Literature DB >> 32848463

microRNA-26a Directly Targeting MMP14 and MMP16 Inhibits the Cancer Cell Proliferation, Migration and Invasion in Cutaneous Squamous Cell Carcinoma.

Wang Zheng1, Zong-Yu Li1, De-Lai Zhao1,2, Xing-Long Li1,2, Rui Liu3.   

Abstract

PURPOSE: To investigate the specific effect and underlying mechanism of microRNA-26a-5p (miR-26a) in cutaneous squamous cell carcinoma (CSCC).
METHODS: miR-26a and MMP14/16 mRNA expression were detected by qRT-PCR analysis. Functional experiments were used to detect the role of miR-26a on CSCC progression. Western blot was used for protein detection. Luciferase assay was used to detect miR-26a directly targeting MMP14 and MMP16. Xenograft nude mice model was used to determine the effect of miR-26a on tumorigenesis.
RESULTS: miR-26a was decreased in CSCC tissues and cells. Forced miR-26a suppressed the progression of SCL-1 and A431 cells. Furthermore, miR-26a directly targeted MMP14 and MMP16 to inhibit their expression. Forced expression of MMP14 and MMP16 removed the miR-26a's inhibitory effect on CSCC development. The in vivo tumor growth assay showed that miR-26a suppressed CSCC tumorigenesis by targeting MMP14 and MMP16.
CONCLUSION: Our study suggested miR-26a inhibits cancer cell proliferation, migration and invasion in CSCC by targeting MMP14 and MMP16.
© 2020 Zheng et al.

Entities:  

Keywords:  MMP14; MMP16; cutaneous squamous cell carcinoma; miR-26a; tumorigenesis

Year:  2020        PMID: 32848463      PMCID: PMC7429404          DOI: 10.2147/CMAR.S265775

Source DB:  PubMed          Journal:  Cancer Manag Res        ISSN: 1179-1322            Impact factor:   3.989


Introduction

Cutaneous squamous cell carcinoma (CSCC) is a malignant skin tumor with a high morbidity.1 At present, the diagnosis of CSCC mainly depends on the diagnosis of skin histopathology.2 The treatment options include surgical treatment, radiotherapy and photodynamic therapy, but there are still no effective indicators for early diagnosis and targeted therapy.3 Therefore, it is of great significance to actively explore the molecular mechanism of CSCC at the molecular level and lay the foundation for targeted therapy against tumor generation. MicroRNAs (miRNAs) are highly conserved small RNA with a length of less than 19–25 nucleotides in eukaryotes.4 The main mechanism of its function is to partially or completely complement the 3ʹ non-translation regions of target genes, cut the transcriptional products of target genes or inhibit the translation of transcriptional products.5 Each miRNA can regulate the expression of different genes, and each gene can be regulated by multiple miRNAs. MiRNAs are involved in regulating various life processes, such as embryonic development, organ differentiation, cell metabolism and growth.6 Studies have found that miRNAs contribute to the occurrence and development of various diseases, especially tumors.7 Many miRNAs regulate cell proliferation, differentiation and other functions, and abnormal expression of such miRNAs may lead to the development of tumors. For example, miR-21 is associated with the occurrence and migration of liver cancer.8 MiR-107 inhibits the development of lung cancer by inducing cell cycle arrest.9 Studies have shown that microRNA-26a-5p (miR-26a) can promote autophagy of myocardial cells to combat the injury of myocardial infarction and has an important role in myocardial protection.10 What is more, microarray miRNA expression profiling showed a significant decrease of miR-26a in CSCC.11 At the same time, miR-26a can inhibit the WNT signaling pathway, thus inhibiting the metastasis of thyroid cancer.12 However, no studies have been reported on the role of miR-26a in CSCC. In the process of tumor progression, migration and invasion are two important steps of tumor cell metastasis. Matrix metalloproteinases (MMPs) can hydrolyze a variety of extracellular matrix components and assist tumor cells to remove obstacles, thus facilitate the invasion and metastasis of tumor cells.13,14 At present, MMPs effects in tumor progression have attracted extensive attention. It has been shown that the high expression of MMP2 and MMP9 in glioma facilitates the metastasis to the skin.15 In ovarian cancer, high expression of BCL9 can reduce the levels of MMP2 and MMP9, thus inhibiting the migration and invasion activities.16 In addition, MMP14 and MMP16 also play important roles in the development of multiple tumors.17–20 However, whether miR-26a regulates MMPs in CSCC remains elusive. The purpose of our study was to clarify the specific function of miR-26a in CSCC and to further clarify the regulation of miR-26a on MMPs.

Patients and Methods

Patients

The surgical specimens of 40 CSCC patients from our hospital were collected, which were used for follow-up experimental detection. All procedures were approved by the Clinical Research Ethics Committee of The Fifth Hospital of Harbin. All patients provided written informed consent and the study was conducted in accordance with the Declaration of Helsinki.

Cell Culture

Cell lines were purchased from CHI Scientific, Inc (Jiangsu, China). The cells were cultured with complete medium including 89% 1640 and 10% FBS, both were purchased from Biological Industries (Beit-Haemek, Israel), and maintained in an incubator with 37°C and 5% of CO2 saturated humidity. A431 and SCL-1 cells were transfected with 50nM oligonucleotides or vectors using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. AgomiR-26a, miR-26a inhibitor, pcDNA3.1-MMP14/MMP16 overexpression vector (MMP14/MMP16)17,21,22 were synthesized by Genepharma (Shanghai, China).

qRT-PCR

RNA extraction was performed using TRIzol reagent. NanoDrop 8000 (Thermo Scientific, Waltham, MA, USA) used for detecting RNA concentration. The single-stranded cDNAs were synthesized from 1 μg of RNA. The expression of mRNAs and miRNAs were quantified by RT-PCR. Primers list: miR-26a (F: GCGTAGCAGCGGGAACAGT, R: CCAGTGCGTGTCGTGGAGT), U6 (F: CGCTTCACGAATTTGCGTGTCAT, R: GCTTCGGCACATATACTAAAAT), MMP14 (F: GCCTTGGACTGTCAGGAATG, R: AGGGGTCACTGGAATGCTC), MMP16 (F: TCACAGCGGATTTGGACAA, R: AATGCGAATAGCGACGTTCT). GAPDH (F: GGATATTGTTGCCATCAATGACC, R: AGCCTTCTCCATGGTGGTGAAGA).

Western Blot

After RIPA cleavage, we extracted total protein and measured with BCA method. After quantitative denaturation, protein electrophoresis membrane transfer and blocked. The first incubation and second incubation were carried out according to the operation steps. The expression of the protein was expressed by the gray value. Primary antibodies list: Bcl2 (14,552-1-AP), Bax (50,599-2-Ig), cleaved-caspase 3 (25,546-1-AP), MM14 (14,552-1-AP) and GAPDH (60,004-1-Ig). And MMP16 (ab73877) were purchased from Abcam.

Cell Proliferation Detection

Cells were plated in 96-well plates and we used CCK8 assay to detect the cell viability. CCK8 (10 nmol/L; Beyotime Biotechnology, China) was added after curcumin treatment and incubated at 37°C. We measured the absorbance of 450 nm at 24, 48 and 72 h.

Cell Migration Assay

The cells were spread in a 6-well plate, and when they grew to 80%, horizontal lines were drawn in the cells with a ruler at an interval of 0.5 cm, with 4 lines drawn in each well. The cells were washed with PBS for 3 times. Serum-free culture medium was added and photoed for 0 hours. The cells were continuously cultured for 24 hours before the photo was taken.

Cell Invasion Assay

First, the Matrigel was spread over the Transwell, and the starved cells for 12 hours were inoculated into the upper chamber. The culture medium with serum was added to the lower chamber and cultured for 12 hours. The Transwell was taken out, the culture medium was discarded. And Transwell was washed using PBS, and fixed with methanol for 30 min. After the chamber was dried, the cells were stained with crystal violet for 20 min, and the upper cells were removed and washed with PBS for 3 times. The cells were photographed and counted under the microscope.

Luciferase Reporter Assay

Luciferase reporter plasmid (WT or mut MMP14/16) and miR-26a or miR-NC was co-transfected into HEK293 cells for 48 h. Then, cells were lysed and the luciferase activity was determined using Luciferase Reporter Gene Assay Kit (Promega) according to the instruction. WT MMP14: … UGUUGGGGGCUCUGCACUUGAAG …, Mut MMP14: … UGUUGGGGGCUCUGCCAGGUCCG …. WT MMP16: … AAAAAAAACCUCAAAUACUUGAA …, Mut MMP16: AAAAAAAAAAGCAAAGCAGGUCC

Apoptosis Detection

The Annexin V-FITC/PI apoptosis kit was purchased from Solebao Company (Beijing, China), and an appropriate amount of logarithmic growth phase cells were washed twice with pre-cooled PBS. The cells were suspended with 500 ul of bound buffer, mixed with 5 ul of annexin V-FITC and PI, respectively, and placed at 25°C for 15 min.

Enzyme Linked Immunosorbent (ELISA) Assay

The supernatant MMP14 and MMP16 was detected using ELISA kits (Invitrogen). According to the instructions, the samples were added to the 96-well plate and incubated at 37°C for 90 min. Discard the liquid, add the detection solution and incubate for 1 hour. Discard the liquid, wash for 3 times. Add working solution and incubate for 30 min. Discard the liquid, wash for 5 times. Add substrate solution to react for 15 min. Then, add termination solution and measure absorbance value at 450nm.

In vivo Tumor Growth Assay

Animal experiments were permitted by the Animal Protection and Ethics Committee. BALB/c nude mice (6–8 weeks) were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. (Beijing, China). For the experiment of Xenograft, CSCC cell cells (5 × 106) were suspended in 200 μL normal saline and subcutaneously injected or through tail vein. Tumor volume (mm3): V (Mm3) = S2 (Mm2) × L (Mm)/2.

Institutional Animal Care and Use Committee Statement

All experimental protocols were approved by the Animal Research Ethical Committee of the Fifth Hospital of Harbin and were performed in accordance with National Institutes of Health guide for the care and use of laboratory animals (NIH Publications No. 8023, revised 1978). All efforts were made to utilize only the minimum number of animals necessary to produce reliable scientific data. All animal experimentation was taken place in the Fifth Hospital of Harbin.

Statistical Analysis

Significant differences were calculated using two-tailed t-test through Graphpad 7.0 and SPSS 22.0.

Results

miR-26a is Decreased in CSCC Clinical Samples and Cells

To illuminate the regulatory function of miR-26a, we firstly detected its expression in CSCC. miR-26a decreased in cancer tissues than normal tissues (Figure 1A). Also, the level of miR-26a was seriously inhibited in SCL-1, A431 cells than that in HaCaT keratinocytes (Figure 1B).
Figure 1

Expression of miR-26a in CSCC tissue and cells. (A) The expression of miR-26a in CSCC tissues (n = 40) and adjacent normal tissues (n = 40) determined by qRT-PCR (**p<0.01). (B) qRT-PCR assay analyzed the expression of miR-26a in HaCaT and CSCC cells SCL-1 and A431 (**p<0.01 vs HaCaT). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

Expression of miR-26a in CSCC tissue and cells. (A) The expression of miR-26a in CSCC tissues (n = 40) and adjacent normal tissues (n = 40) determined by qRT-PCR (**p<0.01). (B) qRT-PCR assay analyzed the expression of miR-26a in HaCaT and CSCC cells SCL-1 and A431 (**p<0.01 vs HaCaT). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

miR-26a Restrains Proliferation but Induces CSCC Cell Apoptosis

To clarify the miR-26a effects in CSCC, we forced miR-26a expression in SCL-1 and A431 cells (Figure 2A). Follow-on CCK-8 assay exhibited that miR-26a arrestingly inhibited cell growth in SCL-1 and A431 cells (Figure 2B). Besides, flow cytometry showed that miR-26a significantly induced CSCC cell apoptosis (Figure 2C). Also, miR-26a increased Bax and caspase3 expression but inhibited Bcl2 protein (Figure 2D).
Figure 2

Forced expression of miR-26a inhibits proliferation, but promotes apoptosis in SCL-1 and A431 cells. (A) The expression of miR-26a was determined by qRT-PCR (**p<0.01). (B) CKK-8 assay was used to examine the cell growth at 0, 24, 48 and 72 h in SCL-1 and A431 cells. (*p<0.05). (C) The apoptosis of cells was calculated by flow cytometry (**p<0.01). (D) Western blot was performed to detected the expression of apoptosis-related protein Bcl 2, Bax and C-casp 3 (cleaved caspase-3). (*p<0.05). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

Forced expression of miR-26a inhibits proliferation, but promotes apoptosis in SCL-1 and A431 cells. (A) The expression of miR-26a was determined by qRT-PCR (**p<0.01). (B) CKK-8 assay was used to examine the cell growth at 0, 24, 48 and 72 h in SCL-1 and A431 cells. (*p<0.05). (C) The apoptosis of cells was calculated by flow cytometry (**p<0.01). (D) Western blot was performed to detected the expression of apoptosis-related protein Bcl 2, Bax and C-casp 3 (cleaved caspase-3). (*p<0.05). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

miR-26a Reduces Migration and Invasion of CSCC Cells

Migration and invasion are the vital processes for tumor growth. And our followed data showed that miR-26a reduced the migrative and invasive ability of SCL-1 and A431 cells (Figure 3A and B). Taken together, miR-26a was involved in the progress of CSCC.
Figure 3

miR-26a suppresses migration and invasion in CSCC cells. miR-26a or its NC was transfected into SCL-1 and A431 cells. (A) Wound healing assay was used to detect cell migration (*p<0.05). (B) Transwell assay was performed to check cell invasive ability (*p<0.05). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

miR-26a suppresses migration and invasion in CSCC cells. miR-26a or its NC was transfected into SCL-1 and A431 cells. (A) Wound healing assay was used to detect cell migration (*p<0.05). (B) Transwell assay was performed to check cell invasive ability (*p<0.05). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

miR-26a Directly Targets MMP14 and MMP16

The data from Targetscan showed that the 3ʹUTR of MMP14 and MMP16 possessed a directed target site for miR-26a (Figure 4A). And luciferase activity of WT MMP14 and MMP16, but not mutant MMP14 and MMP16, was decreased in the miR-26a (Figure 4B). Furthermore, miR-26a significantly reduced the expression of MMP14 and MMP16, while miR-26a inhibitor increased their expression level in SCL-1 cells (Figure 4C). In accordance with PCR data, Western blot results exhibited a decrease of MMP14 and MMP16 in miR-26a upregulation cells, and an increase in miR-26a downregulation cells (Figure 4D). As well, miR-26a reduced the supernatant MMP14 and MMP16 while miR-26a inhibitor induced the MMP14 and MMP16 level (Figure 4E). These data suggested that MMP14 and MMP16 might be the targets of miR-26a in CSCC modification.
Figure 4

MMP14 and MMP16 are direct targets of miR-26a. (A) The paired bases of miR-26a with MMP14 and MMP16 and Western blot (B) WT and mutant MMP14 or MMP16 luciferase plasmids were transfected into HEK293 cells with miR-NC or miR-26a. The luciferase activity was measured by dual-luciferase reporter assay system. (*p<0.05). AgomiR-26a or miR-26a inhibitor or its NC was transfected into SCL-1 cells. (C) The mRNA level of MMP14 and MMP16 was analyzed by qRT-PCR (*p<0.01). (D) Western blot was performed to detect MMP14 and MMP16 protein expression (*p<0.05). (E) ELISA assay was used to determine the activity of MMP14 and MMP16 in cell supernatant (*p<0.05). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

MMP14 and MMP16 are direct targets of miR-26a. (A) The paired bases of miR-26a with MMP14 and MMP16 and Western blot (B) WT and mutant MMP14 or MMP16 luciferase plasmids were transfected into HEK293 cells with miR-NC or miR-26a. The luciferase activity was measured by dual-luciferase reporter assay system. (*p<0.05). AgomiR-26a or miR-26a inhibitor or its NC was transfected into SCL-1 cells. (C) The mRNA level of MMP14 and MMP16 was analyzed by qRT-PCR (*p<0.01). (D) Western blot was performed to detect MMP14 and MMP16 protein expression (*p<0.05). (E) ELISA assay was used to determine the activity of MMP14 and MMP16 in cell supernatant (*p<0.05). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

miR-26a Suppresses the Progression of CSCC by Targeting MMP14 and MMP16

We then forced MMP14 and MMP16 expression in SCL-1 cells (Figure 5A and B). Functionally,
Figure 5

miR-26a inhibits proliferation, migration and invasion by targeting MMP14 and MMP16. MMP14 or MMP16 plasmid or its NC was transfected into SCL-1 cells. qRT-PCR (A) and Western blot (B) was used to detect the transfection efficiency of MMP14 or MMP16 (*p<0.05, **p<0.01 vs NC). (C) The apoptosis of cells was calculated by flow cytometry in SCL-1 cells (*p<0.05 vs agomiR-26a, #p<0.05 vs agomiR-26a+MMP14 and agomiR-26a+MMP16). (D) Western blot was performed to detected the expression of apoptosis-related protein Bcl 2, Bax and C-casp 3 (cleaved caspase-3) (*p<0.05 vs agomiR-26a, #p<0.05 vs agomiR-26a+MMP14 and agomiR-26a+MMP16). (E) Wound healing assay was used to detect cell migration (*p<0.05 vs agomiR-26a, #p<0.05 vs agomiR-26a+MMP14 and agomiR-26a+MMP16). (F) Transwell assay was performed to check cell invasive ability (*p<0.05 vs agomiR-26a, #p<0.05 vs agomiR-26a+MMP14 and agomiR-26a+MMP16). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

miR-26a inhibits proliferation, migration and invasion by targeting MMP14 and MMP16. MMP14 or MMP16 plasmid or its NC was transfected into SCL-1 cells. qRT-PCR (A) and Western blot (B) was used to detect the transfection efficiency of MMP14 or MMP16 (*p<0.05, **p<0.01 vs NC). (C) The apoptosis of cells was calculated by flow cytometry in SCL-1 cells (*p<0.05 vs agomiR-26a, #p<0.05 vs agomiR-26a+MMP14 and agomiR-26a+MMP16). (D) Western blot was performed to detected the expression of apoptosis-related protein Bcl 2, Bax and C-casp 3 (cleaved caspase-3) (*p<0.05 vs agomiR-26a, #p<0.05 vs agomiR-26a+MMP14 and agomiR-26a+MMP16). (E) Wound healing assay was used to detect cell migration (*p<0.05 vs agomiR-26a, #p<0.05 vs agomiR-26a+MMP14 and agomiR-26a+MMP16). (F) Transwell assay was performed to check cell invasive ability (*p<0.05 vs agomiR-26a, #p<0.05 vs agomiR-26a+MMP14 and agomiR-26a+MMP16). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate. MMP14 or MMP16 decreased apoptotic cell numbers when treatment with miR-26a (Figure 5B and C). Likewise, MMP14 or MMP16 reversed the role of miR-26a on apoptosis-related protein (Figure 5D). Moreover, we found that transfection with MMP14 or MMP16 removed the repressive role of miR-26a on migration and invasion (Figure 5E and F). Interestingly, the effect of MMP14 and MMP16 cotransfection was more significant than MMP14 or MMP16 alone (Figure 5C–F).

miR-26a Inhibits in vivo Tumor Growth in the Nude Mice

To further explore the function of miR-26a on CSCC, we used xenograft nude mice model. SCL-1 cells stably transfected with agomiR-26a or agomiR-NC were injected into nude mice. AgomiR-26a inhibited the growth of CSC (Figure 6A) and decreased tumors weight (Figure 6B). Besides, miR-26a expression was increased in isolated tumors with agomiR-26a injection (Figure 6C). Moreover, miR-26a injection reduced MMP14 and MMP16 level in tumors (Figure 6D).
Figure 6

miR-26a inhibits in vivo tumor growth in the nude mice. The nude mice were subcutaneously injected with SCL-1 cells (5 x 106) transfected with agomiR-26a or agomiR-NC in to the right flanks of the nude mice. (A) The tumor volume was assessed in the nude mice every 5 days (*p<0.05). (B) Tumor weight was determined in the isolated tumors from the nude mice (*p<0.05). (C) The relative expression of miR-26a was determined by qRT-PCR in the isolated tumor tissues (**p<0.01). (D) qRT-PCR was performed to detect the relative mRNA expression of MMP14 and MMP16 (*p<0.05). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

miR-26a inhibits in vivo tumor growth in the nude mice. The nude mice were subcutaneously injected with SCL-1 cells (5 x 106) transfected with agomiR-26a or agomiR-NC in to the right flanks of the nude mice. (A) The tumor volume was assessed in the nude mice every 5 days (*p<0.05). (B) Tumor weight was determined in the isolated tumors from the nude mice (*p<0.05). (C) The relative expression of miR-26a was determined by qRT-PCR in the isolated tumor tissues (**p<0.01). (D) qRT-PCR was performed to detect the relative mRNA expression of MMP14 and MMP16 (*p<0.05). The above measurement data were expressed as mean ± standard deviation. Data among multiple groups were analyzed by one-way ANOVA, followed by a Tukey post hoc test. The experiment was repeated in triplicate.

Discussion

CSCC is the most malignant skin tumor with the highest incidence.23 Studies show that the onset age of CSCC tends to be younger, which seriously threatens people’s health and quality of life.24 Due to the existence of chemotherapy resistance, the treatment of CSCC has great limitations.25 In recent years, with the introduction of the concept of precision medicine, molecular targeted therapy for a variety of diseases has become a hot topic.26 Therefore, basing on precision medicine, exploring the treatment methods of CSCC from the molecular level is expected to improve the current treatment CSCC. MiRNAs are a kind of noncoding RNA that participate in multiple kinds of physiological and pathophysiological processes.27 Massive research showed the important effects of miRNAs during the development of multiple cancers.28,29 In triple-negative breast cancer, miR-551b-3p can activate the OSM signaling pathway, thus inhibiting the occurrence and development of tumors.30 In CSCC, the expression patterns of mir-205 and mir-203 showed a typical negative correlation, which could be used as prognostic markers.31 In addition, the expression level of miR-203 was negatively correlated with the degree of CSCC differentiation, which targets c-Myc to inhibit tumor progression.32 miR-26a is a highly conserved type of RNA that has been shown to be involved in myocardial infarction, arthritis, colorectal cancer, and neurogenesis.33,34 In the present study, we firstly found a disease of miR-26a in CSCC clinical tissues and cell lines, which might be an indicator for miR-26a being involved in CSCC progression. And then, we forced miR-26a expression in SCL-1 and A431 cells, which suggested that miR-26a induced apoptosis and reduced the growth, migration, and invasion of CSCC cells. Because MMPs can efficiently hydrolyze extracellular matrix, it is beneficial to the near migration and distant metastasis of tumor cells.35 This phenomenon has caused widespread concern, and it has been confirmed that MMP exerts a vital effect in the progression of multiple tumors. In our study, we surprisedly found that a potential binding of miR-26a and MMP14/MMP16. Further experiments revealed that miR-26a directly targeted MMP14 and MMP16. Functional experiments showed that MMP14 or MMP16 removed the inhibitory effect of miR-26a on CSCC progression. Interestingly, the reversed effect was much stronger when MMP14 and MMP16 were transfected together into cells. Furthermore, in vivo tumor formation experiments proved that miR-26a could significantly inhibit the progression of CSCC, which was conducive to clinical targeted therapy.

Conclusions

In conclusion, our results showed that miR-26a inhibited CSCC cell proliferation, invasion and metastasis by targeting MMP14 and MMP16. And our data might provide a new insight for the detection and treatment of CSCC.
  35 in total

1.  Microarray analysis of microRNA expression in cutaneous squamous cell carcinoma.

Authors:  Michael Sand; Marina Skrygan; Dimitrios Georgas; Daniel Sand; Stephan A Hahn; Thilo Gambichler; Peter Altmeyer; Falk G Bechara
Journal:  J Dermatol Sci       Date:  2012-09-13       Impact factor: 4.563

Review 2.  Biosensors and bioassays for determination of matrix metalloproteinases: state of the art and recent advances.

Authors:  Zhen Lei; Minghong Jian; Xiaotong Li; Jia Wei; Xianying Meng; Zhenxin Wang
Journal:  J Mater Chem B       Date:  2020-04-29       Impact factor: 6.331

3.  miRNA551b-3p Activates an Oncostatin Signaling Module for the Progression of Triple-Negative Breast Cancer.

Authors:  Deepak Parashar; Anjali Geethadevi; Miriam Ragle Aure; Jyotsna Mishra; Jasmine George; Changliang Chen; Manoj K Mishra; Andliena Tahiri; Wei Zhao; Bindu Nair; Yiling Lu; Lingegowda S Mangala; Cristian Rodriguez-Aguayo; Gabriel Lopez-Berestein; Amadou K S Camara; Mingyu Liang; Janet S Rader; Ramani Ramchandran; Ming You; Anil K Sood; Vessela N Kristensen; Gordon B Mills; Sunila Pradeep; Pradeep Chaluvally-Raghavan
Journal:  Cell Rep       Date:  2019-12-24       Impact factor: 9.423

Review 4.  Intratumoral fate of functional nanoparticles in response to microenvironment factor: Implications on cancer diagnosis and therapy.

Authors:  Jinrong Peng; Qian Yang; Kun Shi; Yao Xiao; Xiawei Wei; Zhiyong Qian
Journal:  Adv Drug Deliv Rev       Date:  2019-07-02       Impact factor: 15.470

Review 5.  Treatment approaches in immunosuppressed patients with advanced cutaneous squamous cell carcinoma.

Authors:  T J Willenbrink; A Jambusaria-Pahlajani; S Arron; D Seckin; C A Harwood; C M Proby
Journal:  J Eur Acad Dermatol Venereol       Date:  2019-12       Impact factor: 6.166

Review 6.  Medical treatment of advanced cutaneous squamous-cell carcinoma.

Authors:  F F Gellrich; S Hüning; S Beissert; T Eigentler; E Stockfleth; R Gutzmer; F Meier
Journal:  J Eur Acad Dermatol Venereol       Date:  2019-12       Impact factor: 6.166

7.  Cutaneous squamous cell carcinoma with incomplete margins demonstrate higher tumour grade on re-excision.

Authors:  G-A Spyropoulou; L Pavlidis; M Trakatelli; P Foroglou; A Pagkalos; A Tsimponis; E Lampros; A Delimpaltas; E Demiri
Journal:  J Eur Acad Dermatol Venereol       Date:  2020-02-16       Impact factor: 6.166

8.  Effect and Mechanism of miR-26a-5p on Proliferation and Apoptosis of Hepatocellular Carcinoma Cells.

Authors:  Wen-Jing Zhu; Ying Yan; Jiu-Wei Zhang; Yan-Dong Tang; Bo Han
Journal:  Cancer Manag Res       Date:  2020-04-30       Impact factor: 3.989

9.  DNMT1 recruited by EZH2-mediated silencing of miR-484 contributes to the malignancy of cervical cancer cells through MMP14 and HNF1A.

Authors:  Yang Hu; Fuxia Wu; Yankun Liu; Qian Zhao; Hua Tang
Journal:  Clin Epigenetics       Date:  2019-12-07       Impact factor: 6.551

10.  Low BCL9 expression inhibited ovarian epithelial malignant tumor progression by decreasing proliferation, migration, and increasing apoptosis to cancer cells.

Authors:  Jing Wang; Mingjun Zheng; Liancheng Zhu; Lu Deng; Xiao Li; Linging Gao; Caixia Wang; Huimin Wang; Juanjuan Liu; Bei Lin
Journal:  Cancer Cell Int       Date:  2019-12-06       Impact factor: 5.722

View more
  3 in total

Review 1.  Oh, the Mutations You'll Acquire! A Systematic Overview of Cutaneous Squamous Cell Carcinoma.

Authors:  Stephenie Droll; Xiaomin Bao
Journal:  Cell Physiol Biochem       Date:  2021-09-22

2.  CircRNA has_circ_0001806 promotes hepatocellular carcinoma progression via the miR-193a-5p/MMP16 pathway.

Authors:  Hongmu Zhou; Ying Chen
Journal:  Braz J Med Biol Res       Date:  2021-10-29       Impact factor: 2.590

Review 3.  The long and short non-coding RNAs modulating EZH2 signaling in cancer.

Authors:  Sepideh Mirzaei; Mohammad Hossein Gholami; Kiavash Hushmandi; Farid Hashemi; Amirhossein Zabolian; Israel Canadas; Ali Zarrabi; Noushin Nabavi; Amir Reza Aref; Francesco Crea; Yuzhuo Wang; Milad Ashrafizadeh; Alan Prem Kumar
Journal:  J Hematol Oncol       Date:  2022-03-02       Impact factor: 17.388

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.