Literature DB >> 32901871

Checkpoint kinase‑1 inhibition and etoposide exhibit a strong synergistic anticancer effect on chronic myeloid leukemia cell line K562 by impairing homologous recombination DNA damage repair.

Zhuoyi Fan1, Huacheng Luo2, Jie Zhou1, Fangce Wang1, Wenjun Zhang1, Jian Wang3, Shuo Li4, Qian Lai5, Yueshuang Xu6, Guangming Wang1, Aibin Liang1, Jun Xu3.   

Abstract

Leukemia, a malignant hematological disease, has poor therapeutic outcomes due to chemotherapeutic resistance. Increasing evidence has confirmed that the elevated capacity for DNA damage repair in cancer cells is a major mechanism of acquired chemotherapeutic resistance. Thus, combining chemotherapy with inhibitors of DNA damage repair pathways is potentially an ideal strategy for treating leukemia. Checkpoint kinase 1 (CHK1) is an important component of the DNA damage response (DDR) and is involved in the G2/M DNA damage checkpoint. In the present study, we demonstrated that shRNA‑mediated CHK1 silencing suppressed cell proliferation and enhanced the cytotoxic effects of etoposide (VP16) in the chronic myeloid leukemia (CML) cell line K562 through the results of CCK‑8, and comet assay. The results demonstrated that shRNA‑induced CHK1 silencing can override G2/M arrest and impair homologous recombination (HR) repair by reducing breast cancer susceptibility gene 1 (BRCA1) expression. Cells had no time, and thus limited ability, to repair the damage and were thus more sensitive to chemotherapy after CHK1 downregulation. Second, we tested the therapeutic effect of VP16 combined with CCT245737, an orally bioavailable CHK1 inhibitor, and observed strong synergistic anticancer effects in K562 cells. Moreover, we discovered that CCT245737 significantly prevented the G2/M arrest caused by acute exposure to VP16. Interestingly, CCT245737 inhibited both BRCA1 and Rad51, the most important component of the HR repair pathway. In conclusion, these results revealed that CHK1 is potentially an ideal therapeutic target for the treatment of CML and that CCT245737 should be considered a candidate drug.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32901871      PMCID: PMC7551253          DOI: 10.3892/or.2020.7757

Source DB:  PubMed          Journal:  Oncol Rep        ISSN: 1021-335X            Impact factor:   3.906


Introduction

Although tyrosine kinase inhibitors (TKIs) have revolutionized the treatment of chronic myeloid leukemia (CML), some CML patients experience TKI resistance (1,2), TKI intolerance (3) or economic plight (4). Thus, there is still a need to identify new approaches for CML treatment. Despite the vast improvements in therapeutic strategies, DNA damage-based chemotherapy agents currently remain the preferred choice to treat most leukemias. DNA damage can induce cell cycle arrest and activate repair pathways, which are the main mechanisms of resistance to these preferred chemotherapy drugs. Therefore, combining DNA damage response (DDR) pathway inhibitors with DNA damage-based chemotherapeutics is a potential new strategy for treating leukemia, including CML. In general, DNA damage induces cell cycle arrest by activating cell cycle checkpoints, which gives cells enough time to repair the damage. Cancer cells mostly rely on the G2/M checkpoint to repair damaged DNA due to inactivating mutations or loss of p53 (5,6). Thus, we were inspired to target important components of the G2/M checkpoint to treat cancer, especially p53-mutant cancer. Two major signaling pathways are involved in the DDR: ATM/checkpoint kinase 2 (CHK2) and ATR/CHK1 (7–9). Research has shown that in malignant cells, the components involved in the ATR/CHK1 pathway are often upregulated, while ATM/CHK2 components are often deficient (10). Hence, the ATR/CHK1 signaling pathway, which is also involved in the G2/M checkpoint, is a potential target for the treatment of cancer. CHK1 is a Ser/Thr protein kinase that was first discovered in fission yeast in 1993 (11). In many different cancers, resistance to chemotherapy and radiotherapy is associated with CHK1 overexpression. CHK1 is phosphorylated by ATR in response to DNA damage and subsequently phosphorylates its downstream substrates to induce cell cycle arrest (12–14). Subsequent research confirmed that both the G2/M checkpoint and CHK1 play critical roles in the S phase and mitotic checkpoints (15,16). The CHK1 pathway can directly facilitate homologous recombination (HR) by regulating the expression, activity or localization of related proteins (17,18). Therefore, CHK1 is an attractive candidate for anticancer therapy. To date, several CHK1 inhibitors have been developed and administered either alone or in combination with other chemotherapeutic agents in preclinical or clinical trials (19–25). Among them, CCT245737 ((R)-5-((4-((morpholin-2-ylmethyl)amino)-5-(trifluoromethyl)pyridin-2-yl)amino)pyrazine-2-carbonitrile) is a selective CHK1 inhibitor that has oral bioavailability (26,27). Previous research has shown that CCT245737 can enhance the anticancer effects of gemcitabine and carboplatin in non-small cell lung cancer (NSCLC) and B-cell lymphoma mouse models (26). However, no study has tested the potential of this inhibitor to increase the efficacy of chemotherapy or elucidated the mechanism by which this inhibitor enhances chemotherapeutic effects in CML. In the present study, CHK1 was inhibited by RNA interference (RNAi) or CCT245737 in K562 cells to determine its role in the chemosensitivity of CML cells. We confirmed that CHK1 inhibition significantly and specifically enhanced the chemosensitivity of K562 cells to etoposide (VP16) by eliminating VP16-induced G2/M arrest and suppressing HR efficiency. Moreover, we also preliminarily investigated the therapeutic effect of CCT245737 in imatinib-treated K562 cells and showed that this approach could be applicable to TKI treatment of CML in the future.

Materials and methods

Cell lines

K562 (human CML) and 293T/17 cells were purchased from the Cell Bank, Chinese Academy of Sciences (Shanghai, China); the KCL22 (human CML) cell line was obtained from the German Collection of Cell Cultures (Braunschweig, Germany); and the CAM191 (human normal lymphocyte) cells were purchased from the Cell Bank, Chinese Academy of Sciences (Kunming, China). K562 and KCL22 cells were grown in IMDM (Gibco; Thermo Fisher Scientific, Inc.), CAM191 cells were grown in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.), and 293T/17 cells were grown in DMEM (Gibco; Thermo Fisher Scientific, Inc.). All media were supplemented with 100 U/ml penicillin, 0.1 mg/ml streptomycin and 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.). The cells were incubated at 37°C in a humidified atmosphere containing 5% CO2 and were used for experiments in the logarithmic growth phase.

Reagents

VP16, imatinib and the CHK1 inhibitor CCT245737 were obtained from Selleckchem (USA) and dissolved in DMSO (Sigma-Aldrich; Merck KGaA) for the in vitro studies. In the shRNA-mediated CHK1 knockdown study, cells were seeded at 105/ml and then treated with 5 µM VP16 for 4.5 h to induce DNA double-strand breaks (DSBs). After incubation, the cells were washed with PBS and maintained in IMDM for 48 h to allow the repair of VP16-induced DSBs before further analysis (28,29). In the imatinib experiments, K562 cells were seeded at 105/ml and then treated with 1 µM imatinib for 24 h. After incubation, live cells were acquired by washing with PBS and incubated for another 24 h, and then, the cells were collected for subsequent experiments. In most CCT245737-induced CHK1 inhibition studies, in order to induce sustained DNA damage in cells and detect the role of CCT245737 on CHK1 activation more efficiently and to promote this pharmacological combination approach in the clinic more conveniently in the future, cells were treated with VP16 (5 µM) and CCT245737 (500 nM) either alone or in combination at the density of 105/ml for 24 h as in previous research (22). Before further analysis, cells were washed with PBS. Primary antibodies against pSer296 CHK1 (cat. no. 2349), pSer317 CHK1 (cat. no. 2344), pSer345 CHK1 (cat. no. 2341), total CHK1 (cat. no. 2360), total H2AX (cat. no. 7631), pSer139 H2AX (cat. no. 9718), cleaved-PARP (cat. no. 5625), total H3 (cat. no. 4499), pSer10 H3 (cat. no. 53348), pSer216 CDC25c (cat. no. 4901), total CDK1 (cat. no. 9116), pTyr15CDK1 (cat. no. 4539), Rad51 (cat. no. 8875), Rad50 (cat. no. 3427), BRCA1 (cat. no. 9010) and GAPDH (cat. no. 2118) were purchased from Cell Signaling Technology, and antibodies against total CDC25c (product code 32444), MRE11 (product code 208020), Ku70 (product code 92450), Ku80 (product code 80592) and Lig4 (product code 193353) were purchased from Abcam.

RNAi-mediated gene knockdown

The shRNA sequence GCAACAGTATTTCGGTATAAT was used to knock down CHK1 (shCHK1-KD), whereas the sequence GCGCGCTTTGTAGGATTCG, which is unrelated to any sequence in humans, served as a negative control (shRNA-NC). The pLVX-shRNA vector system containing either a puromycin resistance cassette or ZsGreen (Clontech Laboratories) was used to carry these sequences. In addition to shRNA-NC, the empty pLVX-shRNA vector was also used as a control (shRNA-Vector). To produce lentiviral particles, all of these plasmids (with two packaging plasmids at a ratio of 4:3:2) were cotransfected into 293T/17 cells via the calcium phosphate precipitation method. Viral infection was performed with 10 µg/ml polybrene, and GFP expression in cells was observed by a fluorescence microscope after 48–72 h. After positive cells were sorted, qPCR and western blotting were performed to detect the knockdown efficiency. Cells with significant target gene knockdown were used for subsequent experiments.

RNA extraction and qPCR

Total RNA was extracted with a MiniBEST Universal RNA Extraction Kit (Takara), and cDNA was produced by the PrimeScript RT Master Mix (Takara). The TB Green Premix Ex Taq™ II (Tli RNaseH Plus) Kit (Takara) was used to detect relative mRNA expression by LightCycler 96 system (Roche) with 40 cycles of PCR thermocycling. The primer sequences were as follows: β-actin forward, 5′-GGATTCCTATGTGGGCGACGA−3′ and reverse, 5′-GCGTACAGGGATAGCACAGC-3′; CHK1 forward, 5′-CCAGATGCTCAGAGATTCTTCCA-3′ and reverse, 5′-TGTTCAACAAACGCTCACGATTA-3′. The mRNA expression of the target gene relative to β-actin expression was calculated by the 2−ΔΔCq method (30).

Protein extraction and western blotting

Cells were harvested and lysed in RIPA lysis buffer (Thermo Fisher Scientific, Inc.) containing protease and phosphatase inhibitors (Epizyme Scientific, China). Lysates were centrifuged to obtain protein extracts for western blotting. The BCA method (Beyotime Institute of Biotechnology) was used to detect the protein concentration. SDS-PAGE gels (10% gel) (Epizyme, China) were used for protein electrophoresis (20–40 µg per sample), and the separated proteins were transferred to PVDF membranes (Millipore). Next, the membranes were blocked in 5% nonfat milk for 2 h at room temperature and washed 3 times with TBS-T. Then, the membranes were incubated with specific primary antibodies at the dilution of 1:1,000, at 4°C overnight. On the next day, the membranes were washed and then incubated for 2 h at room temperature with HRP-conjugated anti-rabbit or anti-mouse secondary antibodies at the dilution of 1:1,000 (cat. nos. 7074 and 7076; both from Cell Signaling Technology). Protein bands were detected after incubation with ECL solution (Thermo Fisher Scientific, Inc.) for 2 min in the dark. GAPDH served as a loading control and the densitometry of band intensities were detected by Amersham Imager 600 (GE Healthcare).

Cell cycle distribution analysis

After the cells were washed twice and collected in 100 µl prechilled PBS, they were fixed with 95% ethanol overnight at 4°C. The next day, the cells were collected and washed once with prechilled PBS before they were treated with FxCycle PI/RNase Staining Solution (Invitrogen; Thermo Fisher Scientific, Inc.). The cell cycle distribution was determined by a Flow cytometer (BD Biosciences) and analyzed by ModFit LT 3.2 (Verity Software House).

Alkaline comet assay

The cells were washed twice with prechilled PBS and diluted to 1.5×105/ml. The comet assay was performed using CometAssay HT kits (Trevigen). Aliquots of 50 µl of cells (7,500 cells total) were mixed with 500 µl of LM-Agarose and rapidly pipetted over the entire sample area of comet slides, which were then placed at 4°C for 30–45 min in the dark. After the agarose solidified, the slides were immersed in ice-cold lysis solution for 2 h at 4°C in the dark. Excess buffer was drained after lysis, and the slides were immersed in freshly prepared alkaline unwinding solution for 30 min at room temperature in the dark. The slides were placed in an electrophoresis slide tray, covered with slide tray overlay and electrophoresed at 21 V for 25 min. After electrophoresis, the slides were washed twice with deionized water, immersed in 70% ethanol for 10 min in the dark, and placed in a drying oven for 30 min to remove excess buffer. SYBR Gold was pipetted onto each sample, and the slides were incubated for 30 min at room temperature in the dark. Images were collected by an Olympus microscope and charge-coupled device (CCD) camera at a final magnification of ×200. The tail moment was analyzed using the Comet Assay Software Project 4 (CASP 4; Perspective Instruments, Ltd.) as an indicator of DNA damage.

Colony formation assay

K562 cells were seeded evenly at 200 cells/well in 24-well plates. A two-layer soft agarose assay was performed with 0.6% agarose as the bottom layer and 0.3% agarose as the top layer. After the cells were seeded, 100 µl of culture medium was added to each well every 2 days. After 10 days, colony number and size were analyzed, and representative images were captured by microscope (Nikon) and charge-coupled device (CCD) camera.

CCK-8 assay

Cells were seeded in 96-well plates and treated as indicated. Then, 10 µl of CCK-8 reagent (Dojindo) was added to each well, and the plates were incubated for 2 h at 37°C in the dark. The absorbance at 450 nm was detected by a SpectraMax microplate reader (Molecular Devices). The combination index (CI) between CCT245737 and VP16 was calculated through Chou-Talalay method by CompuSyn software (CompuSyn Inc., USA).

Statistical analysis

All statistical analyses were performed using GraphPad Prism 6.0 (GraphPad Software, Inc.). Data are presented as the mean ± standard deviation. All quantitative experiments were conducted with a minimum of three independent experiments. An unpaired two-tailed t test or one-way ANOVA followed by Turkey, Dunnett-T3 or Dunnett post-doc test was used as appropriate to determine statistical significance (*P<0.05, **P<0.01, and ***P<0.001). Statistical analyses were performed with IBM SPSS Statistics 19.0 (SPSS Inc., USA) and GraphPad Prism 7 (GraphPad Software, USA).

Results

CHK1 displays higher expression in K562 cells

The KCL22 and K562 cell lines are the two most common CML cell lines used in experiments. To determine CHK1 mRNA levels in these two cell lines, we performed qPCR with CAM-191 cells as a control as they have the lowest CHK1 mRNA expression of the three cell lines tested (the dotted line). As shown in Fig. 1A, CHK1 mRNA expression was significantly higher in K562 cells than in KCL22 cells. Consistently, western blot analysis demonstrated that CHK1 protein expression was also significantly higher in K562 cells than in KCL22 cells (Fig. 1B and C). Thus, K562 cells were selected for the subsequent experiments.
Figure 1.

CHK1 expression is higher in K562 cells. (A) CHK1 mRNA levels relative to β-actin (loading control) levels in KCL22 and K562 cells were detected by qPCR, CAM-191 cells were used as the control group which is shown as a dotted line. (B) Western blot analysis of CHK1 protein levels in KCL22 and K562 cells. (C) Relative quantification of CHK1 expression normalized to GAPDH expression based on densitometric analysis of the band intensities shown in B (***P<0.001) comparison between KCL22 and K562 cells. CHK1, checkpoint kinase 1.

shRNA-mediated CHK1 knockdown efficiently suppresses cell proliferation

To determine the role of CHK1 in K562 cell proliferation, we transduced K562 cells with lentiviral vectors containing shRNA specifically targeting CHK1 (shCHK1-KD), a negative control sequence (shRNA-NC) or an empty pLVX-shRNA vector (shRNA-Vector). shCHK1-KD significantly reduced CHK1 expression at both the mRNA and protein levels (Fig. 2A and B). Compared with shRNA-NC and shRNA-Vector, shCHK1-KD significantly suppressed K562 cell proliferation (Fig. 2C). Thus, CHK1 is a potential target for the treatment of CML.
Figure 2.

shRNA-mediated CHK1 knockdown efficiently suppresses cell proliferation. (A) CHK1 mRNA levels relative to β-actin (loading control) levels in K562 cells infected with three different lentiviruses (shVector, shNC and shKD) as detected by qPCR. (B) Western blotting was performed to confirm that shCHK1 (shKD) efficiently knocked down CHK1 protein expression in K562 cells. (C) Cell viability on different days was examined by CCK-8 assays after Chk1 knockdown (shKD). The OD450 nm values were measured and plotted with respect to time (*P<0.05, **P<0.01). CHK1, checkpoint kinase 1. shKD, Chk1-knockdown cells.

CHK1 knockdown enhances the cytotoxicity of VP16 in K562 cells

To investigate whether silencing CHK1 increases the cytotoxicity of VP16 in K562 cells, K562 cells were transduced with shCHK1-KD, shRNA-NC or shRNA-Vector and then treated with 5 µM VP16; we then analyzed DSBs, apoptosis and colony formation. First, we investigated the level of phosphorylated H2AXH2AX), a protein marker of DSBs. The results demonstrated that CHK1 knockdown increased γH2AX levels compared to the two controls, especially when combined with VP16 treatment (Fig. 3A). Subsequently, we performed comet assays and analyzed different parameters using CASP. The Olive Tail Moment (OTM) was used to describe the level of DNA damage in cells. Similar to the change in γH2AX accumulation, the comet assay showed that CHK1 knockdown slightly, but not obviously, increased OTM values under both normal growth and DMSO treatment conditions. However, after VP16 treatment, the CHK1 knockdown group exhibited a significant increase in DNA damage (Fig. 3B and C). These results revealed that CHK1 knockdown can increase VP16-induced DNA damage in K562 cells. Next, as shown in Fig. 3D, CHK1 knockdown did not significantly increase the expression of cleaved poly(ADP-ribose) polymerase (c-PARP), an apoptosis marker, under either normal growth or DMSO treatment conditions. However, after incubation with VP16, cells with CHK1 knockdown showed distinctly increased levels of c-PARP, which indicates elevated levels of apoptosis. Furthermore, we performed colony formation assays to determine the role of CHK1 in cell proliferation. Silencing of CHK1 was associated with a significant decrease in colony formation ability under all conditions, regardless of the presence of VP16 (Fig. 3E and F). These results suggest that downregulation of CHK1 enhances the cytotoxic effect of VP16 on K562 cells.
Figure 3.

CHK1 knockdown enhances the cytotoxicity of VP16 in K562 cells. (A) Western blot analysis of the expression of the DSB marker γH2AX and total H2AX. (B) An alkaline comet assay was performed using cells transduced with shVector, shNC, or shCHK1 (shKD) under normal conditions (CON) or after treatment with DMSO or VP16 to assess the level of DNA damage. CHK1 silencing by shRNA enhanced the induction of DNA damage by VP16. (C) Graphical presentation of the tail moment in the alkaline comet assay described in B (***P<0.001). (D) Western blot analysis of cleaved PARP (c-PARP), an apoptosis marker. shRNA-mediated CHK1 inhibition significantly increased VP16-induced apoptosis. (E) A colony formation assay was performed in K562 cells infected with three different lentiviruses under normal conditions (CON) and after treatment with DMSO or VP16. (F) Graphical presentation of the number of colonies described in E (**P<0.01, ***P<0.001). NS, not significant; CHK1, checkpoint kinase 1; DSB, double-strand break; VP16, etoposide.

shRNA-mediated CHK1 knockdown reduces G2/M arrest and HR repair in K562 cells

Accurate and timely DNA damage repair is vital for cells to survive chemotherapy-induced DNA damage. As we showed that CHK1 knockdown sensitized K562 cells to VP16, we aimed to ascertain whether CHK1 knockdown impairs the DNA damage repair pathway in K562 cells. First, we analyzed the cell cycle distribution in the shRNA-NC and shCHK1-KD groups and found that CHK1 knockdown eliminated G2/M arrest under both conditions, especially following VP16 treatment (Fig. 4A and B). Consistent with the cell cycle distribution results, VP16 treatment increased the levels of the G2/M arrest markers pS216 CDC25c and pY15 CDK1, and shRNA-mediated CHK1 knockdown suppressed the induction of pS216 CDC25c and pY15 CDK1 by VP16 (Fig. 4C). Moreover, CHK1 knockdown reversed the VP16-induced decrease in the levels of the mitotic marker pS10 H3 (Fig. 4D). These results indicate that shRNA-mediated CHK1 knockdown mitigates chemotherapy-induced G2/M arrest and forces cells to enter mitosis with unrepaired DNA damage. HR and non-homologous end joining (NHEJ) are two major pathways for repairing damaged DNA. Although a previous study showed that CHK1 is required for the HR repair pathway (17), the detailed mechanism is still unclear. Here, we examined the expression of proteins related to NHEJ and HR to determine which pathway is affected by CHK1 silencing. CHK1 knockdown had no impact on the expression of the NHEJ-related proteins Ku70/80 and ligase 4 (Lig4) (Fig. 4E and F). In contrast, the HR pathway was impaired based on the suppression of VP16-induced BRCA1 elevation, which represents the location capacity of Rad51 to DNA damage loci. However, shRNA-mediated CHK1 ablation had no direct influence on the VP16-mediated induction of the HR-related proteins MRE11, Rad50 and Rad51 (Fig. 4G and H). Taken together, the results showed that CHK1 knockdown abolishes G2/M arrest and reduces the efficiency of HR repair; thus, knockdown cells are forced to enter mitosis with unrepaired DNA damage.
Figure 4.

shRNA-mediated CHK1 knockdown reduces G2/M arrest and HR repair in K562 cells. (A) The cell cycle distribution of K562 cells transduced with shNC or shCHK1 (shKD) was detected following treatment with DMSO (control) or VP16. (B) Statistical analysis of the G2/M phase percentages (%) shown in A (*P<0.05, **P<0.01). (C) Western blot analysis of the G2/M arrest markers pS216CDC25c, pY15CDK1 and total CDC25c and CDK1 in K562 cells infected with lentivirus carrying shVector, shNC or shCHK1 (shKD) under normal conditions and in the presence of DMSO or VP16. (D) Western blot analysis of the mitotic marker pS10-H3 and total H3 in K562 cells infected with lentivirus carrying shVector, shNC or shCHK1 (shKD) under normal conditions and in the presence of DMSO or VP16. (E) Western blot analysis of the NHEJ pathway-related proteins Ku70, Ku80 and ligase 4 (Lig4) in shVector-, shNC-, or shCHK1-transduced (shKD) K562 cells under normal conditions and after treatment with DMSO or VP16. (F) Relative quantification of Ku70 (a), Ku80 (b) and Lig4 (c) expression shown in E by densitometric analysis; target band intensity was normalized to that of GAPDH. (G) Western blot analysis of the HR pathway-related proteins BRCA1, Rad50, MRE11 and Rad51 in shVector-, shNC-, or shCHK1-transduced (shKD) K562 cells under normal conditions and after treatment with DMSO or VP16. (H) Relative quantification of BRCA1 (a), Rad50 (b), MRE11 (c) and Rad51 (d) expression shown in G by densitometric analysis; band intensity was normalized to that of GAPDH (*P<0.05). NS, not significant. CHK1, checkpoint kinase 1; HR, homologous recombination; VP16, etoposide.

CCT245737 efficiently inhibits CHK1 phosphorylation and promotes the accumulation of DNA damage

CCT245737 is a potent CHK1 inhibitor with good oral bioavailability. As shown in a previous study (26,27), CCT245737 is a selective CHK1 inhibitor with a half maximal inhibitory concentration (IC50) value of 1.4±0.3 nM and >1,000-fold selectivity over CHK2 and CDK1. To confirm the ability of CCT245737 in inhibiting CHK1, we first analyzed total CHK1 protein expression in cells treated with different concentrations of CCT245737. As shown in Fig. 5A and B, increasing concentrations of CCT245737 did not significantly decrease total CHK1 protein levels, and CHK1 was inhibited at only a high concentration of CCT245737 (5 µM). Then, we treated K562 cells with VP16 and increasing concentrations of CCT245737 alone or in combination to investigate whether CCT245737 influences phosphorylated CHK1 levels. VP16 obviously induced CHK1 autophosphorylation at Ser296 and phosphorylation at Ser317 and Ser345 (Fig. 5C). In the presence of CCT245737, VP16-induced Ser296 autophosphorylation was dramatically suppressed at 0.05 µM and completely eliminated at 0.5 µM. In contrast, the influence of CCT245737 on other CHK1 phosphorylation sites (Ser317 and Ser345) and total CHK1 levels was minimal. Meanwhile, the inhibition of CHK1 autophosphorylation at Ser296 coincided with the accumulation of γH2AX. Therefore, these results suggest that CCT245737 can efficiently inhibit the activation of CHK1 by suppressing VP16-induced CHK1 autophosphorylation at Ser296 and promoting the accumulation of DNA damage in VP16-treated K562 cells.
Figure 5.

Characterization of the effects of CCT245737 on the VP16-induced changes in the levels of CHK1 and DNA damage biomarkers in K562 cells. (A) Western blot analysis of total CHK1 expression in K562 cells after treatment with increasing concentrations of CCT245737 for 24 h. (B) Relative quantification of total CHK1 expression shown in A by densitometric analysis; band intensity was normalized to that of GAPDH (*P<0.05). (C) Western blot analysis of K562 cells treated with VP16 (5 µM), CCT245737 (5 µM) or the combination of VP16 and increasing concentrations of CCT245737. CHK1 autophosphorylation at Ser296 and phosphorylation at Ser317 and Ser345 were used as biomarkers of CHK1 activity, and γH2AX was used as a biomarker of DNA damage. NS, not significant. CHK1, checkpoint kinase 1; VP16, etoposide.

CCT245737 sensitizes K562 cells to VP16

To determine the cytotoxicity of CCT245737, K562 cells were treated with increasing concentrations of CCT245737 for 24 h, and cell viability was measured by CCK-8 assays. Our results showed that K562 cell viability was significantly reduced by CCT245737 in a dose-dependent manner (Fig. 6A). Furthermore, we demonstrated that CCT245737 and VP16 had a synergistic effect on the viability of both K562 and imatinib-treated K562 cells (K562-IM), with a CI of 0.35 and 0.15 at a 50% effective dose (ED50) as calculated by the Chou-Talalay analysis (Fig. 6B and C) (31). To clarify that this drug combination is specific for cancer cells, we performed the same experiment with a normal human lymphocyte cell line, CAM191. CCT245737 showed weak synergism with VP16 in CAM191 cells compared with vehicle- and imatinib-treated K562 cells, with a CI of 0.93 at the ED50 (Fig. 6D). Moreover, consistent with the γH2AX accumulation shown in Fig. 4C, comet assays demonstrated that CCT245737 obviously increased the level of VP16-induced DNA damage (Fig. 6E and F). Furthermore, the increased c-PARP levels in the combination treatment group suggested the upregulation of apoptosis (Fig. 6G). These data revealed that CCT245737 may have a considerable and specific synergistic anticancer effect with VP16 in K562 cells treated with or without imatinib.
Figure 6.

CCT245737 sensitizes K562 cells to VP16. (A) Graphical presentation of the % viability of K562 cells after treatment with increasing concentrations of CCT245737 for 24 h. (B) Graphical presentation of (a) the % viability and (b) the Fa-CI after Chou-Talalay analysis of K562 cells after treatment with the indicated drugs for 24 h. (C) Graphical presentation of (a) the % viability and (b) the Fa-CI after Chou-Talalay analysis of imatinib-treated K562 (K562-IM) cells after treatment with the indicated drugs for 24 h. (D) Graphical presentation of (a) the % viability and (b) the Fa-CI after Chou-Talalay analysis of CAM191 cells after treatment with the indicated drugs for 24 h. (E) An alkaline comet assay was performed to assess the extent of DNA damage in K562 cells treated with CCT245737 (500 nM) and/or VP16 (5 µM) for 24 h. (F) Graphical presentation of the tail moment in the alkaline comet assay described in E (***P<0.001). (G) Western blot analysis of the apoptotic marker cleaved PARP in K562 cells treated with CCT245737 (500 nM) and/or VP16 (5 µM) for 24 h. The combination of VP16 with CCT245737 increased the levels of c-PARP. NS, not significant; VP16, etoposide; c-PARP, cleaved poly(ADP-ribose) polymerase.

CCT245737 abrogates G2/M arrest and reduces HR repair capacity in K562 cells

To elucidate the mechanism of the anticancer synergy between CCT245737 and VP16 in leukemia cells, we first analyzed the cell cycle distribution. CCT245737 abolished G2/M arrest in K562 cells under normal conditions and after acute VP16 exposure (5 µM for 1.5 h) (Fig. 7A and B). The western blot results showed that CCT245737 efficiently reduced the VP16-induced increases in the G2/M arrest markers pS216 CDC25c and pY15 CDK1 (Fig. 7C). Moreover, the VP16-induced decrease in the mitotic marker pS10 H3 was rescued by CCT245737 (Fig. 7D). Next, the expression of critical proteins related to the NHEJ and HR pathways was investigated to elucidate the potential mechanism by which CCT245737 enhances chemosensitivity. Consistent with the results of shRNA-induced CHK1 silencing, CCT245737 had no obvious impact on NHEJ-related protein expression (Fig. 7E and F). However, in contrast to the results of the shCHK1-KD experiments, the induction of both Rad51 and BRCA1 by VP16 was markedly suppressed by CCT245737 (Fig. 7G and H). This result indicates that CCT245737 does not only reduce the local availability of Rad51 but also directly suppresses Rad51 expression after DSBs. Due to the results above, BRCA1 and Rad51 were chosen to be the most important proteins involved in CHK1-related DNA damage repair pathway in K562 wild-type (K562-WT) cells. Thus, we prioritized the Rad51 and BRCA1 expression in imatinib-treated K562 (K562-IM) cells over other assays to certify that CHK1 inhibition by CCT245737 could also suppress HR efficiency in K562-IM cells through downregulating these two proteins expression and similar results were obtained in K562-IM cells. Compared with K562-WT cells, K562 cells pretreated with imatinib showed a nonsignificant VP16-induced increase in Rad51 and BRCA1 expression, perhaps because this pretreatment could induce abundant Rad51 and BRCA1 expression in these cells. CCT245737 also obviously inhibited Rad51 and BRCA1 expression in imatinib-treated K562 cells, indicating that CCT245737 can also effectively suppress HR efficiency in TKI-treated CML cells (Fig. 7I and J). In conclusion, these results suggest that CCT245737 can abolish the VP16-induced activation of the G2/M checkpoint, efficiently inhibit the HR repair pathway, and promote the progression of cells with unrepaired DNA damage into mitosis.
Figure 7.

CCT245737 abrogates G2/M arrest and reduces HR repair capacity in K562 cells. (A) Effects of CCT245737 (500 nM, 24 h) on cell cycle arrest in K562 cells treated with acute VP16 (5 µM, 1.5 h). (B) Statistical analysis of the G2/M phase percentage (%) described in A (**P<0.01, ***P<0.001). (C) Western blot analysis of the G2/M arrest markers pS216CDC25c, pY15CDK1 and total CDC25c and CDK1 in K562 cells treated with CCT245737 (500 nM) and/or VP16 (5 µM) for 24 h. (D) Western blot analysis of the mitosis marker pS10-H3 and total H3 in K562 cells treated with CCT245737 (500 nM) and/or VP16 (5 µM) for 24 h. (E) Western blot analysis of the NHEJ pathway-related proteins Ku70, Ku80 and ligase 4 (Lig4) in K562 cells treated with CCT245737 (500 nM) and/or VP16 (5 µM) for 24 h. (F) Relative quantification of Ku70 (a), Ku80 (b) and Lig4 (c) expression shown in E by densitometric analysis of band intensities normalized to those of GAPDH. (G) Western blot analysis of the HR pathway-related proteins BRCA1, Rad50, MRE11 and Rad51 in K562 cells treated with CCT245737 (500 nM) and/or VP16 (5 µM) for 24 h. (H) Relative quantification of BRCA1 (a), Rad50 (b), MRE11 (c) and Rad51 (d) expression shown in G by densitometric analysis of band intensities normalized to those of GAPDH (*P<0.05). (I) Western blot analysis of BRCA1 and Rad51 protein expression in imatinib-treated K562 cells after exposure to CCT245737 (500 nM) and/or VP16 (5 µM) for 24 h. (J) Relative quantification of Rad51 (a) and BRCA1 (b) expression shown in I by densitometric analysis of band intensities normalized to those of GAPDH (*P<0.05, **P<0.01, ***P<0.001). NS, not significant; HR, homologous recombination; CHK1, checkpoint kinase 1; VP16, etoposide.

Discussion

Although the development of various chemotherapeutic drugs has greatly improved cancer therapy, there remain patients who are resistant to certain therapies. Due to the critical role of the DNA damage response (DDR) in chemotherapy resistance, blocking this pathway has emerged as a new approach to address this problem. Checkpoint kinase 1 (CHK1), a well-known cell cycle checkpoint protein, is associated with the DDR pathway, especially in p53-mutant cells, which account for a large subset of cancer cells (6,32). CHK1 is involved in not only cell cycle regulation but also the homologous recombination (HR) pathway through direct or indirect regulation of Rad51 (Fig. 8). Thus, CHK1 is potentially an ideal candidate for the treatment of chemotherapy-resistant cancer.
Figure 8.

Schematic model of the CHK1-mediated regulation of the G2/M cell cycle checkpoint and HR repair pathway. BRCA1, breast cancer gene susceptibility 1; BARD1, BRCA1-associated ring domain protein 1; CDC25c, cell division cyclin 25 homolog C; CDK1, cyclin dependent kinase 1; CHK1, checkpoint kinase 1; Lig4, ligase 4.

CCT245737, a selective CHK1 inhibitor with greater than 1,000-fold selectivity over CHK2 and CDK1, has an oral bioavailability nearly 100% (26). The present study demonstrated that CCT245737 suppressed CHK1 activation by abolishing autophosphorylation at Ser296 but had a minimal impact on Ser317 and Ser345 phosphorylation or total CHK1 levels. As pSer317 CHK1 and pSer345 CHK1 levels are influenced by the levels of DNA damage and PP2A phosphatase activity, we utilized pSer296 CHK1 as a specific biomarker of CHK1 activity, consistent with previous studies (19,33). Therefore, CCT245737 could be considered a candidate CHK1 inhibitor to enhance the efficacy of chemotherapy. In the present study, we first downregulated CHK1 expression in CML cells with shRNA and found that CHK1 silencing significantly increased DNA damage, promoted apoptosis, and reduced the proliferation and colony formation of cells. Subsequently, CCT245737 was shown to have a favorable and specific synergistic effect with VP16 in CML cells. To uncover the potential mechanism, we performed related experiments to investigate the influence of CHK1 inhibition on the cell cycle and the DNA damage repair pathway. VP16, a DNA topoisomerase II (TOP2) inhibitor that can induce and stabilize DNA double-strand breaks (DSBs) by disrupting the TOP2 catalytic cycle at the DNA ligation step, is commonly included in anticancer therapy regimens (34). A previous study showed that VP16-mediated DSBs induce G2/M arrest by activating the G2/M cell cycle checkpoint to repair DNA damage (35). In our study, we revealed that both RNAi-mediated CHK1 silencing and CCT245737 efficiently abolished the VP16-induced activation of the G2/M cell cycle checkpoint, eliminating the time necessary for DNA repair by overruling the G2/M arrest. Hence, cells may enter mitosis with accumulated unrepaired damage. Non-homologous end joining (NHEJ) and HR are the two major mechanisms for repairing DSBs (36). NHEJ can occur during almost the whole cell cycle, while HR only occurs in S/G2 phase after DNA replication. In NHEJ repair, DSB ends are resected by various endonucleases or exonucleases to generate a microhomology sequence (<4 nucleotides) (37). Then, Ku70 and Ku80 heterodimers (Ku70/80) recognize and bind DSBs to recruit nucleases, ligases, and polymerases, such as DNA ligase IV, to repair the breaks. We discovered that neither shRNA-mediated CHK1 knockdown nor CCT245737 significantly impacted the expression of Ku70/80 or DNA ligase IV, which indicated that the NHEJ repair pathway might not be influenced by CHK1 inhibition. In contrast to NHEJ, which evokes error-prone repair, HR repair is a more precise method of repairing DNA damage. Once DSBs occur, the Mre11-Nbs1-Rad50 (MRN) complex converts the DSB ends into single-strand DNA (ssDNA). Subsequently, a key component of the HR pathway, Rad51, is recruited to replication protein A (RPA)-coated single-strand breaks (SSBs) and induces D-loop formation to repair the breaks. BRCA1 is involved in various biological processes, including mRNA splicing (38), DNA damage signaling (39) and HR repair (40,41). BRCA1 can form a stable complex with BRCA1-associated ring domain protein 1 (BARD1) (42), and one study showed that it coimmunoprecipitates with Rad51 (43). A more recent report indicated that the BRCA1-BARD1 complex can directly interact with human Rad51, enhance the affinity of Rad51 for DNA damage loci and facilitate D-loop formation (44). In our study, shRNA-mediated Chk1 silencing markedly inhibited BRCA1 expression but not MRE11, Rad50 and Rad51 expression after VP16 treatment. Thus, shRNA-mediated CHK1 downregulation may suppress HR repair efficiency by reducing BRCA1-induced Rad51 localization and D-loop formation rather than by directly repressing Rad51 expression. However, in contrast to shRNA-mediated CHK1 inhibition, which only suppressed BRCA1 induction by VP16, CCT245737 considerably decreased the VP16-induced increases in both Rad51 and BRCA1 levels. A similar result was also found in imatinib-treated K562 cells. These results demonstrate that CCT245737 might block the HR pathway by both directly suppressing Rad51 expression and indirectly inhibiting the BRCA1-mediated localization of Rad51 at DNA damage and D-loop formation. These results are consistent with those of a recent study, which found that prexasertib, another selective CHK1 inhibitor, suppressed Rad51 and BRCA1 expression in triple-negative breast cancer cells by promoting ubiquitin-mediated proteasome degradation, but RNAi-induced CHK1 downregulation only affected the focus-forming capacity of Rad51 (45). However, the detailed mechanism by which CCT245737 inhibits Rad51 and BRCA1 expression in CML cells and whether these effects depend on the timing of drug administration remain to be determined in subsequent experiments. Based on the CCK-8 and western blot results in K562-IM cells, we speculated that imatinib (IM) may force K562 cells into a stress state which helped cells to be more resistant to other pharmacological stimulation. Therefore, a more in-depth comparison of the pharmacological combination of CCT245737 and VP16 between K562-WT and K562-IM cells in terms of DNA damage repair would also be investigated in our future research. In addition to the critical role of CHK1 in the cell cycle and DNA damage repair pathway, a recent study revealed that a CHK1 inhibitor can also trigger Bcr-Abl protein degradation in CML (46). This is another potential mechanism by which targeting CHK1 could functionally treat CML. In conclusion, CHK1 is a promising target for the development of CML therapies. CHK1 inhibition can efficiently impair DSB-mediated cell cycle arrest and the HR repair pathway. Therefore, the lack of time and capacity to repair DNA damage after CHK1 inhibition will induce greater accumulation of DNA damage and increase apoptosis, resulting in reductions in proliferation and colony formation. Furthermore, CCT245737 is potentially an ideal candidate CHK1 inhibitor that demonstrates dramatic and specific synergism with VP16 in both wild-type and IM-treated K562 cells. These results provide convincing evidence to promote this strategy in future clinical regimens for CML or even TKI-resistant CML.
  46 in total

1.  SIRT1 downregulation enhances chemosensitivity and survival of adult T-cell leukemia-lymphoma cells by reducing DNA double-strand repair.

Authors:  Liang Li; Shiguang Ye; Meng Yang; Wenlei Yu; Zhuoyi Fan; Hong Zhang; Jiong Hu; Aibin Liang; Wenjun Zhang
Journal:  Oncol Rep       Date:  2015-09-18       Impact factor: 3.906

2.  Checkpoint kinase 1 (Chk1) is required for mitotic progression through negative regulation of polo-like kinase 1 (Plk1).

Authors:  Jiabin Tang; Raymond L Erikson; Xiaoqi Liu
Journal:  Proc Natl Acad Sci U S A       Date:  2006-07-27       Impact factor: 11.205

3.  Assessment of chk1 phosphorylation as a pharmacodynamic biomarker of chk1 inhibition.

Authors:  Leslie A Parsels; Yushen Qian; Daria M Tanska; Marisa Gross; Lili Zhao; Maria C Hassan; Sankari Arumugarajah; Joshua D Parsels; Linda Hylander-Gans; Diane M Simeone; Deborah Morosini; Jeffrey L Brown; Sonya D Zabludoff; Jonathan Maybaum; Theodore S Lawrence; Meredith A Morgan
Journal:  Clin Cancer Res       Date:  2011-04-11       Impact factor: 12.531

4.  Brca1 controls homology-directed DNA repair.

Authors:  M E Moynahan; J W Chiu; B H Koller; M Jasin
Journal:  Mol Cell       Date:  1999-10       Impact factor: 17.970

5.  Association of BRCA1 with Rad51 in mitotic and meiotic cells.

Authors:  R Scully; J Chen; A Plug; Y Xiao; D Weaver; J Feunteun; T Ashley; D M Livingston
Journal:  Cell       Date:  1997-01-24       Impact factor: 41.582

6.  Management of imatinib-resistant patients with chronic myeloid leukemia.

Authors:  Pavan Kumar Bhamidipati; Hagop Kantarjian; Jorge Cortes; A Megan Cornelison; Elias Jabbour
Journal:  Ther Adv Hematol       Date:  2013-04

Review 7.  Checkpoint kinase 1 in DNA damage response and cell cycle regulation.

Authors:  Mallikarjun Patil; Navjotsingh Pabla; Zheng Dong
Journal:  Cell Mol Life Sci       Date:  2013-03-19       Impact factor: 9.261

8.  BRCA1-BARD1 promotes RAD51-mediated homologous DNA pairing.

Authors:  Weixing Zhao; Justin B Steinfeld; Fengshan Liang; Xiaoyong Chen; David G Maranon; Chu Jian Ma; Youngho Kwon; Timsi Rao; Weibin Wang; Chen Sheng; Xuemei Song; Yanhong Deng; Judit Jimenez-Sainz; Lucy Lu; Ryan B Jensen; Yong Xiong; Gary M Kupfer; Claudia Wiese; Eric C Greene; Patrick Sung
Journal:  Nature       Date:  2017-10-04       Impact factor: 49.962

Review 9.  Selective targeting of the G2/M cell cycle checkpoint to improve the therapeutic index of radiotherapy.

Authors:  M T Dillon; J S Good; K J Harrington
Journal:  Clin Oncol (R Coll Radiol)       Date:  2014-02-26       Impact factor: 4.126

Review 10.  Type II DNA Topoisomerases Cause Spontaneous Double-Strand Breaks in Genomic DNA.

Authors:  Suguru Morimoto; Masataka Tsuda; Heeyoun Bunch; Hiroyuki Sasanuma; Caroline Austin; Shunichi Takeda
Journal:  Genes (Basel)       Date:  2019-10-30       Impact factor: 4.096

View more
  2 in total

1.  [Cell Cycle Checkpoint Kinase and Drug Resistance of Lung Cancer].

Authors:  Zhiyin Ke; Ailing Liang; Yongjun Liu
Journal:  Zhongguo Fei Ai Za Zhi       Date:  2021-04-20

2.  TRIB2 regulates the expression of miR‑33a‑5p through the ERK/c‑Fos pathway to affect the imatinib resistance of chronic myeloid leukemia cells.

Authors:  Hang Sun; Youjie Li; Xiao Wang; Xue Zhou; Simin Rong; Dongmin Liang; Guangbin Sun; Huizhen Cao; Hongfang Sun; Ranran Wang; Yunfei Yan; Shuyang Xie; Yunxiao Sun
Journal:  Int J Oncol       Date:  2022-03-18       Impact factor: 5.650

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.