and upper edges of boxes show the 25th and 75th percentiles, respectively. Whiskers represent the maximum and minimum values.
Cq value of candidate reference genes across all treatments under four abiotic stresses.
The dashed horizontal line within a box-plot represents the median. The lower and upper edges of boxes show the 25th and 75th percentiles, respectively. Whiskers represent the maximum and minimum values.
Stability analysis of candidate reference genes using GeNorm software
The GeNorm software program was used to assess the stability of 10 candidate reference genes, which was defined as the average variation of one gene relative to all other genes. The threshold for eliminating stable genes was an average expression stability value (M) < 1.5, as a lower M value indicates higher stability [10]. Based on this criterion, RPL and PP2A were the most stable reference genes in pooled samples from all treatments (Total) and drought-treated roots (PR) (Fig 3), β-actin and GADPH were most stable in cold-treated leaves (CL), β -actin and PP2A were most stable in cold-treated roots (CR), EF1a and UBC were most stable in heat-treated leaves (HL), PP2A and F-box were most stable in heat-treated roots (HR), PP2A and SAND were the most stable in salt-treated leaves (NL), and RPL and GADPH were the most in drought-treated leaves (PL). TIP41 was the most unstable reference gene in all samples (S1 File).
Fig 3
Average expression stability (M) value of the 10 candidate reference genes assayed with GeNorm software.
Within a pane, the most and least stable genes are on the right and left, respectively. CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.
Average expression stability (M) value of the 10 candidate reference genes assayed with GeNorm software.
Within a pane, the most and least stable genes are on the right and left, respectively. CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.Paired variant (Vn/Vn+1) values were also calculated using the GeNorm software program to determine the optimal number of reference genes required for RT-qPCR to normalize target gene expression levels [12]. A small change between Vn/Vn+1 and Vn+1/Vn+2 indicates that the addition of another reference gene has no significant effect on normalization, and a Vn/Vn+1 value of 0.15 is considered a threshold for determining whether to add a reference gene [10, 35]. The V2/3 values in CL (0.129), CR (0.111), HL (0.145), NR (0.134), PL (0.135), and PR (0.058) were lower than 0.15 (Fig 4), indicating that two reference genes were sufficient to normalize target gene expression (S1 File). The V2/3 values in HR (0.174) and NL (0.156) were higher than 0.15, and their V3/4 values were 0.116 and 0.147, respectively, indicating that three reference genes were required to normalize target gene expression. However, some researchers have suggested that ‘0.15’ should not be considered as a strict threshold and that a higher Vn/Vn+1 threshold may be optimal in some cases [9, 36].
Fig 4
Pairwise variation (V) of candidate reference genes.
The Vn/Vn+1 value is used to determine number of reference genes required for treatments; usually the value should be less than 0.15 for inclusion of a reference gene. CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.
Pairwise variation (V) of candidate reference genes.
The Vn/Vn+1 value is used to determine number of reference genes required for treatments; usually the value should be less than 0.15 for inclusion of a reference gene. CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.
Stability analysis of candidate reference genes using NormFinder software
Stability values of the 10 candidate reference genes were calculated using the NormFinder software program, and lower values represent higher stability. RPL was the most stable reference gene in pooled samples from all treatments (Total, 0.343) and in NR (0.185), SAND was the most stable in CL (0.233) and NL (0.063), EF1α was the most stable in CR (0.085), PP2A was the most stable in PL and PR, F-box was the most stable in HR and the most unstable in PR, and TIP41 was unstable for multiple treatments (Table 2 and S2 File). Consistent with the GeNorm anlaysis, RPL was the most stable gene in all samples; however, in most samples, the stability level of candidate reference genes generated with NormFinder was slightly different from that with GeNorm. For example, in the NormFinder analysis, PP2A and SAND were identified as the most stable reference genes in PL and CL, while the GeNorm analysis ranked these as third and fourth in stability, respectively.
Table 2
Stability value of candidate reference genes determined using NormFinder software.
Rank
Total
CL
CR
HL
HR
NL
NR
PL
PR
1
RPL (0.343)
SAND (0.223)
EF1α (0.085)
SAND (0.217)
F-box (0.13)
SAND (0.063)
RPL (0.185)
PP2A (0.14)
PP2A (0.028)
2
SAND (0.41)
β-TUB (0.294)
GADPH (0.241)
F-box (0.228)
PP2A (0.142)
PP2A (0.183)
UBC (0.237)
RPL (0.212)
RPL (0.028)
3
GADPH (0.537)
β-actin (0.322)
TIP41 (0.323)
RPL (0.263)
RPL (0.31)
UBC (0.362)
β-actin (0.264)
GADPH (0.22)
UBC (0.088)
4
PP2A (0.613)
RPL (0.358)
RPL (0.334)
TIP41 (0.307)
SAND (0.361)
GADPH (0.388)
PP2A (0.308)
SAND (0.354)
TIP41 (0.358)
5
TIP41 (0.667)
GADPH (0.372)
β-actin (0.371)
EF1α (0.33)
TIP41 (0.389)
RPL (0.419)
EF1α (0.321)
UBC (0.414)
EF1α (0.437)
6
β-actin (0.708)
PP2A (0.426)
F-box (0.425)
β-actin (0.333)
β-TUB (0.506)
TIP41 (0.479)
SAND (0.442)
TIP41 (0.48)
β-TUB (0.455)
7
UBC (0.742)
EF1α (0.47)
β-TUB (0.436)
UBC (0.395)
β-actin (0.545)
β-TUB (0.56)
F-box (0.544)
EF1α (0.58)
SAND (0.479)
8
β-TUB (0.767)
F-box (0.482)
PP2A (0.439)
β-TUB (0.421)
UBC (0.581)
EF1α (0.597)
GADPH (0.66)
β-TUB (0.742)
GADPH (0.515)
9
F-box (0.911)
UBC (0.527)
SAND (0.544)
PP2A (0.472)
GADPH (0.648)
F-box (0.685)
β-TUB (0.732)
F-box (0.745)
β-actin (0.54)
10
EF1α (0.951)
TIP41 (0.558)
UBC (0.645)
GADPH (0.865)
EF1α (1.007)
β-actin (0.901)
TIP41 (0.736)
β-actin (0.987)
F-box (0.845)
CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.
CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.
Stability analysis of candidate reference genes using BestKeeper software
The expression stability of 10 candidate reference genes was evaluated based on the Cq value calculated using the BestKeeper software program. The coefficient of variation and standard deviation of all candidate reference genes were calculated, and lower values of these indicate higher stability [37]. β-actin was the most stable reference gene in CL (2.1 ± 0.59), CR (0.52±0.11), and NR (0.48 ± 0.1), PP2A was the most stable in HL (1.97 ± 0.53) and PR (0.83±0.22), SAND was the most stable in pooled samples from all treatments (2.1 ± 0.59), UBC was the most stable in HR (0.68 ± 0.16), and RPL was the most stable in PL (0.38 ± 0.08) (Table 3 and S3 File). β-TUB was the most stable gene in NL, but was the most unstable in NR and PL. EF1a was the most unstable in pooled samples from all treatments, and in CL and HR, but ranked second in NL and NR, and β-TUB was unstable in most treatments. For most treatments, the stability ranking of candidate reference genes generated using BestKeeper was different from that with GeNorm and NormFinder.
Table 3
Stability of candidate reference genes determined using BestKeeper software.
Rank
Total
CL
CR
HL
HR
NL
NR
PL
PR
1 CV±SD
SAND 2.1±0.59
β-actin 0.47±0.1
β-actin 0.52±0.11
PP2A 1.97±0.53
UBC 0.68±0.16
β-TUB 3.48±0.96
β-actin 0.48±0.1
RPL 0.38±0.08
PP2A 0.83±0.22
2 CV±SD
TIP41 2.72±0.74
PP2A 1.13±0.29
PP2A 0.94±0.24
SAND 2.14±0.6
β-actin 1.04±0.21
EF1α 4.27±0.84
EF1α 1.19±0.21
GADPH 0.53±0.11
UBC 1.05±0.25
3 CV±SD
PP2A 3.01±0.8
GADPH 1.31±0.27
GADPH 1.44±0.3
F-box 2.21±0.62
TIP41 1.41±0.38
F-box 3.5±0.96
UBC 1.84±0.46
PP2A 1.13±0.3
GADPH 1.15±0.23
4 CV±SD
RPL 3.26±0.68
SAND 1.36±0.37
TIP41 1.88±0.51
TIP41 2.38±0.66
PP2A 1.69±0.45
β-actin 3.26±0.67
PP2A 2.21±0.6
SAND 2.21±0.62
β-TUB 1.18±0.29
5 CV±SD
β-actin 3.49±0.72
RPL 1.54±0.32
EF1α 1.95±0.36
β-actin 2.67±0.6
F-box 1.82±0.45
GADPH 4.47±0.99
GADPH 2.29±0.46
UBC 2.66±0.65
RPL 1.18±0.24
6 CV±SD
UBC 3.68±0.92
β-TUB 2.32±0.6
F-box 2.18±0.56
β-TUB 2.8±0.76
GADPH 2.15±0.43
PP2A 2.38±0.66
RPL 2.29±0.48
TIP41 2.83±0.77
β-actin 1.42±0.29
7 CV±SD
GADPH 3.74±0.78
UBC 2.75±0.68
β-TUB 2.27±0.57
RPL 3.02±0.66
SAND 2.66±0.74
RPL 1.53±0.33
TIP41 2.44±0.64
β-actin 3.05±0.58
TIP41 1.52±0.41
8 CV±SD
F-box 4.5±1.21
F-box 2.86±0.8
SAND 2.77±0.76
UBC 3.6±0.91
RPL 3.47±0.74
SAND 1.87±0.52
F-box 3±0.76
F-box 3.31±0.91
SAND 2.56±0.7
9 CV±SD
β-TUB 4.59±1.2
TIP41 2.96±0.82
RPL 2.87±0.58
EF1α 4.41±0.89
β-TUB 3.79±1.01
TIP41 1.77±0.46
SAND 3.01±0.82
EF1α 3.51±0.71
EF1α 3.26±0.63
10 CV±SD
EF1α 6.08±1.2
EF1α 3.72±0.72
UBC 4.13±1.05
GADPH 4.97±1.08
EF1α 5.65±1.2
UBC 2.88±0.73
β-TUB 3.81±0.99
β-TUB 3.7±0.93
F-box 3.54±0.96
CV and SD: coefficient of variation and standard deviation, respectively; CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.
CV and SD: coefficient of variation and standard deviation, respectively; CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.
Ranking of candidate reference genes using RefFinder software
The RefFinder software program was used to determine the overall ranking of candidate reference genes. The program integrates the GeNorm, NormFinder, BestKeeper, and △Cq methods [12, 32, 38]. Under all treatments, the ranking order (from the most stable to the least stable) was: RPL > SAND > PP2A > GADPH > β-actin > TIP41 > UBC > β-TUB > F-box > EF1α (Table 4). Under CL treatments, the ranking order (from the most stable to the least stable) was: β-actin > SAND > GADPH > RPL > β-TUB > PP2A > EF1α > UBC > F-box > TIP41. Under CR treatments, the ranking order (from the most stable to the least stable) was: β-actin > EF1α > GADPH > PP2A > TIP41 > RPL > F-box > β-TUB > SAND > UBC. SAND and F-box, were the most stable for HL, PP2A and RPL were the most stable for HR, PP2A and SAND were the most stable for NL, RPL and UBC were the most stable for NR, PP2A, GADPH, and RPL were the most stable for PL, and PP2A and RPL were the most stable for PR. β-TUB, F-box, and EF1α were the most unstable reference genes in most of the abiotic stress treatments (S1 Table).
Table 4
The most stable and unstable combinations of reference genes determined using RefFinder analysis.
Sample
Stability
Genes (ranking value)
Total
Most
RPL (1.19)
SAND (1.86)
PP2A (3.13)
Least
EF1α (9.46)
F-box (9.24)
CL
Most
β-actin (1.57)
SAND (2.11)
GADPH (2.66)
Least
TIP41 (10)
CR
Most
β-actin (1.97)
EF1α (2.11)
GADPH (2.45)
Least
UBC (10)
HL
Most
F-box (2.21)
SAND (2.45)
Least
GADPH (10)
HR
Most
PP2A (2.06)
RPL (2.82)
F-box (2.99)
Least
EF1α (10)
NL
Most
SAND (1.32)
PP2A (2)
Least
F-box (9)
NR
Most
RPL (1.5)
UBC (1.86)
β-actin (2.78)
Least
β-TUB (9.74)
PL
Most
RPL (1.41)
PP2A (1.73)
GADPH (2.06)
Least
β-TUB (8.97)
PR
Most
PP2A (1.19)
RPL (1.57)
Least
F-box (10)
CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.
CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.
Expression of target genes and validation of selected reference genes
To verify the stability of the most stable and unstable reference genes obtained in the aforementioned analyses, the expression pattern of the target gene PXG3 in CR and PL was analyzed (Fig 5 and S2 Table). In CR, the most stable reference genes were β-actin and EF1α, and the most unstable reference gene was UBC (Fig 5A). In PL, the most stable reference genes were RPL and GADPH, and the most unstable reference gene was β-TUB (Fig 5B). The expression of PXG3 in the roots of winter rapeseed was slightly up-regulated after ≤6 h of cold stress, and significantly up-regulated after 12–24 h of cold stress (Fig 5A). When UBC was used as the reference gene, the expression was significantly up-regulated at 1 h of cold stress, the expression for all durations of cold stress was significantly higher than that of the other three reference genes. Therefore, the expression profile was more stable when the reference gene was combined. Under drought stress, PXG3 in leaves of winter rapeseed was expressed at the highest level at 6 h of stress (Fig 5B). When using GAPDH and RPL alone, or GAPDH combined with RPL as the reference gene, the expression of PXG3 was more stable and consistent than that with β-TUB, and the expression was most stable for the combined reference gene. When β-TUB was used as a reference gene, the expression of PXG3 fluctuated greatly, especially after 6–48 h of drought stress.
Fig 5
Relative expression of the PXG3 target gene for validation of selected reference genes.
(A) cold stress roots, (B) drought stress leaves.
Relative expression of the PXG3 target gene for validation of selected reference genes.
(A) cold stress roots, (B) drought stress leaves.
Discussion
RT-qPCR is widely recognized as a method for accurately and sensitively quantifying gene transcription levels, even for genes with lower transcription levels. For efficient RT-qPCR, precise standardization of gene expression is required for appropriate internal reference controls, and most gene expression studies in the literature are typically standardized using a single internal reference control [39]. The validity of the experimental results depends to a large extent on the reference gene applied, so it is necessary to verify expression stability of the control gene under specific experimental conditions before using for standardization [14, 33]. The most commonly used reference genes in early gene expression studies were based primarily on their roles that are known or expected in basic cellular processes. The actin gene has been the most commonly used for quantification of normalized gene expression levels [40]. Genes encoding GAPDH, actin, and EF1α have been used as the most relevant reference genes for fruit development [41]. However, in subsequent studies it was found that the actin gene is not suitable as a broad reference gene because transcript levels are observed in different plant tissues and organs under different growth conditions [27].Analyses with the GeNorm, NormFinder, and BestKeeper software programs are based on statistical principles and are used extensively in RT-qPCR experiments to identify the stability of reference genes. The NormFinder program works similarly to GeNorm program, but the GeNorm program can be used to screen for the best combination of reference genes and numbers. Compared to the GeNorm and NormFinder programs, the BestKeeper program directly uses the quantitative result of the Cq value calculation [11]. The results of this study show that the results obtained by the GeNorm and NormFinder programs were similar, but different from the results obtained with the BestKeeper program, concurrent with Rapacz et al. [42]. The RefFinder program was used for comprehensive comparative analysis of reference genes to determine the final stability ranking because it integrates the comprehensive evaluation of GeNorm, NormFinder, BestKeeper, and △Cq [43], and has been used in many other species [15, 30, 34, 39, 44, 45].In this study we selected 10 Brassica rapa reference genes according to the internal reference gene TOP10 of plant species that are closely related to the internal control genes of Brassica rapa [3, 8, 16, 34, 46–49]. The reference genes identified differed with stress treatment and plant tissue. Of 13 reference genes previously selected for identification in Brassica rapa L. ssp. pekinensis subjected to various stresses, UBC, EF1α, and β-actin were recommended for abiotic stress induced by hormones, salt, drought, cold, and heat [45]; the results of this study are similar. Others found that if only one reference gene is used in Chinese cabbage research, EF1α is the best choice for standardization of different tissues, but for higher accuracy, the combination of EF1α and Apr should be considered to improve the normalization factor [50]. These researchers also concluded that GAPDH is the best single reference gene for experiments under conditions of drought stress and downy mildewinfection, but the combination of GAPDH and UBC enhances the normalization factor. Our study found that RPL had a relatively high ranking in all treatments, while GAPDH had a relatively high ranking in some samples. In Poa pratensis L., a combination of β-actin and RPL were identified as stable reference genes in heat-treated roots; however, RPL was the most unstable in drought-treated leaves [6]. Other studies found RPL17 to be the best reference gene for short-term salt and ABAstress in Populus euphratica [16, 51]. Our results add another possible stable reference gene (RPL) besides β-actin to Brassica rapa. Studies on Brassica napus found that the combinations of PP2A + UBC and F-box + SAND performed well under drought and cold stress, and that two new reference genes (TIP41 and PP2A) were expressed under multiple abiotic stresses [18]. In this study, PP2A was stable in leaves and roots under drought stress, and SAND was stable in cold-stressed leaves. These are similar to the above results, but TIP41 was not among the combinations of reference genes ranked as most stable for any treatment in this study, which may attributable to differences in species [14, 32, 36, 47, 52, 53]. β-actin and GADPH were stable internal reference genes in cold-stressed leaves and roots, and RPL and UBC were stable in drought-stressed roots.The expression pattern of the target gene PXG3 in response to cold and drought stress in winter rapeseed was analyzed and the reliability of the identified stable reference genes was verified. EF1α and β-actin or EF1α and β-actin were used as reference genes for cold-stressed root samples, and PXG3 expression profiles in winter rapeseed were used when GAPDH and RPL or GAPDH combined with RPL were used as reference genes for drought-stressed leaf samples. These genes may be suitable for quantitative normalization of target gene expression profiles in cold-stressed roots or drought-stressed leaves of Brassica rapa L. When a reference gene with poor stability is selected, the PXG3 expression spectrum fluctuates, indicating that these genes are not reliable for RT-qPCR analysis. Selecting unstable reference genes for RT-qPCR analysis can lead to inaccurate experimental conclusions [12, 14–16, 54]. Therefore, selection of the best reference gene is particularly important for standardization of RT-qPCR and the rational expression of target genes.
Conclusions
In this study, the GeNorm, NormFinder, BestKeeper, and RefFinder programs were used to analyze the internal reference genes of four abiotic stresses in winter rapeseed. β-actin and SAND were the most stable internal reference gene combination in cold-stressed leaves, β-actin and EF1α were the most stable combination in cold-stressed roots. F-box and SAND were the most stable combination in heat-stressed leaves, PP2A and RPL were the most stable combination in heat-stressed roots. SAND and PP2A were the most stable combination in NaCl-stressed leaves, RPL and UBC were the most stable combination in NaCl-stressed roots. RPL and PP2A were the most stable combination in drought-stressed leaves, and PP2A and RPL were the most stable combination in drought-stressed roots. These were verified by PXG3 expression profiles. It is also believed that RPL can be used as a universal reference gene for multiple abiotic stresses in Brassica rapa. The stable reference gene identified in this study are a useful tool for identifying stress-responsive genes and can advancing knowledge of the underlying molecular mechanisms of abiotic stress tolerance in rapeseed.
RT-qPCR standard curve of the 10 reference genes.
(TIF)Click here for additional data file.
Stability analysis of candidate reference genes using GeNorm software.
CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.(ZIP)Click here for additional data file.
Stability analysis of candidate reference genes using NormFinder software.
CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.(ZIP)Click here for additional data file.
Stability of candidate reference genes determined using BestKeeper software.
CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.(ZIP)Click here for additional data file.
Sequencing results of 10 genes specifically amplified products.
(ZIP)Click here for additional data file.
Ranking of candidate reference genes using RefFinder software.
CL and CR: Cold-treated leaves and roots, respectively; HL and HR: Heat-treated leaves and roots, respectively; NL and NR: Salt-treated leaves and roots, respectively; PL and PR: Drought-treated leaves and roots, respectively; Total: Pooled samples from all treatments.(XLS)Click here for additional data file.(A) cold stress roots, (B) drought stress leaves.(XLSX)Click here for additional data file.
The original gel images contained in the manuscript’s main figures.
(PDF)Click here for additional data file.26 Mar 2020PONE-D-20-00260Screening and Verification of Reference Genes for Analysis of Gene Expression in Winter Rapeseed (Brassica rapa L.) under Abiotic StressPLOS ONEDear Prof. Sun,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.We would appreciate receiving your revised manuscript by May 10 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Yong Pyo LimAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements:1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ3. Thank you for stating the following in the Acknowledgments Section of your manuscript:"This study was financially supported by the Utilization Technology of Rapeseed Heterosis and Creation of Strong Heterosis of China (2016YFD0101300), Agriculture Research System of China (CARS-12), and the Agriculture Research System of Gansu Province (GARS-TSZ-1), and the National Natural Science Foundation of China (31860388)."We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:"Specify the role(s) played."[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: NoReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: NoReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: Comments for the authorThis paper attempts to identify appropriate reference genes for gene expression studies in Brassica rapa. The stability of ten potential reference genes was evaluated in four different abiotic stresses, in leaves and root samples. The expression stability of these genes was analyzed using geNorm, NormFinder, BestKeeper, and RefFinder software in order to identify the best reference genes under given experimental conditions. However, the article could have been more significant if the authors conducted a similar analysis for many different developmental stages and other abiotic stresses. Since such studies are not new, and a lot of work has been carried out with a more in-depth analysis of a large number of samples and genes.I have several comments that should be clarified, namely:1- The authors should mention a justification for choosing these particular 10 candidate genes in the materials methods.2- No justification is given for the use of neither the concentration of 180mM NaCl for salt treatment nor the percentage of 18% of PEG for the drought treatment. Have the authors done some previous studies that show that these concentrations are adequate to induce the stresses?3- In the case of plants obtained from seeds in which the variability will certainly be high, three biological replicates may not be sufficient to guarantee a good sampling; five replicates should be the minimum.4- After DNAse treatment I do not see strong evidence (sufficient evidence) that contaminating genomic DNA was removed. The methods described (agarose gel and spectrophotometer) do not address the removal of contamination. The authors need to at least conduct a negative Reverse Transcriptase reaction whereby DNAse digested RNA is subjected to a mock cDNA synthesis without Reverse Transcriptase. The resulting reaction is then used for PCR as usual. In this case, the Ct value for the negative reactions could be compared to control reactions as evidence for "successful digestion".5- Total RNA extraction and cDNA synthesis (Line 82) It is not clear how much total RNA was used for cDNA conversion. The authors should provide this detail and also confirm whether the same amount of total RNA was used for cDNA conversion across all the samples.6- Candidate reference gene selection and primer design (Line 96) It is mentioned that the gel pictures were analyzed through 1.5% agarose gel on the RT-PCR product with a single expected size DNA band to confirm the specificity of the PCR product. I am not sure if the authors actually mean that they confirmed the product by the predicted size. The best practice is to sequence the product to confirm the specificity of the reaction. The authors should clearly state that their assessment was based on the product size and single band.8- It is not clear which cDNA was used to confirm primers specificity (lines 96-97). Please mention in the text.9- It is not clear which cDNA samples were used to determine primers efficiencies (Table 1). Please mention in the text.10- Inside Table 1 regarding primer pairs, the amplicons more than 180 to 200 bp is not suitable for Real-time analysis. It’s usually recommended to keep amplicon size small and if possible about the same length across all test genes. Is there any particular reason why some of these genes have big amplicons?11- “Brassica rapa”, “reference gene” “gene expression” and “abiotic stress” keywords are redundant since already present in the title.12- Additionally, the most stably expressed reference genes for each stress were used for accurate normalization of the expression level of Probable peroxygenase 3 (PXG3) in leaves of Longyou-7 under drought and cold stress.It seems that one of the conclusions of the study was that none of the candidate reference genes were uniformly expressed across tissues and all the experimental conditions tested in this study.13- Correct the nomenclature of Fig 5 in throughout the result. The author has written Fig 4 instead of Fig 5.14- The authors should also, provide statistical analysis for data shown in fig 5.15- The English writing needs to revise. Also, some correction should be done for some incorrect words inside the text, for example in conclusion (line 317) gene name is RPL, not PRL, so many extra spaces found across the manuscript for example line 75, 120, 162 etc. Inline 47 species name should be in italic Cynodon dactylon. Please rephrase line 276 to 296 in the discussion. In-text, many places it is NACL, it should be NaCl.Reviewer #2: The authors of this ms have carried out similar approach to the previous one in B. napus (Wang et al. 2014). Normalization of expression levels of genes will be very important to predict their gene function. Therefore, development of appropriate reference genes can greatly contribute to the transcriptional regulation of gene expression. It is also true in the study of B. rapa crops. However, one should consider duplication and polyploidization of Brassicaceae. B. rapa represents one of the diploid genomes (with triplicated genome) that forms allopoloid B. napus. Therefore, Wang et al. (2014) reported that TIP41 is the best-ranked reference gene in B. napus under several stress conditions (two parolog gens are present in B. napus), but not in B. rapa (only one gene in the geneome). Paralog genes might differentially expressed in different tissues or different conditions, and expression levels will be sum of them, implying more paralogs better. Beta-actin-2 or -7 represents at least 4 paralogs in B, rapa. Therefore, authors should consider how many paralog genes are present in B. rapa genome for data explanation.- Beta-actin -7 used by authors appears to be beta-actin-2. Please check gene and primer sequences in Table 1.- References should be intensively edited: Capital vs. lowercase, removal of printing company, etc.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.8 May 2020Response to Reviewer #1:In China, winter rapeseed (Brassica rapa L.) is mainly produced in northern latitudes with harsh growing conditions and frequently experiences abiotic stresses such as cold, heat, drought, and salt. At present, about 115 kinds of plants have carried out the identification of internal reference genes. The results show that the internal reference genes identified by different stress treatments and tissue parts are different. However, this kind of research has not been carried out in winter rapeseed (Brassica rapa L.). This study is the first time to identify the reference genes of typical oil crops (winter Brassica rapa) in northern China, which provides support for the research on the mechanism and gene expression of cold resistance, drought resistance, salt resistance and heat resistance of winter rapeseed.1- The authors should mention a justification for choosing these particular 10 candidate genes in the materials methods.Response 1: Reasons for selecting these 10 candidate genes have been added to materials and methods.2- No justification is given for the use of neither the concentration of 180mM NaCl for salt treatment nor the percentage of 18% of PEG for the drought treatment. Have the authors done some previous studies that show that these concentrations are adequate to induce the stresses?Response 2: Yes, our research group has done these researches before. 180mm NaCl and 18% PEG are the critical concentrations of salt and drought stress in winter Brassica rapa. These results have been published and two references have been added to the manuscript.Dong X, Mi C, Liu Z, et al. Response of winter rapessed seeding growth and physiological characteristics under PEG drought tolerance. J Henan Agric Univ. 2018;52: 313–321.Wang Z, Liu Z, Sun W, et al. Effects of NaCl and Na2SO4stress on germination of winter rapeseed (Brassica rapa L.) and analysis of salt resistance. Agric Res Arid Areas. 2016;34: 243–252.3- In the case of plants obtained from seeds in which the variability will certainly be high, three biological replicates may not be sufficient to guarantee a good sampling; five replicates should be the minimum.Response 3: For the experiment operation, including seed selection, pot experiment, growth management, abiotic stress and experiment operation, we carried out three biological repeats in strict accordance with the same standard, and the previous transcriptome, microRNA and fluorescence quantitative experiments got good results. Therefore, three biological repeats are feasible in winter Brassica rapa.4- After DNAse treatment I do not see strong evidence (sufficient evidence) that contaminating genomic DNA was removed. The methods described (agarose gel and spectrophotometer) do not address the removal of contamination. The authors need to at least conduct a negative Reverse Transcriptase reaction whereby DNAse digested RNA is subjected to a mock cDNA synthesis without Reverse Transcriptase. The resulting reaction is then used for PCR as usual. In this case, the Ct value for the negative reactions could be compared to control reactions as evidence for "successful digestion".Response 4: Yes, we used gDNA eraser to remove DNA pollution, and then we carried out negative reverse transcriptase reaction (without reverse transcriptase), and then we carried out fluorescence quantitative PCR to get CT value similar to that of negative control.5- Total RNA extraction and cDNA synthesis (Line 82) It is not clear how much total RNA was used for cDNA conversion. The authors should provide this detail and also confirm whether the same amount of total RNA was used for cDNA conversion across all the samples.Response 5: In the process of RNA extraction and cDNA reverse transcription, we strictly followed the instructions of the kit. After the completion of RNA extraction, RNA concentration, a260/A280 and a260/A230 were tested, and we will re extract the samples with non-standard results. According to the instructions of cDNA reverse transcription Kit (10 μl reaction system can use up to 500 ng of total RNA), the RNA volume is calculated to ensure that all the added RNA is reverse transcribed into cDNA. Finally, we will dilute the cDNA concentration of all samples to 50 ng/μl according to the method described. This detail has been added to the manuscript.6- Candidate reference gene selection and primer design (Line 96) It is mentioned that the gel pictures were analyzed through 1.5% agarose gel on the RT-PCR product with a single expected size DNA band to confirm the specificity of the PCR product. I am not sure if the authors actually mean that they confirmed the product by the predicted size. The best practice is to sequence the product to confirm the specificity of the reaction. The authors should clearly state that their assessment was based on the product size and single band.Response 6: Sorry, I didn't write the pre experiment steps in the manuscript. We will design 3-4 pairs of primers according to the principle of fluorescence quantitative primer design, and we will test the amplification effect and specificity of primers in multiple software before synthesis. After obtaining the primers, RT-PCR amplification and detection in 1.5% agarose, the most important thing is that we will carry out pre experiment on the primers, and determine the final primers after obtaining the ideal CT value, amplification curve and dissolution curve. All the experimental steps and questions in the manuscript will be communicated with the technical personnel of the kit manufacturer to get the best experimental results.8- It is not clear which cDNA was used to confirm primers specificity (lines 96-97). Please mention in the text.Response 8: The cDNA of CK was selected for primer specific detection. It has been mentioned in the text.9- It is not clear which cDNA samples were used to determine primers efficiencies (Table 1). Please mention in the text.Response 9: The cDNA of CK was selected for detection of primer efficiency. It has been mentioned in the text.10- Inside Table 1 regarding primer pairs, the amplicons more than 180 to 200 bp is not suitable for Real-time analysis. It’s usually recommended to keep amplicon size small and if possible about the same length across all test genes. Is there any particular reason why some of these genes have big amplicons?Response 10: After we designed the primers, we did not find the ideal pairing primers of TIP41 and EF1α genes within 200 bp by software and qPCR pre experiment analysis. Then we slightly increased the amplification length of the primers, and got the ideal pairing primers through the above methods, and there are similar reports in the related internal reference gene identification articles.11- “Brassica rapa”, “reference gene” “gene expression” and “abiotic stress” keywords are redundant since already present in the title.Response 11: Key words have been modified in the manuscript.12- Additionally, the most stably expressed reference genes for each stress were used for accurate normalization of the expression level of Probable peroxygenase 3 (PXG3) in leaves of Longyou-7 under drought and cold stress. It seems that one of the conclusions of the study was that none of the candidate reference genes were uniformly expressed across tissues and all the experimental conditions tested in this study.Response 12: Ideally, reference genes are expressed at constant levels to represent the concentration of cDNA in a sample. However, their expression is usually altered by the effects of experimental treatment, tissue sites, and nucleic acid quality [5]. The best method currently considered to follow the MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) guidelines, using multiple internal reference genes, because the use of a single internal reference gene is considered inappropriate [13].In China, winter rapeseed (Brassica rapa L.) is mainly produced in northern latitudes with harsh growing conditions and frequently experiences abiotic stresses such as cold, heat, drought, and salt. At present, about 115 kinds of plants have carried out the identification of internal reference genes. The results show that the internal reference genes identified by different stress treatments and tissue parts are different, but this kind of research has not been carried out in in winter rapeseed (Brassica rapa L.).13- Correct the nomenclature of Fig 5 in throughout the result. The author has written Fig 4 instead of Fig 5.Response 13: It has been revised in the manuscript.14- The authors should also, provide statistical analysis for data shown in fig 5.Response 14: Statistical analysis has been added to figure 5.15- The English writing needs to revise. Also, some correction should be done for some incorrect words inside the text, for example in conclusion (line 317) gene name is RPL, not PRL, so many extra spaces found across the manuscript for example line 75, 120, 162 etc. Inline 47 species name should be in italic Cynodon dactylon. Please rephrase line 276 to 296 in the discussion. In-text, many places it is NACL, it should be NaCl.Response 15: Sorry, these errors have been corrected in the manuscript, and the full text has been carefully revised and checked.Response to Reviewer #2:The authors of this ms have carried out similar approach to the previous one in B. napus (Wang et al. 2014). Normalization of expression levels of genes will be very important to predict their gene function. Therefore, development of appropriate reference genes can greatly contribute to the transcriptional regulation of gene expression. It is also true in the study of B. rapa crops. However, one should consider duplication and polyploidization of Brassicaceae. B. rapa represents one of the diploid genomes (with triplicated genome) that forms allopoloid B. napus. Therefore, Wang et al. (2014) reported that TIP41 is the best-ranked reference gene in B. napus under several stress conditions (two parolog gens are present in B. napus), but not in B. rapa (only one gene in the geneome). Paralog genes might differentially expressed in different tissues or different conditions, and expression levels will be sum of them, implying more paralogs better. Beta-actin-2 or -7 represents at least 4 paralogs in B, rapa. Therefore, authors should consider how many paralog genes are present in B. rapa genome for data explanation.- Beta-actin -7 used by authors appears to be beta-actin-2. Please check gene and primer sequences in Table 1.- References should be intensively edited: Capital vs. lowercase, removal of printing company, etc.Response Reviewer #2: There are different ploidy between Brassica rapa and Brassica napus, which shows that the internal reference genes need to be selected according to different species and stress treatment, there are more suitable reference genes than TIP41 in Brassica rapa. We used NCBI and Ensemble Genomes to compare the sequence of the internal reference gene, fully considered the existence of Paralog genes in Brassica rapa, and got the appropriate results.We rechecked the gene and primer sequence in Table 1, and we used beta-actin-7.We carefully revise the references and the full text to ensure correct writing.Submitted filename: Response to Reviewers.docxClick here for additional data file.27 May 2020PONE-D-20-00260R1Screening and Verification of Reference Genes for Analysis of Gene Expression in Winter Rapeseed (Brassica rapa L.) under Abiotic StressPLOS ONEDear Dr. Sun,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by Jul 11 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,Yong Pyo LimAcademic EditorPLOS ONE[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Partly**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: (No Response)**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: No**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1:I found the manuscript has been improved following revision. However, there is still scope to improve it which affects manuscripts quality.- Authors did not mentioned qPCR conditions in material and methods.- A sequence of PCR product is also needed in order to confirm that the specific gene has been amplified.- Please avoid some unnecessary some space in sentences and typing errorsFor example line 52, 54, 56, 76 and 77 have spacing problem.Line 26 there you typed EF-1a instead of EF1α.Line 114 you added 2.4 as a bullet numbering.Reviewer #2: I am sorry to say that author did not consider my first comments. I have checked most genes whether they have multigenes showing high identities. Except TIP4l, most genes have more than two paralogs with high sequence identities. Therefore, authors should check whether primer sequences shown in Table 1 is specific for one of them or common. XM_009127096.2 is beta-actin 7 gene, but it does not have primer sequences in Table 1. Instead, beta-actin 2 gene contains forward primer, but no reverse primer sequence at all. Please check, specify primer and paralog gene.**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: Yes: Sonam SinghReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.26 Jun 2020Response to Reviewer #1:1- Authors did not mentioned qPCR conditions in material and methods.Response 1: The reaction conditions of qPCR have been supplemented in material and methods.2- A sequence of PCR product is also needed in order to confirm that the specific gene has been amplified.Response 2: We rechecked 10 gene sequences with primers, A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. Here is the result.β-actin: Sorry, Professor, we sequenced the actin primers to get a single strip and sequencing result. The comparison result is shown in the figure below. After NCBI comparison, it shows that it is beta actin 2 gene (XM_018658258.2), and the primer information has been updated.GADPH: No paralogs with high sequence identities, and NCBI has provided a new version of this gene, which I have updated in materials and methods.TIP41: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.F-box: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.UBC: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.SAND: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.RPL: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.β-TUB: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.EF1α: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.PP2A: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.3- Please avoid some unnecessary some space in sentences and typing errorsFor example line 52, 54, 56, 76 and 77 have spacing problem.Line 26 there you typed EF-1a instead of EF1α.Line 114 you added 2.4 as a bullet numbering.Response 3: These errors have been corrected in the manuscript and the full text examined carefully.Response to Reviewer #2:I am sorry to say that author did not consider my first comments. I have checked most genes whether they have multigenes showing high identities. Except TIP4l, most genes have more than two paralogs with high sequence identities. Therefore, authors should check whether primer sequences shown in Table 1 is specific for one of them or common. XM_009127096.2 is beta-actin 7 gene, but it does not have primer sequences in Table 1. Instead, beta-actin 2 gene contains forward primer, but no reverse primer sequence at all. Please check, specify primer and paralog gene.Response Reviewer #2: Sorry, Professor, I didn't understand your question and didn't answer it completely in the first reply. This time, We rechecked 10 gene sequences with primers, and sequenced them after PCR amplification to ensure that the primers were specifically amplified. Here is the result.β-actin: Sorry, Professor, we sequenced the actin primers to get a single strip and sequencing result. The comparison result is shown in the figure below. After NCBI comparison, it shows that it is beta actin 2 gene (XM_018658258.2), and the primer information has been updated.GADPH: No paralogs with high sequence identities, and NCBI has provided a new version of this gene, which I have updated in materials and methods.TIP41: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.F-box: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.UBC: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.SAND: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.RPL: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.β-TUB: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.EF1α: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.PP2A: A single band was obtained by PCR amplification with primers, and the specific sequence was obtained by sequencing. And NCBI has provided a new version of this gene, which I have updated in materials and methods.Submitted filename: Response to Reviewers.docxClick here for additional data file.10 Jul 2020Screening and Verification of Reference Genes for Analysis of Gene Expression in Winter Rapeseed (Brassica rapa L.) under Abiotic StressPONE-D-20-00260R2Dear Dr. Sun,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Yong Pyo LimAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: (No Response)**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The comments were satisfactory answered in revised version of manuscript. It can be accepted for publicationReviewer #2: Authors do their best to improve ms. Now this ms can be published in PLoS One, thereby helping someones who have studying transcripts profiles**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No14 Jul 2020PONE-D-20-00260R2Screening and Verification of Reference Genes for Analysis of Gene Expression in Winter Rapeseed (Brassica rapa L.) under Abiotic StressDear Dr. Sun:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Yong Pyo LimAcademic EditorPLOS ONE