Literature DB >> 32898162

Identification of a homology-independent linchpin domain controlling mouse and bank vole prion protein conversion.

Cassandra M Burke1, Kenneth M K Mark1, Daniel J Walsh1, Geoffrey P Noble1, Alexander D Steele1, Abigail B Diack2, Jean C Manson2, Joel C Watts3, Surachai Supattapone1,4.   

Abstract

<span class="Species">Prions are unorthodox pathogens that cause fatal neurodegenerative diseases in humans and other mammals. Prion propagation occurs through the self-templating of the pathogenic conformer PrPSc, onto the cell-expressed conformer, PrPC. Here we study the conversion of PrPC to PrPSc using a recombinant mouse PrPSc conformer (mouse protein-only recPrPSc) as a unique tool that can convert bank vole but not mouse PrPC substrates in vitro. Thus, its templating ability is not dependent on sequence homology with the substrate. In the present study, we used chimeric bank vole/mouse PrPC substrates to systematically determine the domain that allows for conversion by Mo protein-only recPrPSc. Our results show that that either the presence of the bank vole amino acid residues E227 and S230 or the absence of the second N-linked glycan are sufficient to allow PrPC substrates to be converted by Mo protein-only recPrPSc and several native infectious prion strains. We propose that residues 227 and 230 and the second glycan are part of a C-terminal domain that acts as a linchpin for bank vole and mouse prion conversion.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32898162      PMCID: PMC7508373          DOI: 10.1371/journal.ppat.1008875

Source DB:  PubMed          Journal:  PLoS Pathog        ISSN: 1553-7366            Impact factor:   6.823


Introduction

<span class="Species">Prions are unorthodox infectious agents of fatal <span class="Disease">neurological diseases that affect many mammalian species, including humans. The central pathogenic event underlying prion infection is the self-propagating conformational change of a host-encoded glycoprotein (PrPC) into a misfolded conformer (PrPSc)[1]. The protein-only hypothesis states t<span class="Species">hat infectious prions are composed solely of PrPSc[2, 3]. However, much evidence indicates that cofactor molecules are required for the formation of infectious prions[4-7]. In direct support of this concept, our laboratory generated two self-propagating bacterially-expressed recombinant (rec) PrPSc conformers (cofactor recPrPSc and protein-only recPrPSc) by propagating the same original seed in the presence and absence of purified phospholipids, respectively[7, 8]. Whereas cofactor recPrPSc effectively seeds mouse (Mo) brain homogenate (BH) sPMCA reactions in vitro and potently infects wild-type mice in vivo, protein-only recPrPSc cannot seed Mo BH sPMCA reactions and fails to infect wild-type mice[7]. <span class="Species">Most animal species <span class="Species">have transmission barriers that render them resistant to the majority of prion strains from other species. Some species, such as rabbits, dogs, and horses are resistant to naturally occurring prion strains[9]. In contrast, the European bank vole (Myodes glareolus) is a highly susceptible host for a wide variety of prion diseases[10-14]. Experiments with transgenic mice showed that the susceptibility of bank voles to prion infection is ultimately encoded by the amino acid sequence of bank vole (BV) PrPC[13, 15], and BV PrP has been shown to be a highly susceptible substrate for in vitro conversion assays [16]. Several residues and domains in the BV PrPC sequence have previously been identified through in vitro and in vivo approaches to play important roles in the susceptibility by specific prions from other species[17-22]. While the residues and domains identified in these experiments appear to play roles for the specific species barriers studied, it is difficult to distinguish whether they do so because of sequence mismatch between seed and substrate or because they control the structural transition of PrPC to PrPSc. Recently, we discovered t<span class="Species">hat protein-only rec<span class="Gene">PrPSc is able to potently seed BV but not Mo PrPC substrate in sPMCA reactions, and the PrPSc molecules produced in these reactions are highly infectious[23]. Interestingly, we observed that the formation of infectious PrPSc molecules from non-infectious protein-only recPrPSc seed required several factors: (1) bank vole rather than mouse PrPC substrate, (2) native PrPC rather than recPrP substrate lacking post-translational modifications (PTMs), and (3) cofactor molecules. In the present study, we exploit this system to identify PrPC domains that might serve as “linchpins” to control PrP conformational change. Uniquely, this system has the critical advantage of not being influenced by species barriers[24] since mouse protein-only recPrPSc can seed BV PrPC but not Mo PrP in this system. Therefore, we can test the ability of native Mo-BV PrPC chimeric substrates to convert in sPMCA reactions driven by Mo protein-only recPrPSc seed, with confidence that this process depends only upon the enhanced ability of BV PrPC (and chimeric substrates) to convert into PrPSc, rather than the degree of amino acid sequence similarity between seed and substrate. Similarly, this system also provides a unique opportunity to study the effect of PTMs on PrPSc formation since protein-only recPrPSc, which lacks PTMs, requires native PrPC substrate to produce PrPSc.

Results

BV PrP is uniquely able to propagate Mo protein-only recPrPSc

The amino acid sequence of the processed region of BV <span class="Gene">PrP is a natural chimera of <span class="Species">Mo PrP and Ha PrP, with the exception of two unique residues at the extreme C-terminus (. As a preliminary experiment, we first compared the conversion ability of BV BH, Ha BH, and Mo BH to propagate Mo protein-only recPrPSc. The results show that BV BH, but not Ha BH or Mo BH, is capable of propagating Mo protein-only recPrPSc (. BV BH is also capable of propagating both the hamster prion strain 139H and the mouse prion strain RML. In contrast, Mo BH is capable of propagating only RML, and Ha BH is capable of propagating only 139H (. Taken together, these results show that BV PrP is a uniquely susceptible substrate to Mo protein-only recPrPSc and native prion strains from other species.

Susceptibility of various rodent species in BH sPMCA.

(A) Amino acid comparison of the processed regions of <span class="Species">Mo <span class="Gene">PrP, Ha PrP, and BV PrP. The sequence bar highlights the regions of BV PrP homologous to Mo PrP (orange) or Ha PrP (green), or are unique to BV PrP (blue). Black arrowheads denote the location of N-linked glycans. The locations of various structural domains are shown in black. OR = octapeptide repeat; PB = polybasic domain; GPI = glycophosphaditylinositol. Sequence alignments were performed using Multalin[25]. (B) Western blots showing three-round sPMCA reactions using normal brain homogenates (BH) from the species used in (A) as the substrates and initially seeded on day 0 with various seeds, as indicated. Day 0 samples are seeded reactions not subject to sonication. -PK = samples not subjected to proteinase K digestion; all other samples were proteolyzed. We next developed a system t<span class="Species">hat allowed us to design and produce a wide variety of <span class="Gene">PrPC substrates in HEK 293 cells. HEK 293 are human cells that can express secretory and membrane-bound proteins with post-translational modifications, including N-linked glycans and a GPI anchor[26, 27], at high level. All HEK-expressed constructs were partially deglycosylated using PNGase F as previously described ( to improve the conversion efficiency of Mo PrPC[28] (. This effect is likely due to the previously observed inhibitory effects of PrPC glycosylation on the propagation of mouse prion strains[28, 29], which may be due to negatively charged sialic acid groups within the glycan structure[30], and which may be further aggravated by hyper-glycosylation in HEK 293 cells. To ensure our system faithfully reproduces similar seed specificity as brain homogenate substrates in sPMCA, we first tested the susceptibility of cell-expressed BV PrP and Mo PrP in sPMCA (. The susceptibility of each construct was tested in three-round reconstituted BH sPMCA reactions containing PrP0/0 brain homogenate and a partially purified PrPc construct. The results show that, like the crude BH substrates, cell-expressed BV PrPC is capable of propagating Mo protein-only recPrPSc, 139H, and RML (. Cell-expressed BV PrPC can also propagate Mo cofactor recPrPSc. However, significant PrPSc formation was not observed in either the 139H-seeded or Mo cofactor recPrPSc seeded lanes until round 3 of sPMCA (. In contrast, cell-expressed Mo PrPC was capable of propagating RML and Mo cofactor recPrPSc, but not Mo protein-only recPrPSc or 139H (. Taken together, the results show that the cell-expressed PrPC substrates have similar susceptibilities to crude BH substrates from the same species.

Susceptibility of BV PrPC and Mo PrPC substrates in reconstituted sPMCA.

Western blots showing three-round reconstituted <span class="Chemical">sPMCA reactions using either BV or <span class="Species">Mo partially purified PrPC substrates supplemented with PrP0/0 BH and seeded with various seeds, as indicated. -PK = samples not subjected to proteinase K digestion; all other samples were proteolyzed.

BV PrP C-terminal domain is required for efficient conversion of sPMCA reactions seeded with Mo protein-only recPrPSc

To identify the specific amino acid residue(s) required to enable BV <span class="Gene">PrPC to propagate <span class="Species">Mo protein-only recPrPSc, we designed a series of chimeric constructs based on the BV PrPC backbone sequence that, working from the C- towards the N- terminus, become progressively substituted with Mo PrP residues (, and tested the ability of these chimeric constructs to be seeded by Mo protein-only recPrPSc in sPMCA reactions. Within this systematic paradigm, BV PrP substitution(s) that are specifically required to propagate Mo protein-only recPrPSc are identified when the resulting chimera is no longer capable of propagating Mo protein-only recPrPSc. The results show that substitution of residues 227 and 230 from BV sequence to Mo sequence (i.e. E227D and S230R) inhibited conversion of Mo protein-only recPrPSc seeded reactions by >10-fold (. We observed some variability in sPMCA patterns obtained with BV(DR) substrate from experiment-to-experiment; we detected no bands at all in round three in 3/5 Mo protein-only recPrPSc-seeded independent sPMCA experiments. In other cases, such as the example shown (, we observed a near-complete absence of the ~24 kDa PK-resistant by round three of the reaction, while the lower molecular weight bands at ~16 and 19 kDa are present in round three, but have reduced signal intensity. In comparison, the positive control reaction containing BV(DR) PrPC and seeded with RML PrPSc showed consistent three-round propagation (.

Determining the minimum PrP sequence required for propagation of Mo protein-only recPrPSc seed.

(A) Table summarizing the ability of various BV/<span class="Species">Mo <span class="Gene">PrPC chimeras to propagate Mo protein-only recPrPSc. All constructs in this series are based on the BV PrPC backbone and become progressively substituted with Mo residues from the C-terminus towards the N-terminus, except for the last two constructs which contain different combinations of 3 Mo substitutions. (B) Western blots of experiments summarized in (A), showing three-round reconstituted sPMCA reactions using partially purified PrPC substrates supplemented with PrP0/0 BH and seeded with various seeds, as indicated. -PK = samples not subjected to proteinase K digestion; all other samples were proteolyzed. BV(DR) chimeras with additional step-wise N-terminal <span class="Species">Mo substitutions (i.e. BV(<span class="Mutation">S170DR), BV(YS170DR) and BV(LYS170DR) displayed no significant conversion in reactions seeded with Mo protein-only recPrPSc (. In contrast, BV(LDR) and BV(YDR) substrates were able to propagate Mo protein-only recPrPSc at ~1/3 the conversion efficiency of BV PrPC (. Taken together, our results indicate that residues E227 and S230 are required for efficient conversion of sPMCA reactions seeded by Mo protein-only recPrPSc, and additional substitutions of other non-homologous residues also influence the degree of conversion efficiency. Finally, we also designed and tested the ability of a series of chimeric constructs, which substituted single <span class="Species">Mo <span class="Gene">PrP amino acid residues to their cognate BV PrP residue, to propagate Mo protein-only recPrPSc (. This analysis showed that neither E227D nor S230R substitution alone reduced the conversion efficiency of BV PrPC (. On the other hand, BV(S170) and BV(L) displayed lower conversion efficiencies than BV PrPC ( These data indicate that the E227D and S230R substitutions work synergistically to block propagation of Mo protein-only recPrPSc, whereas substitution of other individual residues can reduce the conversion efficiency of chimeric PrPC molecules.

Determining the effect of single Mo amino acid mutations on the propagation of Mo protein-only recPrPSc.

(A) Table summarizing the effect of single <span class="Species">Mo amino acid substitutions on the ability of BV/<span class="Species">Mo PrPC chimeras to propagate Mo protein-only recPrPSc. All constructs are based on the BV PrPC backbone. (B) Western blots of experiments summarized in (A), showing three-round reconstituted sPMCA reactions using partially purified PrPC substrates supplemented with PrP0/0 BH and seeded with various seeds, as indicated. -PK = samples not subjected to proteinase K digestion; all other samples were proteolyzed.

The extreme C-terminal domain of BV PrPC is sufficient to propagate Mo protein-only recPrPSc

We next sought to identify bank vole amino acid residue(s) that are sufficient to propagate Mo protein-only recPrPSc. Therefore, we designed a series of chimeric constructs based on the Mo PrPC backbone sequence that, working from the C- to the N-terminus, become progressively substituted with BV PrP residues (. and tested the ability of these chimeric constructs to be seeded by Mo protein-only recPrPSc in sPMCA reactions. The results show that substitution of the two non-homologous residues in extreme C-terminus (227 and 230) from DR to ES is sufficient to propagate Mo protein-only recPrPSc (.

Determining the BV amino acids that are sufficient to propagate protein-only recPrPSc.

(A) Table summarizing the ability of BV/<span class="Species">Mo <span class="Gene">PrPC chimeras to propagate Mo protein-only recPrPSc. All constructs are based on the Mo PrPC backbone and become progressively substituted with BV residues from the C-terminus towards the N-terminus. (B) Western blots of experiments summarized in (A), showing three-round reconstituted sPMCA reactions using partially purified PrPC substrates supplemented with PrP0/0 BH and initially seeded with various seeds, as indicated. -PK = samples not subjected to proteinase K digestion; all other samples were proteolyzed. We also designed and tested the ability of a series of chimeric constructs t<span class="Species">hat substitute single BV <span class="Gene">PrP amino acid residues to their cognate Mo PrP residue to propagate Mo protein-only recPrPSc (. The results show that this series of chimeric PrPC substrates are unable to propagate Mo protein-only recPrPSc for three rounds in sPMCA (. In each case, we observed a decrease in PK-resistant PrPSc over each round of sPMCA, resulting in the near absence of PK-resistant PrPSc by round three in each reaction tested (. In contrast, we found that the positive control RML PrPSc efficiently propagates in reactions this series of chimeric PrPC substrates for three rounds of sPMCA (. Thus, no single amino acid mutation from Mo to BV PrPC sequence is sufficient to restore the ability to propagate Mo protein-only recPrPSc. Overall, our results show that both the E227D and S230R substitutions are required to enable Mo PrPC chimeras to propagate Mo protein-only recPrPSc.

Determining the effect of single BV amino acid mutations on the propagation of Mo protein-only recPrPSc.

(A) Table summarizing the effect of single BV amino acid substitutions on the ability of BV/<span class="Species">Mo <span class="Gene">PrPC chimeras to propagate Mo protein-only recPrPSc. All constructs are based on the Mo PrPC backbone. (B) Western blots of experiments summarized in (A), showing three-round reconstituted sPMCA reactions using partially purified PrPC substrates supplemented with PrP0/0 BH and initially seeded with various seeds, as indicated. -PK = samples not subjected to proteinase K digestion; all other samples were proteolyzed.

The extreme C-terminus also controls propagation of native infectious prion strains

To evaluate whether 227 and 230 also controls the ability of <span class="Gene">PrPC substrate to propagate native infectious <span class="Species">prion strains, we tested the ability of hamster Sc237, sheep scrapie, and deer CWD to seed the critical chimeric substrates affecting residues 227 and 230, BV(DR) and Mo(ES). Like protein-only recPrPSc, all three of these native strains can seed BV but not Mo PrPC substrate ( (. Unlike BV PrPC, the BV(DR) chimera was unable to propagate Sc237, sheep scrapie, or CWD ( Conversely, unlike Mo PrPC, the Mo(ES) chimera was competent substrate for propagation of these three native strains (. As expected, all of the wild-type and chimeric substrates could successfully propagate mouse RML, a strain that infects both mice and bank voles efficiently ( Taken together, these results indicate that residues 227 and 230 play a critical role in determining the enhanced susceptibility of BV PrPC to seeding by a variety of native prion strains.

Determining the effect of specific BV and Mo amino acids on the species barrier.

Western blots of experiments showing three-round reconstituted <span class="Chemical">sPMCA reactions using partially purified <span class="Gene">PrPC substrates supplemented with PrP0/0 BH and initially seeded on day 0 with various seeds, as indicated. Day 0 samples are a seeded reaction not subject to sonication. -PK = samples not subjected to proteinase K digestion; all other samples were proteolyzed. In some reactions, we observed changes in the migration pattern of <span class="Gene">PK-resistant bands between sPMCA rounds ( and CWD-seeded Mo(ES)) These shifts may represent strain adaptation, which can occur rapidly and stochastically during sPMCA propagation [31], and which is more likely to occur during cross-species propagation[32].

Specific PrPC glycosylation mutant is also able to propagate Mo protein-only recPrPSc

Finally, we also sought to investigate the influence of PTMs (rather t<span class="Species">han amino acid sequence) on <span class="Gene">PrPC susceptibility to Mo protein-only recPrPSc. To do this, we used brain homogenates from transgenic mice expressing various mutant Mo PrPC molecules with specific PTM defects as substrates in sPMCA reactions. We first analyzed a series of previously described glycosylation mutants with known differences in susceptibility to infection by various prion strains in vivo[33]. Within this series, G1 mice express PrPC with a point mutation at the first N-linked glycosylation site, G2 mice express PrPC with a point mutation at the second N-linked glycosylation site, and G3 mice express PrPC containing both mutations[34, 35]. We carried out sPMCA experiments using G1, G2, or G3 brain homogenate substrate seeded with Mo protein-only recPrPSc or RML. Remarkably, the results show that G2 PrPC was able to convert into PrPSc when seeded by Mo protein-only recPrPSc (. The conversion process appears to be slower for G2 PrPC than for susceptible chimeric PrPC substrates, since G2 PrPSc became detectable only after 4 rounds of sPMCA propagation. In contrast, neither G1 nor G3 PrPC appeared to be susceptible to seeding by protein-only recPrPSc (.

Propagation of Mo protein-only recPrPSc in sPMCA reactions with glycosylation-deficient PrPC substrates.

Western blots of <span class="Chemical">sPMCA reactions using brain ho<span class="Species">mogenates from glycosylation mutants G1, G2, or G3 as substrates, as indicated. Reactions were seeded with Mo protein-only recPrPSc or RML, as indicated. -PK = samples not subjected to proteinase K digestion; all other samples were proteolyzed. Mouse amino acid numbering scheme is used to show locations of N-linked glycans on Mo PrP.

Discussion

Here we leveraged a unique in vitro conversion system to identify a specific domain within the <span class="Gene">prion protein (containing residues 227 and 230) that appears to serve as a linchpin that controls the conformational change of PrPC to PrPSc. The amino acid sequences of mature bank vole PrPC and mouse PrPC differ at only 8 residues[12, 13], and our system allowed us to systematically examine which of these non-homologous amino-acid residues are responsible for the remarkable susceptibility of BV PrPC to convert into PrPSc. For the purposes of this study, our system provided two critical technical advantages. (1) The ability of Mo protein-only recPrPSc to convert BV PrPC does not depend on amino acid complementarity between seed and substrate, allowing us to interpret our results without the potentially confounding factor of sequence mismatch. (2) Our cell-based expression system allowed us to produce multiple BV-Mo chimeric PrPC constructs rapidly and inexpensively, allowing us to perform a thorough analysis of potential permutations in an unbiased manner.

Identification of a C-terminal “linchpin” domain that controls prion protein conformational change

The major finding of this study is t<span class="Species">hat the propensity of BV <span class="Gene">PrPC to undergo conformational change to PrPSc appears to be primarily controlled by two residues (227 and 230) located within the extreme C-terminus of mature PrP. Mutation of these two residues within the Mo PrPC backbone to their corresponding BV sequence identities was sufficient to allow seeded conversion of the resulting chimera by Mo protein-only recPrPSc. Conversely, mutation of these same two residues within the BV PrPC backbone to their corresponding Mo sequence identities largely inhibited conversion seeded by protein-only recPrPSc. Based on these findings, we propose that the extreme C-terminal domain of PrPC may serve as a key “linchpin” for its conformational change. We specifically infer that the E227 and S230 residues destabilize this domain within BV PrPC to facilitate its conformational change into a variety of PrPSc conformers and prion strains. In support of this concept, we found that these two amino acids also control susceptibility to hamster Sc237, sheep scrapie, and deer CWD prion strains. Notably, Kobayashi et al. reported that ~40% of transgenic mice overexpressing Mo PrPC containing the E227 and S230 mutations develop a spontaneous prion disease [36]. Taken together, the results of our systematic analysis using seeded conversion assays and the spontaneous disease reported by Kobayashi et al. provide complementary and compelling evidence for the hypothesis that the extreme C-terminus is a linchpin domain, which controls the conversion (either seeded or unseeded) of PrPC into PrPSc. It is worth noting that, among the 8 BV residues that do not have homologous match in the Mo PrP sequence, E227 and S230 are unique to vole species (. In contrast, the other 6 mismatched BV residues can be found in other mammalian species; for instance, all 6 are homologous to the corresponding residues within the hamster (Ha) PrP sequence (. Together, the observations that (1) residues E227 and S230 are unique to vole species and (2) voles are uniquely susceptible to prion diseases[10-14] are consistent with the hypothesis that the extreme C-terminus plays a key role in prion formation, possibly by stabilizing PrPC. This hypothesis is also consistent with a number of previous results. (1) This region displays decreased solvent accessibility upon transition from PrPC to PrPSc [37], indicating it undergoes conformational change. (2) Residues 225 and 226 of deer PrPC (222 and 223 of BV PrPC) appear to play critical roles in interspecies prion conversion [38]. (3) Specific polymorphisms and mutations in the C-terminus can produce dominant negative PrPC molecules [39]. (4) Y145stop, a PrP mutant lacking the C-terminus, appears to convert spontaneously into amyloid fibers[40] (the absence of the C-terminus in this truncated mutant may destabilize PrP structure and promote misfolding). Finally, it is interesting to note that the GPI anchor is attached to the C-terminus of PrP. It is possible that attachment to this bulky modification may normally stabilize the C-terminal domain to prevent the conformational change of native PrPC into PrPSc. Consistent with this notion, transgenic mice that overexpress Mo PrPC lacking a GPI anchor spontaneously develop prion disease[41]. It is important to acknowledge the experimental limitations of our work. (1) We have not confirmed that the various chimeric PrPSc molecules produced in our sPMCA reactions are infectious. However, we have previously shown that similar reactions containing BV PrPC substrate and seeded with protein-only recPrPSc produces fully infectious prions[23], making it likely that we are also studying a process relevant to infectious prion formation in this study. (2) Since we are using Mo protein-only recPrPSc as a tool to study prion conversion, we can only say that our results are sequence-independent, and may not hold for every prion strain (we have only been able to test the few native strains that show differential ability to seed BV vs. Mo PrPC substrate in reconstituted sPMCA reactions). Additional in vitro and in vivo studies are needed to fully characterize the role played by the C-terminal domain in the propagation of naturally occurring prion strains (3) Finally, our PrPC substrates are partially deglycosylated, and the glycosylation status of PrPC has been shown to modulate its susceptibility to prion infection in vivo[35, 42], raising the possibility that the deglycosylation step might artifactually change the results of our chimeric analysis. However, this appears to be unlikely because we found that our partially deglycosylated WT BV PrPC and Mo PrPC substrates display similar patterns of seeding specificity as their fully glycosylated counterparts in sPMCA reactions.

The influence of other non-homologous residues on seeded conversion by protein-only recPrPSc

In addition to identifying residues 227 and 230 as a linchpin domain, our work also showed that other non-homologous residues could influence the ability of chimeric molecules to propagate Mo protein-only recPrPSc. Specifically, we observed that additional substitution of either M109L or N155Y partially restored the conversion ability of the BV(DR) chimera (, whereas additional substitution with N170S inhibited conversion of BV(DR) ( as well as BV PrPC (. The former effects are expected outcomes of increasing homology between substrate and seed in non-linchpin domains, but the latter effect at residue 170 appears paradoxical, since increasing homology to the MoPrP sequence actually reduces the ability of chimeric substrates to propagate Mo protein-only recPrPSc. It <span class="Species">has been previously reported that homology between PrPC and PrPSc at position 170 correlates with interspecies prion conversion in vitro[43] and is important in allowing transmission across the species barrier in vivo[44]. Additionally, residues 155 and 170 have been shown to control the conversion efficiency of BVPrPC in cell-free conversion (CFC) assays in vitro[19] and control susceptibility to prion infection in rodents[17]. Surprisingly, our results paradoxically show that increasing homology at position 170 between PrPC and PrPSc blocks conversion with Mo protein-only recPrPSc. PrP forms a β2- α2 loop in the region 165–171[20], and mutations that modify this structure can alter host susceptibility[45]. Mice, which have serine at position 170, have a disordered loop [46, 47], while bank voles which have asparagine at position 170 have a rigid loop [20]. Our data supports a model whereby structural or biophysical elements dictated by the amino acid sequence of PrPC that correlate with loop rigidity, rather than amino acid sequence homology between PrPC and PrPSc, promote the conversion of PrPC to PrPSc. This model is supported by our finding that a mutation that increases loop homology but decreases rigidity blocks conversion by Mo protein-only recPrPSc together with a series of observations from other investigators. (1) Transgenic mice that 2-3x overexpress PrP containing 2 point mutations (170N,174T) that increase the rigidity of the a β2- α2 loop develop a spontaneous prion disease[48]. (2) The 170N, 174T double mutation was also found to increase the propensity of recPrP to form amyloid fibrils in vitro[49]. (3) Transgenic mice overexpressing 3-5x PrP containing another mutation that increases the rigidity of the β2- α2 loop (D167S) develop a spontaneous neurologic disease [50]. It is worth noting t<span class="Species">hat the impact of 170 substitution on <span class="Gene">PrP conversion is asymmetrical. In other words, the inverse substitution (S170N) into the Mo PrPC backbone does not produce a chimera that is capable of propagating Mo protein-only recPrPSc (. We can therefore infer that the extreme C-terminal domain likely plays a larger role than residue 170 in facilitating propagation of Mo protein-only recPrPSc.

PrPC glycosylation adjacent to C-terminus also inhibits prion conversion

In addition to the amino acid sequence of the extreme C-terminus, we found that the propensity of PrPC to undergo prion conversion could also be affected by the adjacent N-linked glycan. Specifically, we found that mutant Mo PrPC lacking the second N-linked glycan (G2) at position 196 (mouse numbering) near the C-terminus can also propagate mouse protein-only recPrPSc in vitro. The effect of G2 deglycosylation does not appear to be as important as the effect of the E227 and S230 mutations since G2 PrPSc formation was not observed until round 4. In contrast, mutant PrPC lacking the other (G1), or both (G3) N-linked glycans remained resistant to conversion. It is surprising that Mo G2 PrPC should be more susceptible than Mo G3 PrPC to seeding by Mo protein-only recPrPSc, since Mo G3 PrPC is more similar to recPrP (in that both proteins are completely devoid of N-linked glycans). However, in line with our results, it has been previously reported that transgenic mice expressing Mo G2 PrPC are more susceptible than G1, G3, and wild-type mice to cross-species infection with human prions[33], suggesting that the first N-linked glycan may serve to facilitate PrPSc formation for several different prion strains. However, the first N-linked glycan of PrPC may not be important for propagating all prion strains (e.g. Kim et al. produced a synthetic prion strain is infectious to mice expressing PrPC lacking both glycans[42]).

Conclusion

We <span class="Species">have leveraged a unique in vitro conversion system to show that the extreme C-terminus serves as a linchpin to control the seeded conversion of PrPC to PrPSc. Specifically, our data indicate that BV-specific residues at positions 227 and 230 are sufficient to promote prion conversion independent of seed/substrate sequence homology. We also found that the second N-linked glycan (adjacent to the C-terminal domain) inhibits seeding by Mo protein-only recPrPSc. While PrPC from both bank voles and G2 mutant mice are susceptible to conversion by recombinant protein-only protein seeds and other natural strains, both are relatively resistant to BSE-derived prions [17, 35], which is surprising since BSE prions readily infect wild-type mice[51] and many other animal species. Taken together, these observations suggest that Mo G2 PrPC and BV PrPC may share a common folding mechanism to form PrPSc, and that this mechanism may be able to accommodate a wide variety of PrPSc conformations (except for BSE, which may propagate by a different folding mechanism). It is possible that the G2 glycan, which is attached to residue N196, normally serves to stabilize the C-terminal domain of PrPC, and that specific residues perform a similar function, such as D227 and R230 in mouse PrP. Given that this linchpin controls the conversion of PrPC into PrPSc, we propose that stabilization of this region potentially represents an attractive target for potential prion therapeutics.

Materials and methods

Ethics statement

The Guide for the Care and Use of Laboratory Animals of the National Research Council was strictly followed for all animal experiments. All experiments conducted at Dart<span class="Species">mouth College involving <span class="Species">voles and mice in this study were conducted in accordance with protocol supa.su.1 as reviewed and approved by Dartmouth College’s Institutional Animal Care and Use Committee, operating under the regulations/guidelines of the NIH Office of Laboratory Animal Welfare (assurance number A3259-01) and the United States Department of Agriculture. All experiments conducted at the Roslin Institute involving mice were approved by The Roslin Institute’s Animal Welfare Ethical Review Board (internal protocol number; A471) and were conducted according to the regulations of the 1986 United Kingdom Home Office Animals (Scientific Procedures) Act.

Native prion strains

The <span class="Species">mouse <span class="Species">prion strain RML and the hamster prion strains 139H and sc237 were gifts from Stanley Prusiner (University of California, San Francisco, USA). The deer CWD prion strain and sheep scrapie prion strain were gifts from Mark Hall (USDA, Ames, Iowa, USA). The hamster strain Hyper was a gift from Suzette Priola (Rocky Mountain Laboratories, Hamilton, MT).

General sPMCA methods

The general <span class="Chemical">sPMCA experimental method was adapted from Castilla et al.[52]. All PMCA reactions were sonicated in microplate horns at 37°C using a Misonix S-4000 power supply (Qsonica, Newtown, CT) set to power 70 for three rounds. One round of PMCA is equal to 24 hr. The first round of PMCA was seeded with a volume of <span class="Gene">PrPSc equal to 10% of the total reaction volume. RML prion-infected brain homogenates used as PrPSc seeds were used at a final reaction concentration of 1.0% (v/v), and 139H prion-infected brain homogenates used as PrPSc seeds were used at a final reaction concentration of 0.1% (v/v). To propagate the reaction between PMCA rounds, 10% of the reaction volume was transferred into a new, unseeded, substrate mixture. Due to the sensitivity of sPMCA[53], measures were undertaken to prevent sample contamination. Sample conical tubes were sealed with Parafilm (Bemis Company, Oshkosh, WI) and the sonicator horn was soaked in 100% bleach between experiments to prevent cross-contamination. The experimenter wore two pairs of gloves and changed the outer layer of gloves when handling a new sample. Sample conical tubes were spun at 500 x g for 5 sec to remove liquid off the conical tube lids before propagation and samples were propagated individually using aerosol resistant pipette tips. With each experiment, a sentinel conical tube (a conical tube containing the entire sPMCA reaction mixture but lacking seed) was also placed in the sonicator horn to monitor reactions for contamination.

Preparation of cofactor and protein-only recPrPSc by sPMCA

Rec<span class="Gene">PrP, purified as described by Breydo et al.[54] was used to generate cofactor rec<span class="Gene">PrPSc and protein-only recPrPSc, as described[7, 23]. Briefly, 200 μL reactions containing 6 μg/mL recombinant mouse PrP 23–230 or M109 bank vole PrP 23–231 in conversion buffer [20 mM Tris pH 7.5, 135 mM NaCl, 5 mM EDTA pH 7.5, 0.15% Triton X-100] were supplemented with either brain-derived cofactor[7] for cofactor recPrPSc propagation, or water for protein-only recPrPSc propagation. Reactions were seeded with 20 μL of converted cofactor recPrPSc or protein-only recPrPSc and sonicated with 15 sec pulses every 30 min for 24 hr at 37°C.

sPMCA with brain homogenate

A 10% (w/v) brain ho<span class="Species">mogenate was prepared initially by Potter ho<span class="Species">mogenization in PBS. The crude homogenate was spun at 400 x g for 1 min, and the supernatant was removed and kept. Triton X-100 was added to the supernatant for a final concentration of 1% (v/v), and the supernatant was solubilized on ice for 10 min. Brains were taken from European bank voles with the M109 genotype, Syrian hamsters, C57BL/6J mice, PrP0/0 mice or transgenic mice expressing glycosylation mutants (G1, G2, G3) as previously described[35]. One-hundred microliter reactions were seeded with 10 μL of PrPSc and sonicated with 20 sec pulses every 30 min for 24 hr at 37°C.

Reconstituted sPMCA with HEK 293-expressed PrP

Fifty-five microliters of <span class="Gene">HEK expressed <span class="Gene">PrPC substrate was mixed with 10 μL of 10X cell PMCA buffer (1% Triton X-100, 150 mM NaCl, 500 mM imidazole pH 7.5, 50 mM EDTA pH 7.5), 25 μL of 10% PrP0/0 brain homogenate, and seeded with 10 μL of a sPMCA reaction or 10% brain homogenate. One-hundred microliter reactions were seeded with 10 μL of PrPSc and sonicated with 20 sec pulses every 30 min for 24 hr at 37°C. The final concentration of PrPC in each reaction was 4–5 μg/mL.

Detection of PrPSc in sPMCA reactions

Formation of <span class="Gene">PrPSc was monitored by digestion of PMCA samples with proteinase K (PK) and western blotting. Samples were digested with 64 μg/mL PK (Roche, Basel, Switzerland) at 37°C with shaking at 750 r.p.m. Samples from sPMCA reactions using recPrP as the substrate were treated for 30 min, while samples using HEK 293 expressed PrP or brain homogenate as the substrate were treated for 60 min. Digestions were quenched by adding SDS-PAGE loading buffer and heating to 95°C for 15 min. SDS-PAGE and western blotting were performed as described previously [7] using mAb 27/33. Twenty microliters of a sPMCA reaction was subjected to PK digestion. The minus PK (-PK) lane is used to determine the conversion efficiency of a sPMCA reaction. For reactions using recombinant PrP or crude BH as the substrate, the -PK lane contains the same volume (20 μL) of a sPMCA reaction as a PK-digested sample. For reactions using HEK 293 expressed PrP the -PK lane contains a volume (2 μL) equivalent to one-tenth used in the PK-digested samples. This is because these substrates result in a much lower expected conversion efficiency. Images were quantified using Image Studio Lite (Licor) software to obtain the background-subtracted average signal intensity for the -PK and rounds 1–3 bands. The -PK value was multiplied by 10 to account for loading differences between it and rounds 1–3. The percent-conversion was then calculated for round 3 by dividing the background-subtracted average signal intensity for each round by the background-subtracted average signal intensity for the -PK round. The average percent conversion ±SEM for round 3 was calculated using between 1 and 5 biological replicates and 1 and 3 technical replicates. We also confirmed t<span class="Species">hat the final round <span class="Gene">PrPSc molecules produced in sPMCA reactions using HEK-expressed PrPC substrates could subsequently seed bank vole brain homogenate PMCA reactions (.

Mutagenesis and expression of HEK 293 PrP constructs

<span class="Species">Mo<span class="Gene">PrP on pcDNA 3.1 was generated by excising MoPrP from pcDNA5/FRT. BV PrP M109 pcDNA 3.1[23] and MoPrP pcDNA 5/FRT were cut using ApaI and HindIII (New England Biolabs, Ipswich, MA, USA). MoPrP was then ligated into the pcDNA 3.1 backbone. Chimeric constructs were generated using site directed mutagenesis using either the GeneTailor Site Directed Mutagenesis System (Invitrogen, Carlsbad, CA, USA) or GeneArt Site Directed Mutagenesis System (Invitrogen)(Table 1). All constructs were confirmed by sequencing. Constructs were then transfected into HEK 293 Freestyle-F cells (Invitrogen, Carlsbad, CA, USA)[55]. After 48 hr, 320 mL of cells were harvested in 80 mL aliquots by spinning at 500 x g for 5 min and stored at -80°C until purification.
Table 1

Primers and template plasmids used to generate chimeric BV/Mo PrP plasmids.

CONSTRUCTTEMPLATE PLASMIDPRIMERS
BV(DR)BV PrP pcDNA 3.1F: AGTCCCAGGCCTACTACGATGGGAGAAGATCCCGCGCCGTGCTGCTCTTCTCR: TCGTAGTAGGCCTGGGACTCCTTCTGATACTG
BV(S170DR)BV(DR)F: CCGGTGGACCAGTACAGCAACCAGAACAACTR: TGTACTGGTCCACCGGCCGGTAGTACACTT
BV(YS170DR)BV(S170DR)F: TACTACCGTGAAAACATGTACCGGTACCCTAAR: CATGTTTTCACGGTAGTAGCGGTCCTCC
BV(LYS170DR)BV(YS170DR)F: CAGTAAGCCAAAAACCAACCTGAAGCATGTGGR: GTTGGTTTTTGGCTTACTGGGCTTGTTCCACT
Mo(ES)Mo PrP pcDNA 5F: TCAGGCCTATTACGAGGGGAGAAGCTCCAGCAGCR: GCTGCTGGAGCTTCTCCCCTCGTAATAGGCCTGA
Mo(N155N170ES)Mo(N170ES)F: ACCGTGAAAACATGAACCGATATCCTAACCAAGTGR: CACTTGGTTAGGATATCGGTTCATGTTTTCACGGT
Mo(M109N155N170ES)Mo(N155N170ES)F: CCAAAAACCAACATGAAGCACGTGGCAGGR: CCTGCCACGTGCTTCATGTTGGTTTTTGG
BV(R)BV PrP pcDNA 3.1F: TACTACGAAGGGAGAAGATCCCGCGCCGTGCTR: AGCACGGCGCGGGATCTTCTCCCTTCGTAGTA
BV(D)BV PrP pcDNA 3.1F: CCCAGGCCTACTACGACGGGAGAAGTTCCCR: GGGAACTTCTCCCGTCGTAGTAGGCCTGGG
BV(S170)BV PrP pcDNA 3.1F: GTGGACCAGTACAGCAACCAGAACAACR: GTTGTTCTGGTTGCTGTACTGGTCCAC
BV(Y)BV PrP pcDNA 3.1F: ACCGTGAAAACATGTACCGGTACCCTAACCR: GGTTAGGGTACCGGTACATGTTTTCACGGT
BV(L)BV PrP pcDNA 3.1F: GCCAAAAACCAACCTGAAGCATGTGGCAGR: CTGCCACATGCTTCAGGTTGGTTTTTGGC
Mo(S)Mo PrP pcDNA 5F: TTACGACGGGAGAAGCTCCAGCAGCACR: GTGCTGCTGGAGCTTCTCCCGTCGTAA
Mo(E)Mo PrP pcDNA 5F: CAGGCCTATTACGAGGGGAGAAGATCCAGCAR: TGCTGGATCTTCTCCCCTCGTAATAGGCCTG
Mo(N170)Mo PrP pcDNA 5F: GTGGATCAGTACAATAACCAGAACAACTTCGR: CGAAGTTGTTCTGGTTATTGTACTGATCCAC
Mo(N155)Mo PrP pcDNA 5F: ACCGTGAAAACATGAACCGATATCCTAACCAAGTGR: CACTTGGTTAGGATATCGGTTCATGTTTTCACGGT
Mo(M109)Mo PrP pcDNA 5F: CCAAAAACCAACATGAAGCACGTGGCAGGR: CCTGCCACGTGCTTCATGTTGGTTTTTGG
BV(LDR)BV(DR)F: CAGTAAGCCAAAAACCAACCTGAAGCATGTGGR: GTTGGTTTTTGGCTTACTGGGCTTGTTCCACT
BV(YDR)BV(DR)F: TACTACCGTGAAAACATGTACCGGTACCCTAAR: CATGTTTTCACGGTAGTAGCGGTCCTCC

Purification of HEK 293 expressed PrP constructs

Pellets thawed on ice were re-suspn>ended in 20 mL of lysis buffer [20 mM <span class="Chemical">MOPS pH 7.0, 0.15 M NaCl, 1% Triton X-100, 1% DOC, CompleteTM mini EDTA-free protease inhibitor (Roche, Basel, Switzerland)]. The mixture was solubilized on ice for 30 min, then centrifuged at 100,000 x g for 35 min. The solubilized supernatant was applied to a 2 mL IMAC copper sulfate column made with chelating Sepharose (GE Healthcare, Chicago, USA) that was pre-equilibrated with equilibration and wash buffer [20 mM MOPS pH 7.0, 0.15 M NaCl, 10 mM imidazole, 1% Triton X-100]. The column was then washed with 20 mL of equilibration and wash buffer. The sample was eluted with 8 mL of elution buffer [20 mM MOPS pH 7.5, 0.15 M NaCl, 0.15 M imidazole pH 7.0, 1% Triton X-100]. The eluate was diluted 1:1 with pre-SP buffer [20 mM MES pH 5.4, 0.15 M imidazole pH 7.0, 0.15 M NaCl, and 1% Triton X-100]. Next, the eluate was applied over a 2 mL SP Sepharose fast flow (Sigma-Aldrich, St. Louis, MO, USA) exchange column pre-equilibrated with SP wash buffer [20 mM MOPS pH 7.0, 250 mM NaCl, and 1% Triton X-100]. The column was washed with 10 mL SP was buffer and eluted with 8 mL SP elution buffer [20 mM MOPS pH 7.5, 500 mM NaCl, and 1% Triton X-100]. The eluate was then partially deglycosylated by adding 80 μL of Glycerol Free PNGase F (New England Biolabs, Ipswich, MA, USA) to 8 mL of eluate. The mixture was incubated for 24 hr at 37°C with shaking at 350 r.p.m. The partially deglycosylated substrate was then concentrated and repurified by applying over a 400 μL copper column pre-equilibrated with equilibration and wash buffer. The column was washed with 20 mL of equilibration and wash buffer and eluted with 2 mL of IMAC-CuSO4-elution buffer [20 mM MES pH 6.4, 0.15 M imidazole pH 7.0, 150 mM NaCl, and 1% Triton X-100]. The eluate was loaded into a 3500 MWCO Slide-A-Lyser (Thermo Fisher, Waltham, MA, USA) and dialyzed overnight into dialysis buffer [44]. To ensure t<span class="Species">hat substitutions near the C-terminus of <span class="Gene">PrPC do not interfere with addition of the C-terminal GPI-anchor, we treated chimeric PrPC molecules with either single or double C-terminal substitutions with PI-PLC (. It has been previously reported that PI-PLC treatment of GPI-anchored proteins such as PrPC cause the treated proteins to bind less well to PVDF membranes and migrate more slowly than untreated controls [56]. Accordingly, we observed that all of the HEK-expressed PrPC chimeras tested, as well as HEK-expressed BV PrPC native brain PrPC immunopurified from mouse brain, showed displayed slower migration and lower intensity on western blot after PI-PLC treatment (. In contrast, bacterially-expressed recPrP, which lacks a GPI-anchor, is apparently unaffected by PI-PLC treatment (. Thus, all of the chimeric PrPC substrates used in this study appear to have proper post-translational modifications ( and folding (as judged by solubility in non-denaturing solution and normal behavior during IMAC and ion exchange chromatography. These observations indicate that substitution of homologous residues between mouse and bank vole PrPC does not cause aberrant metabolism or trafficking of chimeric molecules in HEK 293 cells.

Expression and partial enzymatic deglycosylation of PrPC in FreestyleTM HEK 293 cells.

Western blots showing <span class="Gene">PrP partially purified from cell lysates expressing the indicated protein, or no protein, before and after partial enzymatic deglycosylation with <span class="Gene">PNGase F (+ PF), as indicated. (A) Wild-type constructs. (B) Chimeric constructs. (TIF) Click here for additional data file.

Effect of partial enzymatic deglycosylation of PrPC substrate on its ability to propagate mouse prions.

Western blots showing three-round reconstituted <span class="Chemical">sPMCA reactions using partially purified <span class="Species">Mo PrPC substrate supplemented with PrP0/0 BH and seeded with mouse RML. Substrates were either untreated or partially deglycosylated with PNGase F during purification, as indicated. -PK = samples not subjected to proteinase K digestion; all other samples were proteolyzed. (TIF) Click here for additional data file.

Brain homogenate PMCA reactions seeded with chimeric PrPSc molecules.

Western blots showing PMCA reactions using crude bank vole brain ho<span class="Species">mogenate substrate seeded with various HEK-expressed PrPSc molecules, as indicated. The chimeric PrPSc molecules are final round products of 3-round sPMCA reactions using HEK-expressed PrPC substrates originally seeded with Mo protein-only recPrPSc or buffer, as indicated. (TIF) Click here for additional data file.

PI-PLC treatment of purified PrP substrates.

Western blots of various purified <span class="Gene">PrP substrates (bacterially-expressed rec<span class="Gene">PrP, immunopurified native brain PrPC, different HEK-expressed PrPC chimeras with substitutions at residues 227 and/or 230 as indicated, or HEK expressed bank vole PrPC) treated either with (+) or without (-) 0.25U/mL Phosphoinositide phospholipase C (PI-PLC) for 14 hr at 37 oC with shaking at 800 r.p.m. as indicated. Proteins were transferred from a 12.5% polyacrylamide gel onto a Millipore Immobilon-P PVDF membrane by semi-dry electroblotting, and probed with mAb 27/33. (TIF) Click here for additional data file. 28 Apr 2020 Dear Dr. Suppatapone, T<span class="Species">hank you very much for submitting your manuscript "Identification of a Ho<span class="Species">mology-Independent Linchpin Domain Controlling Prion Protein Conversion" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. In particular, we would like you to include data addressing concerns raised by reviewers 1 and 3 about characterization and a<span class="Species">mount of chimeric PrP substrates expressed in HEK293 cells, as aberrant processing may affect conversion efficiency. Furthermore, both reviewers strongly recommend to include robust quantification of western blot signals and statistical analysis when conversion efficiencies are compared (e.g. Fig. 3B and Fig. 7). We cannot make any decision about publication until we <span class="Species">have seen the revised manuscript and your respn>onse to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to the review comments and a description of the c<span class="Species">hanges you <span class="Species">have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. [2] Two versions of the revised manuscript: one with either highlights or tracked c<span class="Species">hanges denoting where the text <span class="Species">has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note t<span class="Species">hat revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts. T<span class="Species">hank you again for your submission. We hope t<span class="Species">hat our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Sabine Gilch, PhD Pearls Editor PLOS Pathogens <span class="Chemical">Michael Malim Section Editor PLOS Pathogens Kasturi <span class="Species">Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X <span class="Chemical">Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************** Reviewer's Responses to Questions Part I - Summary Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and s<span class="CellLine">cholarship. Reviewer #1: The manuscript by Burke et al. uses an in vitro conversion system to study the conversion of normal cellular <span class="Gene">prion protein (<span class="Gene">PrPC) from mice (Mo) or bank voles (BV) by a protein only form of recombinant mouse PrPSc (recPrPSc). They show that recPrPSc converts bank vole, but not mouse, PrPC to PrPSc. They further show that BV amino acid residues 227 and 230 are needed for recPrPSc to convert PrPC as is lack of glycosylation at the second glycosylation site (G2) in PrPC. They conclude that residues 227, 230 and a lack of glycosylation at G2 comprise a C-terminal domain that acts as a “linchpin” for conversion of PrPC to PrPSc. This is a relatively straightforward study looking at the ability of an artificially made <span class="Species">mouse <span class="Species">prion, protein only recPrPSc, to convert mouse PrPC. While the data and design are appropriate, it’s not clear that an artificially generated prion which does not convert its native substrate to PrPSc is a valid system to study the conversion mechanism of natural prions. The argument that the inability of recPrPSc to convert mouse PrPC enables the study of important conformational determinants without taking into consideration amino acid sequence does not make much logical sense. The primary sequence of a protein is intimately tied to conformation, and earlier studies have already made the point that conformational differences driven by amino acid sequence significantly impact PrPSc formation. Reviewer #2: In this study, Burke et al utilized a previously developed yet unique in vitro PrPSc amplification system to identify the extreme C-terminus of <span class="Species">Bank Vole PrPC, namely amino acid residues E227 and S230, as the linchpin for prion conversion, which is a significant advance in our understanding of prion protein misfolding and formation of PrPSc. The results are solid and the manuscript is well written. Reviewer #3: Burke et al investigated the <span class="Species">molecular <span class="Gene">PrP domains involved in the conversion of bank vole PrPC by prions formed from recombinant PrP of mouse origin (Mo-recPrPSc). By studying the convertibility of chimeric mouse/bank vole PrP by Mo-recPrPSc seeds in PMCA reactions, the authors identified the extreme C-terminal region of PrPC as an important domain controlling PrP conversion. The conclusions are partly supported by the data. ********** Part II – Major Issues: Key Experiments Required for Acceptance Please use this section to detail the key new experiments or <span class="Species">modifications of existing experiments t<span class="Species">hat should be absolutely required to validate study conclusions. Generally, there should be no <span class="Species">more t<span class="Species">han 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject". Reviewer #1: 1) All of the <span class="Species">Mo-BV chimeric constructs are expressed in <span class="CellLine">HEK 293 cells. However, no data are shown to indicate whether or not the various chimeras are processed normally, i.e. fully glycosylated, GPI anchored, and expressed on the cell surface. Aberrant processing of the chimeric PrPC molecules, especially those with mutations at 227 and 230 in the C-terminus where the GPI anchor is attached, could affect their ability to convert to PrPSc. The authors should provide information on whether or not the chimeras tested were appropriately processed by the cell. 2) Based on the data in Fig. 3B, the author states t<span class="Species">hat the BV(DR) substrate with two amino acid c<span class="Species">hanges converts less well than the BV(LDR) and BV(YDR) substrates with 3 amino acid substitutions (compare row 2 to rows 6 and 7). However, this is not clear from the data shown in Figure 3 since the signal intensities on the gels shown are very similar. If possible, the authors should include quantitation data to show this more convincingly. 3) In Figure 7, rec<span class="Gene">PrPSc does not convert the BV(DR) construct to <span class="Gene">PrPSc. However, in Figure 3 it does convert BV(DR), albeit at a lower efficiency. This suggests some variability in conversion efficiency between experiments that the authors should address. 4) In Figure 7, conversion of mouse (ES) by <span class="Species">hamster, sheep, and deer PrPSc brain homogenate yields conversion products in the first 2 rounds that are protease-resistant but do not appear to decrease in size. By the third round, there does appear to be some protease-resistant, truncated product in the sheep and deer reactions. Do the authors have any explanation for why Mo(ES) appears to be fully protease resistant through two rounds of sPMCA only to become partially protease-resistant by the third round? 5) A <span class="Species">mouse <span class="Gene">PrPC substrate where the two glycosylation sites have been mutated yielding an unglycosylated product (G3) is not converted to PrPSc by recPrPSc. How does this result impact interpretation of the other experiments in the paper, all of which use partially purified, PNGaseF treated, deglycosylated PrPC substrate? If fully glycosylated PrPC substrate is used, how does that effect the ability of protein only recPrPSc to convert the substrate to PrPSc? Reviewer #2: <span class="Species">Prion conversion is a very complex process and many factors contribute to it, and the main influencer is <span class="Gene">PrP sequence. The current study identifies E227 and S230 as the key amino acids that make Bank Vole PrPC the almost universal substrate for prion conversion by a variety of prion strains, including the in vitro formed protein-only recombinant PrPSc. Although the substitutions of D227 and R230 of mouse PrPC to E227 and S230, respectively, render the mouse chimeric PrPC susceptibility to various prion strains, which strongly supports the key role of E227 and S230, it requires more evidence to conclude such domain as the “general” linchpin for prion conversion, since the only two PrPC species investigated are Bank Vole and mouse. It would be much more convincing if hamster PrPC with E227 and D230 mutations could also be converted by RML, Scrapie and CWD. Reviewer #3: The conclusions are partly supported by the data: 1. Because all the study is based on the difference of <span class="Gene">PrPSc levels in the PMCA products over serial rounds, the manuscript should include robust quantification and statistical analysis of <span class="Gene">PrPSc when mutation effects are compared. This is especially important as i) there is no indication on the reproducibility of the experiments shown, ii) <span class="Gene">PrPSc abundance is generally low in the western blots (compare for instance Fig3 panel B, 2nd vs 3rd lane to measure the effect of the S170 substitution, a key residue of the discussion), iii) PrPres electrophoretic pattern and contribution of initial PrPSc seed to the PrPSc signal detected in the first round are difficult to estimate. 2. The PrPres electrophoretic patterns are difficult to identify. The pattern is frequently polluted by bands of low Mr. Someti<span class="Chemical">mes PK digestion are insufficient, resulting in PrPres patterns migrating like PrPC (see Fig 7 last lane for instance). The pattern is not consistent among the experiments, compare for instance RML seed with Bank vole PrPC fin Fig7B first lane and Fig 2A first lane. 3. The authors expressed chimeric <span class="Gene">PrPC in <span class="Species">human HEK293 cells and purified PrPC before using it as substrate in PMCA experiments: 3.1 The authors do not mention whether these cells express or not <span class="Species">human <span class="Gene">PrPC. Human PrPC could be converted or interfere with chimeric PrP in PMCA reactions. 3.2 Chimeric <span class="Gene">PrPC is partly deglycosylated with <span class="Gene">PNGase F (which usually works on denatured material containing SDS?) before use as substrate. Partial deglycosylation may impact the relative convertibility of the chimeric species. In favor of this hypothesis, the authors show that removing one glycan on mouse PrPC facilitates conversion by Mo-recPrPSc, without any other amino acid mutation. 3.3 <span class="Gene">HEK cells are likely to express variable a<span class="Species">mounts of PrPC depending on the mutation performed. There is no indication on the concentration of PrPC used in the PMCA reaction. This is a key point as other authors showed that efficient conversion of cell PrPC substrate in PMCA requires concentrated material (PMID: 27384922). In other words, conversion may fail because of insufficient PrP levels, not mutation. 4. The added value of performing experiments on <span class="Gene">PrPC glycosylation mutants and on �<span class="Gene">GPI PrPC from transgenics is uncertain. For me, it is a different story. Regarding �<span class="Gene">GPI <span class="Gene">PrPC, another confounding issue is that these mice spontaneously accumulate PrPSc. This may interfere with the PMCA reaction. In addition, PrPC from these mice is lowly glycosylated and this may also impact the conversion by Mo-recPrPSc. Thus ,the relative contribution of the GPI anchor is highly uncertain. Regarding the second c<span class="Species">hapter of the discussion (starting with “It is worth noting”) stating that residues E227 and S230 might stabilize PrPC, making it less prone to conversion (do the authors mean self-conversion or templated conversion?). How do the authors reconciliate this idea with the observation that I109 polymorphism is sufficient for spontaneous bank vole PrPC conversion into prions? ********** Part III – Minor Issues: Editorial and Data Presentation <span class="Species">Modifications Please use this section for editorial suggestions as well as relatively minor <span class="Species">modifications of existing data t<span class="Species">hat would enhance clarity. Reviewer #1: The figure legend to Figure 7 describes panel C but this panel is not in the figure shown. This should be corrected. Reviewer #2: Minor points: 1. One of the limitations of this study, as the authors <span class="Species">have pointed in the discussion part, is the lack of a way to confirm the infectivity of various chimeric <span class="Gene">PrPSc produced in the PMCA reactions. The authors argue that “However, we have previously shown that similar reactions containing BV PrPC substrate and seeded with protein-only recPrPSc produces fully infectious prions, making it likely that we are also studying a process relevant to infectious prion formation in this study”. While it is impractical to ask for in vivo bioassays, the author may consider evaluating the seeding ability of various chimeric PrPSc by using BV and mouse brain homogenates containing WT PrPC as substrates in PMCA reactions, which could serve as the prion infectivity surrogate. 2. In figure 1, the numbering for all PrP sequences follows the <span class="Species">hamster PrPC sequence (23-231). However, in figure 8, the numbering follows mouse PrP sequence (23-230). 3. In figure 5B, <span class="Species">Mo(N155N150ES) on the third row should be <span class="Species">Mo(N155N170ES). Reviewer #3: - Please add page and lanes number to facilitate the comments. - The introduction is conveying incomplete information, particularly for a general audience: As examples: - Introduction, 2nd chapter, about the transmission barriers. “<span class="Species">Humans are susceptible to CJD…”. This is obvious and not an example of a cross-species transmission. 2nd sentence: “…but not to CWD or scrapie”. The references mentioned here refer to transgenic modelling to study whether human PrP can be converted by CWD or scrapie. Whether humans are in fine susceptible or not, we do not know. They are counter-examples of conversion, see for instance the work published by Cassard et al. (PMID: 25510416 ), same for CWD with studies in primates. - Resuming the species to a paper from 1999 by S. Priola is a big shortcut. The topics would deserve <span class="Species">more than that. Transmission barriers are more than “dictated by amino acid sequence complementarity between the incoming PrPSc seed and PrPC substrate”. There are remarkable examples showing that the strain type is a key determinant too. For example, propagation of human CJD in bank vole without species barrier, efficacy of atypical BSE to propagate in human PrP mice, while classical BSE does not, etc. The description of the transmission barrier is too simplistic. ********** PLOS authors <span class="Species">have the option to publish the peer review history of their article (w<span class="Species">hat does this mean?). If published, this will include your full peer review and any attached files. If you <span class="CellLine">choose “no”, your identity will remain anony<span class="Species">mous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this <span class="CellLine">choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure t<span class="Species">hat figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or <span class="Species">have any questions when using PACE, please email us at . Data Requirements: Please note t<span class="Species">hat, as a condition of publication, PLOS' data policy requires t<span class="Species">hat you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To en<span class="Species">hance the reproducibility of your results, PLOS recommends t<span class="Species">hat you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see 13 Jul 2020 Submitted filename: Point-by-point response v6.docx Click here for additional data file. 1 Aug 2020 Dear Dr. Supattapone, T<span class="Species">hank you very much for submitting a revised version of your manuscript "Identification of a Ho<span class="Species">mology-Independent Linchpin Domain Controlling Mouse and Bank Vole Prion Protein Conversion" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. All reviewers appreciated the extent of your revisions. We are likely to accept this manuscript for publication, but ask you to address a minor concern raised by reviewer 1. While they were satisfied with removal of the Mo(N170ES) chimera from the data sets, they noted that reference to this constructs needs to be removed from both Table 1 and SFig. 1. Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to all review comments, and a description of the c<span class="Species">hanges you <span class="Species">have made in the manuscript. Please note while forming your response, if your article is accepted, you may <span class="Species">have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your respn>onses to reviewer comments. If eligible, we will contact you to opt in or out [2] Two versions of the revised manuscript: one with either highlights or tracked c<span class="Species">hanges denoting where the text <span class="Species">has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. T<span class="Species">hank you again for your submission to our journal. We hope t<span class="Species">hat our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Sabine Gilch, PhD Pearls Editor PLOS Pathogens <span class="Chemical">Michael Malim Section Editor PLOS Pathogens Kasturi <span class="Species">Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X <span class="Chemical">Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************** Reviewer Comments (if any, and for reference): Reviewer's Responses to Questions Part I - Summary Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and s<span class="CellLine">cholarship. Reviewer #1: Overall, the authors <span class="Species">have satisfactorily addressed the concerns in my original review. Reviewer #2: The authors addressed my concerns. Reviewer #3: The revised version of the manuscript by Burke et al. <span class="Species">has been significantly improved by providing additional information and results and quantification of the effects of amino acids substitution on the conversion process. The discussion <span class="Species">has also been significantly improved. I <span class="Species">have no <span class="Species">more specific concerns. ********** Part II – Major Issues: Key Experiments Required for Acceptance Please use this section to detail the key new experiments or <span class="Species">modifications of existing experiments t<span class="Species">hat should be absolutely required to validate study conclusions. Generally, there should be no <span class="Species">more t<span class="Species">han 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject". Reviewer #1: None Reviewer #2: The authors addressed my concerns. Reviewer #3: (No Response) ********** Part III – Minor Issues: Editorial and Data Presentation <span class="Species">Modifications Please use this section for editorial suggestions as well as relatively minor <span class="Species">modifications of existing data t<span class="Species">hat would enhance clarity. Reviewer #1: In response to my concern about whether or not the mutant PrP <span class="Species">molecules were appropriately processed by the cell, the authors added new supporting information in SFig 1 and SFig 4, and removed the chimera Mo(N170ES) from the data set. This is fine and addresses my concerns, but the chimera Mo(N170ES) is still in both Table 1 and SFig. 1. These references to this construct may need to be removed as well. Reviewer #2: The authors addressed my concerns. Reviewer #3: (No Response) ********** PLOS authors <span class="Species">have the option to publish the peer review history of their article (w<span class="Species">hat does this mean?). If published, this will include your full peer review and any attached files. If you <span class="CellLine">choose “no”, your identity will remain anony<span class="Species">mous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this <span class="CellLine">choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure t<span class="Species">hat figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or <span class="Species">have any questions when using PACE, please email us at . Data Requirements: Please note t<span class="Species">hat, as a condition of publication, PLOS' data policy requires t<span class="Species">hat you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To en<span class="Species">hance the reproducibility of your results, PLOS recommends t<span class="Species">hat you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see 1 Aug 2020 Submitted filename: Response Letter 2.docx Click here for additional data file. 11 Aug 2020 Dear Dr. Supattapone, We are pleased to inform you t<span class="Species">hat your manuscript 'Identification of a Ho<span class="Species">mology-Independent Linchpin Domain Controlling Mouse and Bank Vole Prion Protein Conversion' has been provisionally accepted for publication in PLOS Pathogens. Before your manuscript can be formally accepted you will need to complete some formatting c<span class="Species">hanges, which you will receive in a follow up email. A member of our team will be in touch with a set of requests. Please note t<span class="Species">hat your manuscript will not be scheduled for publication until you <span class="Species">have made the required changes, so a swift response is appreciated. IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major c<span class="Species">hanges, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript. Should you, your institution's press office or the journal office <span class="CellLine">choose to press release your paper, you will automatically be opted out of early publication. We ask t<span class="Species">hat you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS. T<span class="Species">hank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Sabine Gilch, PhD Pearls Editor PLOS Pathogens <span class="Chemical">Michael Malim Section Editor PLOS Pathogens Kasturi <span class="Species">Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X <span class="Chemical">Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************************************************** Reviewer Comments (if any, and for reference): 2 Sep 2020 Dear Dr. Supattapone, We are delighted to inform you t<span class="Species">hat your manuscript, "Identification of a Ho<span class="Species">mology-Independent Linchpin Domain Controlling Mouse and Bank Vole Prion Protein Conversion," has been formally accepted for publication in PLOS Pathogens. We <span class="Species">have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication. The corresponding author will soon be receiving a typeset proof for review, to ensure errors <span class="Species">have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last c<span class="Species">hance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly. Soon after your final files are uploaded, the early version of your manuscript, if you opted to <span class="Species">have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. T<span class="Species">hank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Kasturi <span class="Species">Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X <span class="Chemical">Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064
  56 in total

1.  Cofactor molecules maintain infectious conformation and restrict strain properties in purified prions.

Authors:  Nathan R Deleault; Daniel J Walsh; Justin R Piro; Fei Wang; Xinhe Wang; Jiyan Ma; Judy R Rees; Surachai Supattapone
Journal:  Proc Natl Acad Sci U S A       Date:  2012-06-18       Impact factor: 11.205

2.  Altered glycosylated PrP proteins can have different neuronal trafficking in brain but do not acquire scrapie-like properties.

Authors:  Enrico Cancellotti; Frances Wiseman; Nadia L Tuzi; Herbert Baybutt; Paul Monaghan; Lorraine Aitchison; Jennifer Simpson; Jean C Manson
Journal:  J Biol Chem       Date:  2005-10-11       Impact factor: 5.157

3.  Generating a prion with bacterially expressed recombinant prion protein.

Authors:  Fei Wang; Xinhe Wang; Chong-Gang Yuan; Jiyan Ma
Journal:  Science       Date:  2010-01-28       Impact factor: 47.728

4.  A domain responsible for spontaneous conversion of bank vole prion protein.

Authors:  Atsushi Kobayashi; Yuichi Matsuura; Atsuko Takeuchi; Masahito Yamada; Ichiro Miyoshi; Shirou Mohri; Tetsuyuki Kitamoto
Journal:  Brain Pathol       Date:  2018-10-29       Impact factor: 6.508

5.  Conversion efficiency of bank vole prion protein in vitro is determined by residues 155 and 170, but does not correlate with the high susceptibility of bank voles to sheep scrapie in vivo.

Authors:  Niklas Piening; Romolo Nonno; Michele Di Bari; Stephanie Walter; Otto Windl; Umberto Agrimi; Hans A Kretzschmar; Uwe Bertsch
Journal:  J Biol Chem       Date:  2006-02-02       Impact factor: 5.157

6.  Probing structural differences between PrP(C) and PrP(Sc) by surface nitration and acetylation: evidence of conformational change in the C-terminus.

Authors:  Binbin Gong; Adriana Ramos; Ester Vázquez-Fernández; Christopher J Silva; Jana Alonso; Zengshan Liu; Jesús R Requena
Journal:  Biochemistry       Date:  2011-05-11       Impact factor: 3.162

7.  Structural effects of PrP polymorphisms on intra- and interspecies prion transmission.

Authors:  Rachel Angers; Jeffrey Christiansen; Amy V Nalls; Hae-Eun Kang; Nora Hunter; Edward Hoover; Candace K Mathiason; Michael Sheetz; Glenn C Telling
Journal:  Proc Natl Acad Sci U S A       Date:  2014-07-17       Impact factor: 11.205

8.  Isolation of phosphatidylethanolamine as a solitary cofactor for prion formation in the absence of nucleic acids.

Authors:  Nathan R Deleault; Justin R Piro; Daniel J Walsh; Fei Wang; Jiyan Ma; James C Geoghegan; Surachai Supattapone
Journal:  Proc Natl Acad Sci U S A       Date:  2012-05-14       Impact factor: 11.205

9.  Full restoration of specific infectivity and strain properties from pure mammalian prion protein.

Authors:  Cassandra M Burke; Daniel J Walsh; Alexander D Steele; Umberto Agrimi; Michele Angelo Di Bari; Joel C Watts; Surachai Supattapone
Journal:  PLoS Pathog       Date:  2019-03-25       Impact factor: 6.823

10.  Prion protein amino acid determinants of differential susceptibility and molecular feature of prion strains in mice and voles.

Authors:  Umberto Agrimi; Romolo Nonno; Giacomo Dell'Omo; Michele Angelo Di Bari; Michela Conte; Barbara Chiappini; Elena Esposito; Giovanni Di Guardo; Otto Windl; Gabriele Vaccari; Hans-Peter Lipp
Journal:  PLoS Pathog       Date:  2008-07-25       Impact factor: 6.823

View more
  3 in total

1.  A single amino acid residue in bank vole prion protein drives permissiveness to Nor98/atypical scrapie and the emergence of multiple strain variants.

Authors:  Laura Pirisinu; Michele Angelo Di Bari; Claudia D'Agostino; Ilaria Vanni; Geraldina Riccardi; Stefano Marcon; Gabriele Vaccari; Barbara Chiappini; Sylvie L Benestad; Umberto Agrimi; Romolo Nonno
Journal:  PLoS Pathog       Date:  2022-06-22       Impact factor: 7.464

2.  Site-specific analysis of N-glycans from different sheep prion strains.

Authors:  Natali Nakić; Thanh Hoa Tran; Mislav Novokmet; Olivier Andreoletti; Gordan Lauc; Giuseppe Legname
Journal:  PLoS Pathog       Date:  2021-02-18       Impact factor: 6.823

Review 3.  Recombinant Mammalian Prions: The "Correctly" Misfolded Prion Protein Conformers.

Authors:  Jiyan Ma; Jingjing Zhang; Runchuan Yan
Journal:  Viruses       Date:  2022-08-31       Impact factor: 5.818

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.