Philip T McGilvray1, S Andrei Anghel1,2, Arunkumar Sundaram1, Frank Zhong1,2, Michael J Trnka3, James R Fuller1, Hong Hu4, Alma L Burlingame3, Robert J Keenan1. 1. Department of Biochemistry and Molecular Biology, The University of Chicago, Chicago, United States. 2. Department of Molecular Genetics and Cell Biology, The University of Chicago, Chicago, United States. 3. Department of Pharmaceutical Chemistry, University of California, San Francisco, San Francisco, United States. 4. Center for Research Informatics, The University of Chicago, Chicago, United States.
Abstract
Membrane proteins with multiple transmembrane domains play critical roles in cell physiology, but little is known about the machinery coordinating their biogenesis at the endoplasmic reticulum. Here we describe a ~ 360 kDa ribosome-associated complex comprising the core Sec61 channel and five accessory factors: TMCO1, CCDC47 and the Nicalin-TMEM147-NOMO complex. Cryo-electron microscopy reveals a large assembly at the ribosome exit tunnel organized around a central membrane cavity. Similar to protein-conducting channels that facilitate movement of transmembrane segments, cytosolic and luminal funnels in TMCO1 and TMEM147, respectively, suggest routes into the central membrane cavity. High-throughput mRNA sequencing shows selective translocon engagement with hundreds of different multi-pass membrane proteins. Consistent with a role in multi-pass membrane protein biogenesis, cells lacking different accessory components show reduced levels of one such client, the glutamate transporter EAAT1. These results identify a new human translocon and provide a molecular framework for understanding its role in multi-pass membrane protein biogenesis.
Membrane proteins with multiple transmembrane domains play critical roles in cell physiology, but little is known about the machinery coordinating their biogenesis at the endoplasmic reticulum. Here we describe a ~ 360 kDa ribosome-associated complex comprising the core Sec61 channel and five accessory factors: TMCO1, CCDC47 and the Nicalin-TMEM147-NOMO complex. Cryo-electron microscopy reveals a large assembly at the ribosome exit tunnel organized around a central membrane cavity. Similar to protein-conducting channels that facilitate movement of transmembrane segments, cytosolic and luminal funnels in TMCO1 and TMEM147, respectively, suggest routes into the central membrane cavity. High-throughput mRNA sequencing shows selective translocon engagement with hundreds of different multi-pass membrane proteins. Consistent with a role in multi-pass membrane protein biogenesis, cells lacking different accessory components show reduced levels of one such client, the glutamate transporterEAAT1. These results identify a new human translocon and provide a molecular framework for understanding its role in multi-pass membrane protein biogenesis.
The human genome encodes thousands of integral membrane proteins, which play critical roles in nearly all aspects of cell physiology. Membrane proteins of the cell surface and most intracellular compartments are first assembled at the endoplasmic reticulum. Most of these are inserted by the evolutionarily conserved Sec61 complex, which guides hydrophobic transmembrane domains (TMDs) into a central aqueous channel that opens laterally to allow TMD entry into the bilayer (Voorhees and Hegde, 2016; Li et al., 2016; Pfeffer et al., 2015).How this process is elaborated to facilitate the insertion and folding of membrane proteins containing multiple TMDs is not well understood. The human genome encodes ~2500 multi-pass proteins, including GPCRs, solute carriers, ion channels, and ABC transporters. These show considerable biophysical and topological complexity, including TMDs of variable length and hydrophobicity, closely spaced TMD hairpins, and re-entrant loops that span only part of the membrane (Cymer et al., 2015; Foster et al., 2000). These features are often critical for function, but they pose a significant challenge for the biosynthetic machinery (Foster et al., 2000; Tector and Hartl, 1999).The ‘translocon’ is a poorly defined and dynamic ensemble that coordinates the insertion, folding, modification and assembly of most membrane proteins. The eukaryotic translocon comprises the core Sec61 channel in association with different accessory factors. The best studied of these factors include the OST (Chavan et al., 2005) and TRAP complexes (Fons et al., 2003), TRAM (Görlich and Rapoport, 1993; Voigt et al., 1996), Sec62/63 (Conti et al., 2015), and the signal peptidase complex (Kalies et al., 1998). A significant challenge to studying the translocon is that many accessory factors only transiently or sub-stoichiometrically associate with the core machinery, contributing to difficulties in isolating intact complexes (Görlich and Rapoport, 1993; Wang and Dobberstein, 1999). As a result, the composition and stoichiometry of ribosome-bound translocons, and their structures, functions and clientele, remain poorly defined.We previously identified TMCO1 as a eukaryotic member of the Oxa1 superfamily, whose members are linked to membrane protein biogenesis (Anghel et al., 2017). These proteins, including the EMC3 subunit of the ‘ER membrane complex’ (EMC) (Chitwood et al., 2018; Guna et al., 2018; Shurtleff et al., 2018; Volkmar et al., 2019), the Get1 subunit of the Get1/2 complex (Schuldiner et al., 2008; Mariappan et al., 2011; Wang et al., 2014), and the Oxa1/Alb3/YidC proteins (Shanmugam and Dalbey, 2019), function in different contexts as TMD insertases and/or as intramembrane chaperones to facilitate membrane protein folding and assembly (Shurtleff et al., 2018; Nagamori et al., 2004; Serdiuk et al., 2016; Klenner et al., 2008). The function of TMCO1 is not yet known, but consistent with a role in a co-translational process at the ER membrane, it can be natively isolated in association with ribosome-Sec61 complexes (Anghel et al., 2017).
Results
Interaction partners of natively isolated TMCO1-ribosome complexes
To identify components of TMCO1-ribosome complexes we solubilized microsomes isolated from 3xFlag-TMCO1HEK293 cells, affinity purified via the Flag tag on TMCO1, isolated the ribosome-bound fraction by sedimentation, and identified co-purifying proteins by quantitative mass spectrometry (Figure 1A,B). Ribosomal proteins, subunits of the Sec61 complex, and TMCO1 were enriched relative to control cells lacking the Flag tag, whereas known translocon accessory factors—including subunits of the OST and TRAP complexes, TRAM, Sec62/63 and the signal peptidase complex—were either weakly enriched or absent. We also observed strong enrichment of three poorly studied proteins: the single-pass membrane protein CCDC47 (calumin) and two subunits of the Nicalin-TMEM147-NOMO transmembrane complex (Dettmer et al., 2010).
(A) Emetine- and micrococcal nuclease-treated membranes from wild-type (WT) or 3xFlag-TMCO1 (Flag) HEK293 cells were digitonin-solubilized, immunoprecipitated via the 3xFlag tag on TMCO1, and the eluate sedimented through a sucrose cushion to isolate the ribosome-associated fraction for analysis. (B) Proteins enriched in the ribosomal fraction after immunoprecipitation from 3xFlag-TMCO1 or wild-type membranes. (C) Top hits were confirmed by western blotting. The catalytic STT3A subunit of the OST complex is not detected. (D) Topology and domain structure for the top hits, based on Uniprot annotation, homology modeling, de novo structure prediction (in RaptorX-Contact), and experimental mapping; the Sec61 complex is not shown. Distinguishing features include the large globular luminal domain of Nicalin (in contrast with the flexible luminal domains of NOMO and CCDC47), the large globular cytosolic domain of CCDC47 (with a conserved C-terminal coiled-coil), and a conserved cytosolic coiled-coil between the first two TMDs of TMCO1. TMEM147 is the core, multi-pass subunit of the Nicalin-TMEM147-NOMO complex Dettmer et al., 2010; note that the short extra-membrane loops of TMEM147 make it difficult to detect by mass spectrometry.
(A) Comparison of co-purifying components in the ribosome-bound fraction (“Pellet”), following immunoprecipitation from digitonin-solubilized microsomes isolated from HEK293 cells stably expressing 3xFlag-TMCO1 or 3xFlag-Nicalin. (B) Digitonin-solubilized microsomes from 3xFlag-TMCO1 HEK293 cells were cleared of ribosomes by sedimentation. The ribosome-free fraction (“Input”) was then subjected to affinity purification using anti-Flag or anti-NOMO antibodies. Immunoprecipitation of 3xFlag-TMCO1 recovers only trace amounts of the other components, and NOMO1 immunoprecipitation fails to recover either TMCO1 or CCDC47. However, as shown previously (Dettmer et al., 2010), Nicalin is efficiently recovered by NOMO immunoprecipitation.
(A) Emetine- and micrococcal nuclease-treated membranes from wild-type (WT) or 3xFlag-TMCO1 (Flag) HEK293 cells were digitonin-solubilized, immunoprecipitated via the 3xFlag tag on TMCO1, and the eluate sedimented through a sucrose cushion to isolate the ribosome-associated fraction for analysis. (B) Proteins enriched in the ribosomal fraction after immunoprecipitation from 3xFlag-TMCO1 or wild-type membranes. (C) Top hits were confirmed by western blotting. The catalytic STT3A subunit of the OST complex is not detected. (D) Topology and domain structure for the top hits, based on Uniprot annotation, homology modeling, de novo structure prediction (in RaptorX-Contact), and experimental mapping; the Sec61 complex is not shown. Distinguishing features include the large globular luminal domain of Nicalin (in contrast with the flexible luminal domains of NOMO and CCDC47), the large globular cytosolic domain of CCDC47 (with a conserved C-terminal coiled-coil), and a conserved cytosolic coiled-coil between the first two TMDs of TMCO1. TMEM147 is the core, multi-pass subunit of the Nicalin-TMEM147-NOMO complex Dettmer et al., 2010; note that the short extra-membrane loops of TMEM147 make it difficult to detect by mass spectrometry.
Additional interaction analysis of the TMCO1 translocon components.
(A) Comparison of co-purifying components in the ribosome-bound fraction (“Pellet”), following immunoprecipitation from digitonin-solubilized microsomes isolated from HEK293 cells stably expressing 3xFlag-TMCO1 or 3xFlag-Nicalin. (B) Digitonin-solubilized microsomes from 3xFlag-TMCO1HEK293 cells were cleared of ribosomes by sedimentation. The ribosome-free fraction (“Input”) was then subjected to affinity purification using anti-Flag or anti-NOMO antibodies. Immunoprecipitation of 3xFlag-TMCO1 recovers only trace amounts of the other components, and NOMO1 immunoprecipitation fails to recover eitherTMCO1 or CCDC47. However, as shown previously (Dettmer et al., 2010), Nicalin is efficiently recovered by NOMO immunoprecipitation.We confirmed recovery of Sec61, TMCO1, Nicalin, TMEM147, NOMO and CCDC47 in the ribosome-associated fraction following 3xFlag-TMCO1 immunopreciptation (Figure 1C,D). Notably, the catalytic OST subunit STT3A was not detected, consistent with the absence of OST from the TMCO1-ribosome complexes. Affinity purification via a Flag tag on Nicalin recovered TMCO1, CCDC47 and NOMO in the ribosome-bound fraction (Figure 1—figure supplement 1A), indicating that these proteins can be isolated as a single, ribosome-associated complex. In the absence of ribosomes, however, only components of the Nicalin-TMEM147-NOMO complex remained intact (Figure 1—figure supplement 1B), suggesting that TMCO1, CCDC47 and the pre-formed Nicalin-TMEM147-NOMO complex assemble in the context of the ribosome.
Figure 1—figure supplement 1.
Additional interaction analysis of the TMCO1 translocon components.
(A) Comparison of co-purifying components in the ribosome-bound fraction (“Pellet”), following immunoprecipitation from digitonin-solubilized microsomes isolated from HEK293 cells stably expressing 3xFlag-TMCO1 or 3xFlag-Nicalin. (B) Digitonin-solubilized microsomes from 3xFlag-TMCO1 HEK293 cells were cleared of ribosomes by sedimentation. The ribosome-free fraction (“Input”) was then subjected to affinity purification using anti-Flag or anti-NOMO antibodies. Immunoprecipitation of 3xFlag-TMCO1 recovers only trace amounts of the other components, and NOMO1 immunoprecipitation fails to recover either TMCO1 or CCDC47. However, as shown previously (Dettmer et al., 2010), Nicalin is efficiently recovered by NOMO immunoprecipitation.
CCDC47, Nicalin, TMEM147 and NOMO are abundant ER-localized proteins, conserved across eukaryotes, widely expressed in human tissues, and associated with several human diseases (Itzhak et al., 2016; Burdon et al., 2011; Sharma et al., 2012; Xin et al., 2010; Caglayan et al., 2013; Alanay et al., 2014; Li et al., 2019; Reuter et al., 2017; Morimoto et al., 2018). Although their functions remain obscure, CCDC47 has been linked to various membrane-associated processes (Morimoto et al., 2018; Zhang et al., 2007; Konno et al., 2012; Thapa et al., 2018; Yamamoto et al., 2014), and the Nicalin-TMEM147-NOMO complex has been proposed to regulate subunit assembly and localization of several cell surface receptors and ion channels (Almedom et al., 2009; Gottschalk et al., 2005; Kamat et al., 2014; Rosemond et al., 2011). More recently, all four genes were identified in a genome-wide screen for factors that impair surface expression of a mutant TRP channel (Talbot et al., 2019). That these proteins can be stably isolated with TMCO1-bound ribosome-Sec61 complexes suggests a link between these observations and a co-translational process at the ER.
Architecture of a ribosome-bound TMCO1 translocon
We sought to clarify the role of these ribosome-associated membrane components by examining their arrangement relative to key functional domains of the ribosome and the Sec61 complex. Using chemical cross-linking and mass spectrometry (XL-MS), we identified 1229 unique, high-confidence intra- and inter-protein cross-links in the affinity-purified complexes (Figure 2—figure supplement 1A,B). Multiple cross-links between 60S ribosomal subunits and the cytosolic-facing regions of Sec61, TMCO1, CCDC47, TMEM147 and NOMO confirmed their predicted membrane topologies, and placed them in the vicinity of the ribosome exit tunnel (Figure 1D and Figure 2—figure supplement 1C,D).
Figure 2—figure supplement 1.
Cross-linking and mass spectrometry analysis of TMCO1-associated ribosomes.
(A) Classification of cross-linked residue pairs. Crosslinks are reported at a false discovery rate of 0.55% corresponding to a classification score threshold of 1.5 (dashed red line). FDR was determined by modeling the distributions of crosslinks with zero (blue), one (red) or two (yellow) peptides randomly matching at given score using a decoy database (see methods). (B) Distance distributions for all ribosome-ribosome crosslinks mapping to a high-resolution cryo-EM structure of the human ribosome (PDB ID 4UG0) (Khatter et al., 2015). After applying a conservative cutoff (SVM score ≥ 1.5), 715 crosslinks could be mapped to the structure with the majority (91.3%) of crosslink Cα-Cα distances lying within the 35 Å upper limit (red dashed line). A distribution sampled from all possible Lys-Lys pairs on the ribosome (purple) is shown for comparison. (C) Network diagram of the 130 strongest (SVM score ≥ 1.5) intra- (purple lines) and inter-molecular (cyan lines) unique cross-linked residue pairs involving the membrane components. Luminal (white), transmembrane (grey) and cytosolic (cyan) regions of the membrane components are indicated. Crosslinks between the luminal domain of Nicalin and the cytosolic domain of NOMO, and between the C-terminus of TMCO1 and eS7, are likely non-physiologic (dashed red lines). (D) Surface representation of the human ribosomal large subunit highlighting the locations of proteins crosslinked to one or more of the membrane components. Ribosomal subunits are colored as in (C), and the exit tunnel is marked with a red asterisk.
We next used single particle cryo-electron microscopy (cryo-EM) to directly visualize the natively purified complexes (Figure 2, Figure 2—figure supplements 2–5 and Table 1). Density for the ribosome is well-defined, revealing hybrid state A/P and P/E tRNAs, and a mixture of nascent polypeptides in the exit tunnel (Figure 2—figure supplement 5A). Additional density is visible surrounding the ribosome exit tunnel. Local resolution within the translocon varies from ~3.5–4.5 Å in Sec61 and regions contacting the ribosome, to ~5.5–7.5 Å for most of the membrane region, and ~10–15 Å in peripheral and luminal regions (Figure 2—figure supplement 4 and Figure 2—figure supplement 5B,C). Sec61 is in a conformation similar to that observed in the ribosome-Sec61-OST complex (Braunger et al., 2018), with a closed lateral gate and the plug helix occluding the central pore (Figure 2—figure supplement 5D).
Figure 2.
CryoEM structure of the ribosome-TMCO1 translocon complex.
(A) Density for the 80S ribosome, A/P and P/E tRNAs is from the sharpened global map after low-pass filtering by local resolution. The translocon density is from the unsharpened focused map after low-pass filtering by local resolution; isolated densities for Sec61 (green), TMEM147 (purple), TMCO1 (blue) and CCDC47 (violet) are shown at a single threshold. The focused map is also shown at a lower threshold (transparent) to highlight luminal density and the micelle. (B) Closeup of the Sec61 complex, including experimentally observed cross-links (red) between Sec61γ and the indicated ribosomal subunits (yellow). (C) Closeup of the TMEM147-Nicalin complex (purple, pink), and cross-links between uL24 and the conserved TM3-TM4 loop of TMEM147. (D) The luminal domain of Nicalin (pink) extends below TMEM147 in a large lobe of density. (E) Closeup of TMCO1, and multiple intra- and inter-molecular cross-links. (F) Closeup of the cytosolic domain of CCDC47 and cross-links to the indicated ribosomal subunits, Sec61α, and the TMCO1 coiled coil; a cross-link that exceeds the distance cutoff of 35 Å is in black. Density in panels B-F is from the unsharpened signal-subtracted map after low-pass filtering by local resolution.
(A) Classification of cross-linked residue pairs. Crosslinks are reported at a false discovery rate of 0.55% corresponding to a classification score threshold of 1.5 (dashed red line). FDR was determined by modeling the distributions of crosslinks with zero (blue), one (red) or two (yellow) peptides randomly matching at given score using a decoy database (see methods). (B) Distance distributions for all ribosome-ribosome crosslinks mapping to a high-resolution cryo-EM structure of the human ribosome (PDB ID 4UG0) (Khatter et al., 2015). After applying a conservative cutoff (SVM score ≥ 1.5), 715 crosslinks could be mapped to the structure with the majority (91.3%) of crosslink Cα-Cα distances lying within the 35 Å upper limit (red dashed line). A distribution sampled from all possible Lys-Lys pairs on the ribosome (purple) is shown for comparison. (C) Network diagram of the 130 strongest (SVM score ≥ 1.5) intra- (purple lines) and inter-molecular (cyan lines) unique cross-linked residue pairs involving the membrane components. Luminal (white), transmembrane (grey) and cytosolic (cyan) regions of the membrane components are indicated. Crosslinks between the luminal domain of Nicalin and the cytosolic domain of NOMO, and between the C-terminus of TMCO1 and eS7, are likely non-physiologic (dashed red lines). (D) Surface representation of the human ribosomal large subunit highlighting the locations of proteins crosslinked to one or more of the membrane components. Ribosomal subunits are colored as in (C), and the exit tunnel is marked with a red asterisk.
Initial rounds of 3D classification yielded five classes containing tRNA density and luminal density extending below the detergent micelle. These were subjected to additional 3D refinement followed by 3D classification with signal subtraction, using a mask encompassing the translocon and part of the ribosomal large subunit (cyan). 3D refinement of the major translocon-containing class was performed with the signal subtracted particles (Map 1), or with unsubtracted particles subjected first to global refinement (Map 2), followed by focused refinement (Map 3) using a mask around the translocon (magenta). The three final maps are shown with their resolutions and EMD deposition codes.
Three maps were used for the final analysis: (A) Translocon map after signal subtraction (Map 1), (B) Global map calculated with unsubtracted particles (Map 2) and (C) Focused map calculated with unsubtracted particles (Map 3). Left, Maps colored by local resolution as estimated by Relion; middle, angular particle distribution in two views; right, gold-standard Fourier shell correlation (FSC) curve with indicated resolution at FSC = 0.143.
(A) Section through a sharpened global map after low-pass filtering by local resolution, showing density for a mixture of nascent polypeptides (orange) throughout the ribosome exit tunnel. (B) Model vs. map FSC curve calculated with a masked version of the signal-subtracted Map 1 and the final translocon model. (C) Model of the translocon, colored by local B-factor. (D) Closeup of the Sec61 complex fit into the unsharpened focused map after low-pass filtering by local resolution. The lateral gate (between TM2 and TM7) of Sec61 is closed, and the plug helix occupies the central pore. (E) Closeup of the seven TMDs of TMEM147, the single-TMD of Nicalin, and the Sec61 “hinge” region, fit into the same map as in (D). This view is rotated ~180° from that shown in Figure 2C.
(A) Amino acid sequence of human TMEM147 colored by ConSurf conservation score. Transmembrane helices (TM) are indicated. (B) Top-scoring iTasser homology model for TMEM147, based on the APH-1 subunit of human γ-secretase (PDB ID 5A63) (Bai et al., 2015), and color ramped from N- (blue) to C-terminus (red). Note the distinctive arrangement of the seven TMEM147 TMDs. (C) Amino acid sequence of human Nicalin colored by ConSurf conservation score. The N-terminal signal peptide (SP) and single transmembrane helix (TM) are indicated. (D) Top-scoring iTasser homology model for the Nicalin luminal domain, based on the Nicastrin subunit of human γ-secretase, and color ramped from N-(blue) to C-terminus (red). (E) Superposition of the Nicalin (pink) and TMEM147 (purple) homology models on the APH1-Nicastrin subunits (white) of γ-secretase. The cytosolic end of TMEM147 TM3 is ~10 residues shorter than the corresponding region in APH-1; as noted in the main text, this allows TMEM147 to approach Sec61 despite limited space available in the ribosome-membrane junction.
(A) Amino acid sequence of human TMCO1 colored by ConSurf conservation score. Transmembrane helices (TM) are indicated. (B) Heat map of the RaptorX-Contact probabilities of two residues being in close proximity (Cβ-Cβ distance <8 Å); higher probabilities are darker. (C) Top five scoring models from RaptorX-Contact; each model is color ramped from the N-terminus (blue) to C-terminus (red). (D) High-probability (p ≥ 0.80) RaptorX-Contact contacts (white lines) mapped onto the final TMCO1 model after fitting into the cryo-EM density map.
(A) Amino acid sequence of human CCDC47 colored by ConSurf conservation score. The N-terminal signal peptide (SP) and single transmembrane helix (TM) are indicated. (B) Heat map of the RaptorX-Contact probabilities of two residues being in close proximity (Cβ-Cβ distance <8 Å); higher probabilities are darker. (C) Top five scoring models from RaptorX-Contact; each model is color ramped from the N-terminus (blue) to C-terminus (red). (D) High-probability (p ≥ 0.80) RaptorX-Contact contacts (white lines) mapped onto the final CCDC47 model after fitting into the cryo-EM density map.
Figure 2—figure supplement 2.
Representative cryo-EM image and 2D class averages for the natively purified ribosome-TMCO1 translocon complex.
Figure 2—figure supplement 5.
Additional views of local map and model quality.
(A) Section through a sharpened global map after low-pass filtering by local resolution, showing density for a mixture of nascent polypeptides (orange) throughout the ribosome exit tunnel. (B) Model vs. map FSC curve calculated with a masked version of the signal-subtracted Map 1 and the final translocon model. (C) Model of the translocon, colored by local B-factor. (D) Closeup of the Sec61 complex fit into the unsharpened focused map after low-pass filtering by local resolution. The lateral gate (between TM2 and TM7) of Sec61 is closed, and the plug helix occupies the central pore. (E) Closeup of the seven TMDs of TMEM147, the single-TMD of Nicalin, and the Sec61 “hinge” region, fit into the same map as in (D). This view is rotated ~180° from that shown in Figure 2C.
Table 1.
Cryo-EM data collection and refinement statistics.
Data collection and processing
Magnification
64,000
Voltage (kV)
300
Electron exposure (e–/Å2)
50
Defocus range (μm)
−1.0 to −2.5
Pixel size (Å)
0.68
Symmetry imposed
C1
Micrographs used
5562
Initial particle images (no.)
1,049,128
Final particle images (no.)
82,684
Map 1 (EMD-21426)
Map 2 (EMD-21427)
Map 3 (EMD-21435)
Map resolution (Å)
3.8
3.4
3.8
FSC threshold
0.143
0.143
0.143
Map resolution range (Å)
3.3 to 10.3
3.0 to 15.4
3.2 to 13.1
Refinement and validation
60S–translocon PDB ID 6W6L
Resolution for refinement (Å)
3.8
FSC threshold
0.143
Model composition
Protein residues
8012 (1718)*
Nucleotide bases
3939 (0)
Average B factors (Å2)
Protein
156 (260)
Nucleotide
191 (N/A)
R.M.S. deviations
Bond lengths (Å)
0.006 (0.005)
Bond angles (°)
0.809 (1.013)
Validation
MolProbity score
2.03 (2.43)
Clash score
9.41 (13.66)
Rotamer outliers
1.42 (3.39)
Ramachandran plot
Favored (%)
93.7 (94.4)
Allowed (%)
6.2 (5.4)
Outliers (%)
0.1 (0.2)
*Values in parentheses are for the translocon components only.
Figure 2—figure supplement 4.
Resolution estimates for the TMCO1-ribosome complex.
Three maps were used for the final analysis: (A) Translocon map after signal subtraction (Map 1), (B) Global map calculated with unsubtracted particles (Map 2) and (C) Focused map calculated with unsubtracted particles (Map 3). Left, Maps colored by local resolution as estimated by Relion; middle, angular particle distribution in two views; right, gold-standard Fourier shell correlation (FSC) curve with indicated resolution at FSC = 0.143.
CryoEM structure of the ribosome-TMCO1 translocon complex.
(A) Density for the 80S ribosome, A/P and P/E tRNAs is from the sharpened global map after low-pass filtering by local resolution. The translocon density is from the unsharpened focused map after low-pass filtering by local resolution; isolated densities for Sec61 (green), TMEM147 (purple), TMCO1 (blue) and CCDC47 (violet) are shown at a single threshold. The focused map is also shown at a lower threshold (transparent) to highlight luminal density and the micelle. (B) Closeup of the Sec61 complex, including experimentally observed cross-links (red) between Sec61γ and the indicated ribosomal subunits (yellow). (C) Closeup of the TMEM147-Nicalin complex (purple, pink), and cross-links between uL24 and the conserved TM3-TM4 loop of TMEM147. (D) The luminal domain of Nicalin (pink) extends below TMEM147 in a large lobe of density. (E) Closeup of TMCO1, and multiple intra- and inter-molecular cross-links. (F) Closeup of the cytosolic domain of CCDC47 and cross-links to the indicated ribosomal subunits, Sec61α, and the TMCO1 coiled coil; a cross-link that exceeds the distance cutoff of 35 Å is in black. Density in panels B-F is from the unsharpened signal-subtracted map after low-pass filtering by local resolution.
Cross-linking and mass spectrometry analysis of TMCO1-associated ribosomes.
(A) Classification of cross-linked residue pairs. Crosslinks are reported at a false discovery rate of 0.55% corresponding to a classification score threshold of 1.5 (dashed red line). FDR was determined by modeling the distributions of crosslinks with zero (blue), one (red) or two (yellow) peptides randomly matching at given score using a decoy database (see methods). (B) Distance distributions for all ribosome-ribosome crosslinks mapping to a high-resolution cryo-EM structure of the human ribosome (PDB ID 4UG0) (Khatter et al., 2015). After applying a conservative cutoff (SVM score ≥ 1.5), 715 crosslinks could be mapped to the structure with the majority (91.3%) of crosslink Cα-Cα distances lying within the 35 Å upper limit (red dashed line). A distribution sampled from all possible Lys-Lys pairs on the ribosome (purple) is shown for comparison. (C) Network diagram of the 130 strongest (SVM score ≥ 1.5) intra- (purple lines) and inter-molecular (cyan lines) unique cross-linked residue pairs involving the membrane components. Luminal (white), transmembrane (grey) and cytosolic (cyan) regions of the membrane components are indicated. Crosslinks between the luminal domain of Nicalin and the cytosolic domain of NOMO, and between the C-terminus of TMCO1 and eS7, are likely non-physiologic (dashed red lines). (D) Surface representation of the human ribosomal large subunit highlighting the locations of proteins crosslinked to one or more of the membrane components. Ribosomal subunits are colored as in (C), and the exit tunnel is marked with a red asterisk.
Cryo-EM data processing workflow.
Initial rounds of 3D classification yielded five classes containing tRNA density and luminal density extending below the detergent micelle. These were subjected to additional 3D refinement followed by 3D classification with signal subtraction, using a mask encompassing the translocon and part of the ribosomal large subunit (cyan). 3D refinement of the major translocon-containing class was performed with the signal subtracted particles (Map 1), or with unsubtracted particles subjected first to global refinement (Map 2), followed by focused refinement (Map 3) using a mask around the translocon (magenta). The three final maps are shown with their resolutions and EMD deposition codes.
Resolution estimates for the TMCO1-ribosome complex.
Three maps were used for the final analysis: (A) Translocon map after signal subtraction (Map 1), (B) Global map calculated with unsubtracted particles (Map 2) and (C) Focused map calculated with unsubtracted particles (Map 3). Left, Maps colored by local resolution as estimated by Relion; middle, angular particle distribution in two views; right, gold-standard Fourier shell correlation (FSC) curve with indicated resolution at FSC = 0.143.
Additional views of local map and model quality.
(A) Section through a sharpened global map after low-pass filtering by local resolution, showing density for a mixture of nascent polypeptides (orange) throughout the ribosome exit tunnel. (B) Model vs. map FSC curve calculated with a masked version of the signal-subtracted Map 1 and the final translocon model. (C) Model of the translocon, colored by local B-factor. (D) Closeup of the Sec61 complex fit into the unsharpened focused map after low-pass filtering by local resolution. The lateral gate (between TM2 and TM7) of Sec61 is closed, and the plug helix occupies the central pore. (E) Closeup of the seven TMDs of TMEM147, the single-TMD of Nicalin, and the Sec61 “hinge” region, fit into the same map as in (D). This view is rotated ~180° from that shown in Figure 2C.
iTasser homology modeling of the human TMEM147-Nicalin complex.
(A) Amino acid sequence of humanTMEM147 colored by ConSurf conservation score. Transmembrane helices (TM) are indicated. (B) Top-scoring iTasser homology model for TMEM147, based on the APH-1 subunit of human γ-secretase (PDB ID 5A63) (Bai et al., 2015), and color ramped from N- (blue) to C-terminus (red). Note the distinctive arrangement of the seven TMEM147TMDs. (C) Amino acid sequence of humanNicalin colored by ConSurf conservation score. The N-terminal signal peptide (SP) and single transmembrane helix (TM) are indicated. (D) Top-scoring iTasser homology model for the Nicalinluminal domain, based on the Nicastrin subunit of human γ-secretase, and color ramped from N-(blue) to C-terminus (red). (E) Superposition of the Nicalin (pink) and TMEM147 (purple) homology models on the APH1-Nicastrin subunits (white) of γ-secretase. The cytosolic end of TMEM147TM3 is ~10 residues shorter than the corresponding region in APH-1; as noted in the main text, this allows TMEM147 to approach Sec61 despite limited space available in the ribosome-membrane junction.
RaptorX-Contact modeling of human TMCO1.
(A) Amino acid sequence of humanTMCO1 colored by ConSurf conservation score. Transmembrane helices (TM) are indicated. (B) Heat map of the RaptorX-Contact probabilities of two residues being in close proximity (Cβ-Cβ distance <8 Å); higher probabilities are darker. (C) Top five scoring models from RaptorX-Contact; each model is color ramped from the N-terminus (blue) to C-terminus (red). (D) High-probability (p ≥ 0.80) RaptorX-Contact contacts (white lines) mapped onto the final TMCO1 model after fitting into the cryo-EM density map.
RaptorX-Contact modeling of human CCDC47.
(A) Amino acid sequence of humanCCDC47 colored by ConSurf conservation score. The N-terminal signal peptide (SP) and single transmembrane helix (TM) are indicated. (B) Heat map of the RaptorX-Contact probabilities of two residues being in close proximity (Cβ-Cβ distance <8 Å); higher probabilities are darker. (C) Top five scoring models from RaptorX-Contact; each model is color ramped from the N-terminus (blue) to C-terminus (red). (D) High-probability (p ≥ 0.80) RaptorX-Contact contacts (white lines) mapped onto the final CCDC47 model after fitting into the cryo-EM density map.*Values in parentheses are for the translocon components only.A cluster of eight TMDs visible near the Sec61 hinge were unambiguously assigned to the Nicalin-TMEM147 sub-complex using a homology model based on the APH1-Nicastrin sub-complex of human γ-secretase (Figure 2—figure supplement 6; Dettmer et al., 2010; Bai et al., 2015; Haffner et al., 2004). The distinctive arrangement of the seven TMEM147TMDs could be docked into the density as a rigid body with only minor adjustments (Figure 2C and Figure 2—figure supplement 5E). This enabled assignment of the remaining helical density to the single NicalinTMD, which packs against TM1 of TMEM147 in its evolutionarily predicted position. Here, the large luminal domain of Nicalin extends into low-resolution density directly below the translocon (Figure 2D). Notably, the cytosolic end of TM3 in TMEM147 is ten residues shorter than the corresponding TM3 in APH-1 (Figure 2—figure supplement 6E). This allows TMEM147 to bind Sec61 despite limited space in the ribosome-translocon junction, and positions the short cytosolic regions of TMEM147 in contact with uL24 and rRNA H7, in agreement with the XL-MS (Figure 2C and Figure 2—figure supplement 1C,D).
Figure 2—figure supplement 6.
iTasser homology modeling of the human TMEM147-Nicalin complex.
(A) Amino acid sequence of human TMEM147 colored by ConSurf conservation score. Transmembrane helices (TM) are indicated. (B) Top-scoring iTasser homology model for TMEM147, based on the APH-1 subunit of human γ-secretase (PDB ID 5A63) (Bai et al., 2015), and color ramped from N- (blue) to C-terminus (red). Note the distinctive arrangement of the seven TMEM147 TMDs. (C) Amino acid sequence of human Nicalin colored by ConSurf conservation score. The N-terminal signal peptide (SP) and single transmembrane helix (TM) are indicated. (D) Top-scoring iTasser homology model for the Nicalin luminal domain, based on the Nicastrin subunit of human γ-secretase, and color ramped from N-(blue) to C-terminus (red). (E) Superposition of the Nicalin (pink) and TMEM147 (purple) homology models on the APH1-Nicastrin subunits (white) of γ-secretase. The cytosolic end of TMEM147 TM3 is ~10 residues shorter than the corresponding region in APH-1; as noted in the main text, this allows TMEM147 to approach Sec61 despite limited space available in the ribosome-membrane junction.
Adjacent to the Nicalin-TMEM147 sub-complex is a cluster of three TMDs, which were assigned to TMCO1 (Figure 2E). We generated a model of TMCO1 using RaptorX-Contact (Wang et al., 2017; Xu, 2019), which employs co-evolutionary data and deep learning for distance-based structure prediction (Figure 2—figure supplement 7). The model recapitulates the conserved three TMD core, N-out/C-in topology, and cytosolic-facing coiled-coil found in members of the Oxa1 superfamily (Anghel et al., 2017; Borowska et al., 2015; Kumazaki et al., 2014), and could be placed into density with only minor adjustments. The conserved and positively charged coiled-coil of TMCO1 extends out of the membrane into the cytosolic vestibule where it packs against a surface on the ribosome that includes rRNA H19, H24 and uL24. This agrees with the proposed ribosome-binding mode of bacterial YidC (Kedrov et al., 2016), satisfies numerous inter- and intra-molecular cross-links observed by XL-MS (Figure 2E and Figure 2—figure supplement 1C,D), and rationalizes the previously reported ribosome-binding activity of TMCO1 (Anghel et al., 2017).
Figure 2—figure supplement 7.
RaptorX-Contact modeling of human TMCO1.
(A) Amino acid sequence of human TMCO1 colored by ConSurf conservation score. Transmembrane helices (TM) are indicated. (B) Heat map of the RaptorX-Contact probabilities of two residues being in close proximity (Cβ-Cβ distance <8 Å); higher probabilities are darker. (C) Top five scoring models from RaptorX-Contact; each model is color ramped from the N-terminus (blue) to C-terminus (red). (D) High-probability (p ≥ 0.80) RaptorX-Contact contacts (white lines) mapped onto the final TMCO1 model after fitting into the cryo-EM density map.
The most prominent feature in the cytosolic vestibule is a globular density that curls out of the membrane near TMCO1 and terminates in a long helical extension that traces along the ribosome surface (Figure 2F). Using RaptorX-Contact we generated a model of the large cytosolic region of CCDC47, revealing a long and flexible C-terminal coiled-coil extending from a globular N-terminal domain (Figure 2—figure supplement 8). After placing the globular domain as a rigid body, the coiled-coil was adjusted to fit the extended helical density. The globular domain of CCDC47 contacts eL6 and rRNA H25, while the conserved and positively charged coiled-coil wedges between Sec61 and rRNA H24, before terminating at the mouth of the exit tunnel. This satisfies multiple intra- and inter-molecular cross-links to Sec61α, to the flexible N-terminus of Sec61β, to uL22, eL31 and eL32, and to the TMCO1 coiled-coil and C-terminal helix (Figure 2F and Figure 2—figure supplement 1C,D).
Figure 2—figure supplement 8.
RaptorX-Contact modeling of human CCDC47.
(A) Amino acid sequence of human CCDC47 colored by ConSurf conservation score. The N-terminal signal peptide (SP) and single transmembrane helix (TM) are indicated. (B) Heat map of the RaptorX-Contact probabilities of two residues being in close proximity (Cβ-Cβ distance <8 Å); higher probabilities are darker. (C) Top five scoring models from RaptorX-Contact; each model is color ramped from the N-terminus (blue) to C-terminus (red). (D) High-probability (p ≥ 0.80) RaptorX-Contact contacts (white lines) mapped onto the final CCDC47 model after fitting into the cryo-EM density map.
The translocon extends ~90 x 120 x 140 Å, with Sec61 and its accessory factors arranged near the ribosome exit tunnel and significant mass on both sides of the membrane (Figure 3A). Ribosome binding is mediated by multiple protein-protein and protein-RNA contacts (Figure 3A,C). These position the cytosolic domains of TMCO1 and CCDC47 near the nascent chain as it emerges from the ribosome exit tunnel, and place the luminalNicalin domain near translocated segments of the nascent chain. Notably, the long C-terminal coiled-coil of CCDC47 extends to the nascent chain at the ribosome exit tunnel (Figure 3A,B). Truncating this conserved motif causes a developmental disorder in humans (Morimoto et al., 2018), suggesting that this interaction is functionally important.
Figure 3.
Organization of the TMCO1 translocon around the ribosome exit tunnel.
(A) Closeup view showing TMCO1 (blue), CCDC47 (violet), TMEM147 (purple), Nicalin (pink) and the Sec61 complex arranged near the nascent polypeptide (orange spheres) at the mouth of the ribosome exit tunnel. (B) View of the translocon from the membrane (the Nicalin luminal domain was omitted for clarity). (C) Surface representation of the ribosome large subunit showing regions that contact Sec61, TMEM147, TMCO1 and CCDC47.
Organization of the TMCO1 translocon around the ribosome exit tunnel.
(A) Closeup view showing TMCO1 (blue), CCDC47 (violet), TMEM147 (purple), Nicalin (pink) and the Sec61 complex arranged near the nascent polypeptide (orange spheres) at the mouth of the ribosome exit tunnel. (B) View of the translocon from the membrane (the Nicalinluminal domain was omitted for clarity). (C) Surface representation of the ribosome large subunit showing regions that contact Sec61, TMEM147, TMCO1 and CCDC47.A prominent feature of the complex is a large (~25 x 30 x 30 Å), lipid-filled cavity formed at the center of the translocon by Sec61, TMEM147 and TMCO1 (Figure 3B). Like other structurally characterized members of the Oxa1 superfamily (Anghel et al., 2017; Kumazaki et al., 2014; Borowska et al., 2015), the transmembrane helices of TMCO1 form a funnel that extends from the cytosol into the lipid bilayer (Figure 4A). In bacterial YidC, this funnel operates as a transient binding site for TMDs, which are then released into the membrane (Kumazaki et al., 2014; Borowska et al., 2015). TMCO1 is located on the ‘back’ side of Sec61 in the TMCO1 translocon (Figure 4B). Here, the TMCO1 funnel lines the lipid-filled cavity at the center of the translocon, suggesting that a hydrophobic segment could be inserted from the cytosol into a protected membrane environment.
Figure 4.
Conserved structural features suggest pathways into the membrane.
(A) Comparison of experimentally determined structures for bacterial, archaeal and human members of the Oxa1 superfamily of membrane protein biogenesis factors. The evolutionarily conserved three TMD core (cyan, lime and orange), forms a funnel extending from the cytosol into the bilayer. A surface representation of TMCO1 (blue) is shown at right. (B) Slice through the membrane of the TMCO1 translocon, viewed from the cytosol. The large lipid-filled cavity formed by Sec61, TMEM147 and TMCO1 is visible at the center of the translocon. Red arrows indicate known (via Sec61) and potential (via TMCO1 and TMEM147) routes into the membrane. (C) Closeup of the Sec61-TMEM147 interaction. The seven TMDs of TMEM147 (purple) form a large funnel that extends from the ER lumen into the lipid bilayer. (D) Surface representation of TMEM147. The hinge region of Sec61 (green) partially occludes the bilayer-exposed opening of the funnel (left), but not the luminal opening (right).
(A) Arrangement of Sec61 (green) and the TMEM147-Nicalin complex (purple, pink) in the TMCO1 translocon, highlighting the Sec61 hinge region interaction with the luminal TMEM147 funnel. (B) Structurally analogous interaction of presenillin-1 (yellow) with the APH-1 subunit (cyan) of γ-secretase (PDB ID 5A63) (Bai et al., 2015). Note that the APH-1 funnel is completely occupied by presenillin-1. (C) The Hrd1 protein conducting ERAD channel (PDB ID 5V6P) (Schoebel et al., 2017) contains a large cytosolic funnel that opens to the bilayer. TM1 of a neighboring Hrd1 subunit (green) is proposed to gate access to the cytosolic leaflet of the bilayer.
Orthogonal views of the (A) TMCO1- (B) OST translocons (PDB ID 6FTI) (Braunger et al., 2018), aligned on the Sec61 complex. The primary ribosome contacts are mediated by CCDC47 (violet), TMCO1 (blue) and TMEM147 (purple) in the TMCO1 translocon, and by RPN1 (orange) in OST; these binding sites are non-overlapping. By contrast, there are extensive steric clashes between the luminal domains of Nicalin (pink) and STT3A (yellow). In addition, TMDs of TMCO1, TMEM147 and Nicalin overlap with TMDs of the STT3A (catalytic subunit), DC2 and OST4 in the OST complex. Note the presence of an unassigned helix in the OST structure, proposed to belong to the opsin substrate TMD (red), which resides near the large, lipid-filled cavity observed in the TMCO1 translocon.
Conserved structural features suggest pathways into the membrane.
(A) Comparison of experimentally determined structures for bacterial, archaeal and human members of the Oxa1 superfamily of membrane protein biogenesis factors. The evolutionarily conserved three TMD core (cyan, lime and orange), forms a funnel extending from the cytosol into the bilayer. A surface representation of TMCO1 (blue) is shown at right. (B) Slice through the membrane of the TMCO1 translocon, viewed from the cytosol. The large lipid-filled cavity formed by Sec61, TMEM147 and TMCO1 is visible at the center of the translocon. Red arrows indicate known (via Sec61) and potential (via TMCO1 and TMEM147) routes into the membrane. (C) Closeup of the Sec61-TMEM147 interaction. The seven TMDs of TMEM147 (purple) form a large funnel that extends from the ER lumen into the lipid bilayer. (D) Surface representation of TMEM147. The hinge region of Sec61 (green) partially occludes the bilayer-exposed opening of the funnel (left), but not the luminal opening (right).
Structural comparisons with γ-secretase and the Hrd1 protein conducting ERAD channel.
(A) Arrangement of Sec61 (green) and the TMEM147-Nicalin complex (purple, pink) in the TMCO1 translocon, highlighting the Sec61 hinge region interaction with the luminalTMEM147 funnel. (B) Structurally analogous interaction of presenillin-1 (yellow) with the APH-1 subunit (cyan) of γ-secretase (PDB ID 5A63) (Bai et al., 2015). Note that the APH-1 funnel is completely occupied by presenillin-1. (C) The Hrd1 protein conducting ERAD channel (PDB ID 5V6P) (Schoebel et al., 2017) contains a large cytosolic funnel that opens to the bilayer. TM1 of a neighboring Hrd1 subunit (green) is proposed to gate access to the cytosolic leaflet of the bilayer.
Structural comparison of the TMCO1- and OST translocons.
Orthogonal views of the (A) TMCO1- (B) OST translocons (PDB ID 6FTI) (Braunger et al., 2018), aligned on the Sec61 complex. The primary ribosome contacts are mediated by CCDC47 (violet), TMCO1 (blue) and TMEM147 (purple) in the TMCO1 translocon, and by RPN1 (orange) in OST; these binding sites are non-overlapping. By contrast, there are extensive steric clashes between the luminal domains of Nicalin (pink) and STT3A (yellow). In addition, TMDs of TMCO1, TMEM147 and Nicalin overlap with TMDs of the STT3A (catalytic subunit), DC2 and OST4 in the OST complex. Note the presence of an unassigned helix in the OST structure, proposed to belong to the opsin substrate TMD (red), which resides near the large, lipid-filled cavity observed in the TMCO1 translocon.TMEM147 also lines the lipid-filled cavity. Here, its seven TMDs form a funnel that extends from the lumen partway across the membrane. Within the bilayer, the Sec61 hinge (located between TM5 and TM6) contacts TM2, TM3 and TM4 inside the TMEM147 funnel. A similar intra-membrane interaction is observed in γ-secretase, where the presenilin C-terminus fills the hydrophobic APH-1 funnel (Figure 4—figure supplement 1B; Bai et al., 2015). Unlike in γ-secretase, however, the Sec61 hinge only partially occupies the TMEM147 funnel, laterally sealing it in membrane, but leaving it open to the lumen (Figure 4C,D). This is reminiscent of the Hrd1 protein conducting ERAD channel, in which a structurally similar hydrophilic funnel, proposed to transport transmembrane segments from the bilayer to the cytosol, opens to the cytosol, and is laterally sealed by a neighboring Hrd1 subunit (Figure 4—figure supplement 1C; Schoebel et al., 2017). By analogy, TMEM147 could insert a hydrophobic segment from the lumen into the central membrane cavity in a process gated by Sec61. Taken together, these structural observations suggest that the TMCO1 translocon may be specialized for membrane protein biogenesis.
Figure 4—figure supplement 1.
Structural comparisons with γ-secretase and the Hrd1 protein conducting ERAD channel.
(A) Arrangement of Sec61 (green) and the TMEM147-Nicalin complex (purple, pink) in the TMCO1 translocon, highlighting the Sec61 hinge region interaction with the luminal TMEM147 funnel. (B) Structurally analogous interaction of presenillin-1 (yellow) with the APH-1 subunit (cyan) of γ-secretase (PDB ID 5A63) (Bai et al., 2015). Note that the APH-1 funnel is completely occupied by presenillin-1. (C) The Hrd1 protein conducting ERAD channel (PDB ID 5V6P) (Schoebel et al., 2017) contains a large cytosolic funnel that opens to the bilayer. TM1 of a neighboring Hrd1 subunit (green) is proposed to gate access to the cytosolic leaflet of the bilayer.
The TMCO1 translocon functions in multi-pass membrane protein biogenesis
We sought to test this possibility by sequencing the mRNAs associated with ribosomes recovered after affinity purification via the Flag tag on TMCO1 (RIP-seq). Remarkably, we observed strong enrichment for transcripts encoding secretory pathway transmembrane proteins (Figure 5A). Of these, single-pass proteins—by far the most abundant type of membrane protein in the human genome—were strongly depleted (Figure 5B). By contrast, transcripts encoding multi-pass membrane proteins with four or more TMDs were enriched (Figure 5B). These include numerous transporters, receptors, transferases and hydrolases (Figure 5C). Consistent with selective enrichment of TMCO1-linked transcripts, we observed enrichment across three orders of magnitude of transcript abundance in the input sample (Figure 5D), and this was independent of protein length (Figure 5—figure supplement 1A). These data directly link the TMCO1 translocon to a co-translational process involving hundreds of different multi-pass clients.
Figure 5.
The TMCO1 translocon acts on multi-pass membrane proteins.
(A) Log2 enrichment of transcripts encoding proteins of the indicated categories according to Uniprot annotation. Enrichment was calculated as (Flag IP - Ctrl IP)/Input, where “Flag IP” and “Ctrl IP” are the average transcript levels in the ribosome fraction following anti-Flag immunoprecipitation from digitonin-solubilized wild-type (Ctrl) or 3xFlag-TMCO1 (Flag) HEK293 membranes (n=3), and “Input” is the average transcript abundance in the total membrane fraction (n=2). More than 98% of the most enriched transcripts (right of the dashed line) encode secretory pathway transmembrane proteins. (B) Proportion of secretory pathway transmembrane proteins containing the indicated number of Uniprot-predicted TMDs in the input (gray), and in the 529 most enriched membrane-protein encoding transcripts from the elution (red). (C) PANTHER classification for the enriched set of membrane proteins. (D) Transcript levels in the TMCO1 immunoprecipitated sample (“IP abundance”) plotted against transcript levels in total HEK293 membranes (“input abundance”). Enrichment (above the dashed line) is seen across three orders of magnitude of input mRNA abundance. (E) Representative western blot of total HEK293 lysate from wild-type (WT) and knockout (ΔTMCO1 and ΔTRAM) cells, in duplicate. Expression of the multi-pass membrane protein EAAT1, is decreased in the TMCO1 knockout cells, but is unaffected by deletion of the unrelated Sec61 accessory factor, TRAM. Note that the EAAT1 “multimer” band is from SDS-induced aggregation. (F) As in (E), for the indicated single- and double-knockout cells. Tubulin serves as a loading control. Note that disruption of Nicalin reduces the expression levels of its binding partner, NOMO, as shown previously (Dettmer et al., 2010). The faint band migrating just above Nicalin in the ΔNicalin cells is a cross-reacting band. (G) Quantification of protein expression levels for EAAT1 (monomer and multimer), showing mean and S.D., relative to WT cells.
(A) Plot of RIP-seq transcript enrichment (“IP enrichment”) vs. protein “engaged length” for all observed secretory pathway transmembrane proteins. Here, “engaged length” is defined as the number of residues following the signal peptide or first transmembrane domain. No correlation is observed between the engaged length and enrichment. (B) Steady-state expression levels and glycosylation patterns of the multi-pass protein EAAT1, and two single-pass proteins, integrin α5 and TRAPα. EAAT1 and integrin α5 are plasma membrane proteins, and TRAPα is an ER membrane protein. The 'multimer' bands visible in the EAAT1 blot are from SDS-induced aggregation, exacerbated here by the denaturing conditions used for deglycosylation (compare with Figure 5E, F). The asterisk indicates a cross-reactive band. (C) Quantification of EAAT1 mRNA levels by qRT PCR analysis. GAPDH-normalized EAAT1 mRNA levels (mean, S.D.) in the indicated cell lines, relative to wild-type cells. In each case, EAAT1 mRNA levels change by less than 1.5-fold.
Figure 5—figure supplement 1.
Additional functional analysis.
(A) Plot of RIP-seq transcript enrichment (“IP enrichment”) vs. protein “engaged length” for all observed secretory pathway transmembrane proteins. Here, “engaged length” is defined as the number of residues following the signal peptide or first transmembrane domain. No correlation is observed between the engaged length and enrichment. (B) Steady-state expression levels and glycosylation patterns of the multi-pass protein EAAT1, and two single-pass proteins, integrin α5 and TRAPα. EAAT1 and integrin α5 are plasma membrane proteins, and TRAPα is an ER membrane protein. The 'multimer' bands visible in the EAAT1 blot are from SDS-induced aggregation, exacerbated here by the denaturing conditions used for deglycosylation (compare with Figure 5E, F). The asterisk indicates a cross-reactive band. (C) Quantification of EAAT1 mRNA levels by qRT PCR analysis. GAPDH-normalized EAAT1 mRNA levels (mean, S.D.) in the indicated cell lines, relative to wild-type cells. In each case, EAAT1 mRNA levels change by less than 1.5-fold.
The TMCO1 translocon acts on multi-pass membrane proteins.
(A) Log2 enrichment of transcripts encoding proteins of the indicated categories according to Uniprot annotation. Enrichment was calculated as (Flag IP - Ctrl IP)/Input, where “Flag IP” and “Ctrl IP” are the average transcript levels in the ribosome fraction following anti-Flag immunoprecipitation from digitonin-solubilized wild-type (Ctrl) or 3xFlag-TMCO1 (Flag) HEK293 membranes (n=3), and “Input” is the average transcript abundance in the total membrane fraction (n=2). More than 98% of the most enriched transcripts (right of the dashed line) encode secretory pathway transmembrane proteins. (B) Proportion of secretory pathway transmembrane proteins containing the indicated number of Uniprot-predicted TMDs in the input (gray), and in the 529 most enriched membrane-protein encoding transcripts from the elution (red). (C) PANTHER classification for the enriched set of membrane proteins. (D) Transcript levels in the TMCO1 immunoprecipitated sample (“IP abundance”) plotted against transcript levels in total HEK293 membranes (“input abundance”). Enrichment (above the dashed line) is seen across three orders of magnitude of input mRNA abundance. (E) Representative western blot of total HEK293lysate from wild-type (WT) and knockout (ΔTMCO1 and ΔTRAM) cells, in duplicate. Expression of the multi-pass membrane protein EAAT1, is decreased in the TMCO1 knockout cells, but is unaffected by deletion of the unrelated Sec61 accessory factor, TRAM. Note that the EAAT1 “multimer” band is from SDS-induced aggregation. (F) As in (E), for the indicated single- and double-knockout cells. Tubulin serves as a loading control. Note that disruption of Nicalin reduces the expression levels of its binding partner, NOMO, as shown previously (Dettmer et al., 2010). The faint band migrating just above Nicalin in the ΔNicalin cells is a cross-reacting band. (G) Quantification of protein expression levels for EAAT1 (monomer and multimer), showing mean and S.D., relative to WT cells.
Additional functional analysis.
(A) Plot of RIP-seq transcript enrichment (“IP enrichment”) vs. protein “engaged length” for all observed secretory pathway transmembrane proteins. Here, “engaged length” is defined as the number of residues following the signal peptide or first transmembrane domain. No correlation is observed between the engaged length and enrichment. (B) Steady-state expression levels and glycosylation patterns of the multi-pass protein EAAT1, and two single-pass proteins, integrin α5 and TRAPα. EAAT1 and integrin α5 are plasma membrane proteins, and TRAPα is an ER membrane protein. The 'multimer' bands visible in the EAAT1 blot are from SDS-induced aggregation, exacerbated here by the denaturing conditions used for deglycosylation (compare with Figure 5E, F). The asterisk indicates a cross-reactive band. (C) Quantification of EAAT1 mRNA levels by qRT PCR analysis. GAPDH-normalized EAAT1 mRNA levels (mean, S.D.) in the indicated cell lines, relative to wild-type cells. In each case, EAAT1 mRNA levels change by less than 1.5-fold.To evaluate the role of the TMCO1 translocon in biogenesis, we monitored the endogenous protein levels of the ‘Excitatory amino acid transporter 1’ (EAAT1; SLC1A3; GLAST-1) in HEK293 cells lacking different accessory components. EAAT1 is a member of the large solute carrier (SLC) transporter superfamily, more than one-third of which were enriched by RIP-seq. EAAT1 functions as a homotrimer, and its structure contains multiple TMDs of marginal hydrophobicity and re-entrant helical loops on both sides of the membrane, all of which are required for function (Canul-Tec et al., 2017).Compared to wild-type cells, the steady-state expression level of EAAT1 was reduced by ~3 fold in TMCO1 knockout cells, but was unaffected in cells lacking the auxiliary translocon component TRAM (Figure 5E–G). Similar reductions were observed in Nicalin (2.4-fold), TMCO1/Nicalin (2.8-fold) and TMCO1/CCDC47 (3.8-fold) single- and double-knockout cells, while a single CCDC47 (1.6-fold) knockout showed only a modest reduction (Figure 5F,G). By contrast, the steady-state expression levels and glycosylation patterns of two single-pass membrane proteins, integrin α5 and TRAPα, were unchanged, demonstrating that TMCO1 disruption does not lead to a general defect in membrane protein biogenesis (Figure 5—figure supplement 1B). We also observed little change in EAAT1 mRNA levels in TMCO1, Nicalin and CCDC47 single- and double-knockout cells. Together with the structural analysis, these data implicate the TMCO1 translocon in multi-pass membrane protein biogenesis.
Discussion
Our data identify TMCO1, CCDC47 and the Nicalin-TMEM147-NOMO complex as conserved components of an ER translocon that functions co-translationally with Sec61 during biogenesis of multi-pass membrane proteins. The biochemical function of the TMCO1 translocon is currently unclear. Although we do not formally exclude a role in client-specific targeting to the ER, we propose that the TMCO1 translocon functions as an insertase and intramembrane chaperone. Our structural model for TMCO1 is consistent with its evolutionary relationship to members of the Oxa1 superfamily, including YidC, Get1, EMC3 and Ylp1 (Anghel et al., 2017). These proteins have evolved to function in different contexts, but their ability to move transmembrane segments into the membrane appears to be conserved (Wang et al., 2014; Klenner et al., 2008; Pleiner et al., 2020; Yu et al., 2008). By analogy, we propose that hydrophobic segments of the nascent chain that inefficiently engage with Sec61 could access the membrane through the conserved cytosolic TMCO1 funnel. In addition, hydrophobic segments that have translocated across the bilayer through the canonical Sec61 channel might access the membrane through the luminalTMEM147 funnel. As segments integrate, the central cavity of the translocon could shield the nascent chain to minimize misfolding and degradation. Organizing these putative functions in a single translocon might increase the efficiency with which different biophysical and topological features of the nascent chain are accommodated during multi-pass membrane protein biogenesis (Cymer et al., 2015; Lu et al., 2000; Skach, 2009). High resolution structures of the TMCO1 translocon and analysis of its interactions with substrate will be important for testing this model.More broadly, our data support a general view of the translocon as a dynamic assembly whose subunit composition varies temporally to meet the demands of a particular client (Conti et al., 2015; Johnson and van Waes, 1999). TMCO1, CCDC47 and the Nicalin-TMEM147-NOMO complex are abundant (Itzhak et al., 2016), which presumably allows them to compete with other translocon-associated factors for access to the nascent chain. Indeed, while many multi-pass clients of the TMCO1 translocon harbor N-terminal STT3A glycosylation sites (Cherepanova et al., 2019), we see little biochemical or structural evidence for an associated OST complex. This is consistent with the substantial steric overlap observed between the membrane and luminal regions of OST and the TMCO1 accessory factors (Figure 4—figure supplement 2), which likely dictates that they alternately access the nascent chain during synthesis. Notably, TMCO1, CCDC47 and the Nicalin-TMEM147-NOMO complex do not stably associate in the absence of ribosomes (Figure 1—figure supplement 1). An intriguing possibility is that these are modular components, capable of acting independently in additional contexts.
Figure 4—figure supplement 2.
Structural comparison of the TMCO1- and OST translocons.
Orthogonal views of the (A) TMCO1- (B) OST translocons (PDB ID 6FTI) (Braunger et al., 2018), aligned on the Sec61 complex. The primary ribosome contacts are mediated by CCDC47 (violet), TMCO1 (blue) and TMEM147 (purple) in the TMCO1 translocon, and by RPN1 (orange) in OST; these binding sites are non-overlapping. By contrast, there are extensive steric clashes between the luminal domains of Nicalin (pink) and STT3A (yellow). In addition, TMDs of TMCO1, TMEM147 and Nicalin overlap with TMDs of the STT3A (catalytic subunit), DC2 and OST4 in the OST complex. Note the presence of an unassigned helix in the OST structure, proposed to belong to the opsin substrate TMD (red), which resides near the large, lipid-filled cavity observed in the TMCO1 translocon.
A general role for the TMCO1 translocon in multi-pass membrane protein biogenesis is consistent with the wide expression and conservation of its subunits, and the numerous cellular and organismal phenotypes associated with their dysfunction. In humans, TMCO1 has been linked to glaucoma (Burdon et al., 2011; Sharma et al., 2012), and loss of eitherTMCO1 (Xin et al., 2010; Caglayan et al., 2013; Alanay et al., 2014) or CCDC47 (Morimoto et al., 2018) causes rare autosomal recessive developmental disorders. Similarly, a mutation in TMEM147 has been linked to a rare neurodevelopmental disorder manifesting with severe intellectual disability and impaired vision (Reuter et al., 2017).At the cellular level, disrupting TMCO1, CCDC47, Nicalin, TMEM147 or NOMO leads to reduced fitness (Wang et al., 2015). Cells lacking CCDC47 show attenuated ERAD (Yamamoto et al., 2014) and impaired Ca2+ signaling (Zhang et al., 2007; Konno et al., 2012), while the Nicalin-TMEM147-NOMO complex is linked to Nodal signaling (Haffner et al., 2004) and altered localization and subunit composition of some multi-pass membrane proteins (Almedom et al., 2009; Kamat et al., 2014; Rosemond et al., 2011). Cells lacking TMCO1 show defects in Ca2+ handling, which has led to the proposal that TMCO1 functions as a Ca2+-channel (Wang et al., 2016). Our data reconcile these different observations, which likely result from biogenesis defects in hundreds of different multi-pass proteins.As the folding capacity of the cell must be robust to mutations and otherstresses that affect folding efficiency, it is likely that otherER chaperones and accessory factors can partially compensate for loss of TMCO1 translocon components. In this regard, it will be important to define the functional relationship between the TMCO1 translocon and the ER membrane complex (EMC), each of which harbors a subunit belonging to the Oxa1 superfamily (Anghel et al., 2017) and facilitates multi-pass membrane protein biogenesis (Chitwood et al., 2018; Guna et al., 2018; Shurtleff et al., 2018; Volkmar et al., 2019; Tian et al., 2019).
Materials and methods
Antibodies
Antibodies against humanTMCO1, Sec61β and TRAPα were characterized previously (Fons et al., 2003; Anghel et al., 2017; Görlich et al., 1992). Additional antibodies were obtained from the following sources: anti-EAAT1 (Santa Cruz, sc-515839), anti-Sec61α (Thermo Fisher, PA5-21773), anti-uL22 (Abgent, AP9892b), anti-STT3A (Novus, H00003703-M02), anti-Tubulin (Abcam, ab7291), anti-Integrin α5 (Cell signaling, 4705) anti-Nicalin (Bethyl, A305-623A-M), anti-TMEM147 (Thermo Fisher, PA5-95876), anti-NOMO (Thermo Fisher, PA5-47534), anti-CCDC47 (Bethyl, A305-100A), anti-TRAM1 (Abcam, ab190982), anti-Mouse rabbit HRP (Abcam, ab6708), anti-Rabbit donkey HRP (Sigma, SAB3700863), anti-Goat rabbit HRP (Sigma, A5420).
Cell culture
Flp-In T-REx 293 cells containing a 3xFlag-Cas9 construct were maintained in DMEM supplemented with 10% FBS (Gemini Foundation) and penicillin/streptomycin mixture (Invitrogen). TMCO1 knockout and 3xFlag-TMCO1HEK293 cell lines have been described and characterized previously (Anghel et al., 2017). Nicalin and CCDC47 knockout cell lines were generated using the CRISPR/Cas9 system, in both parental and TMCO1 knockout backgrounds. Cas9 expression was induced by addition of 10 ng/mL doxycycline followed by transfection of sgRNAs targeting eitherNicalin (ACGGAATGCAGTGCTGAACA) or CCDC47 (TCAGTGATTATGACCCGTT). Cells were grown for 48 hr, followed by single cell sorting into 96 well plates for clonal isolation. Nicalin and CCDC47 knockouts in parental and TMCO1 knockout backgrounds were verified by western blot and genomic DNA sequencing.A TRAM1 knockout cell line was generated using the CRISPR/Cas9 system in Flp-In T-Rex 293 cells (Thermo Fisher) by transfecting a modified pX330 plasmid (Addgene) expressing human codon-optimized Cas9 and an sgRNA targeting TRAM1 (TTTGATGCCATAGTAATAAA). Single cells were isolated by sorting and allowed to grow clonally. The final TRAM1 knockout was verified by western blot and genomic DNA sequencing.To scale up the sample preparation for crosslinking mass spectrometry (XL-MS) and cryo-EM, Flp-In TRex 293 cells expressing 3xFlag-TMCO1 from the endogenous TMCO1 promoter were cultured in suspension. Cells were grown in 1 L PETG square media bottles (Fisher, 09-923-16C) containing 250 ml Freestyle 293 media (Gibco) supplemented with 10 mM Hepes pH 7.5 (Invitrogen), 10 mM L-glutamine (Invitrogen), 0.3 μg/ml penicillin (Gemini), 0.5 μg/ml streptomycin (Gemini), and 0.5% FBS (Gemini Foundation), at 37°C, 5% CO2, and 135 rpm, to a final density of ~1×106 cells/ml.Stable cell lines overexpressing N-terminally 3xFlag tagged TMCO1 and Nicalin were generated by transfecting the respective knockout cell lines with a modified pEGFP-n1 plasmid (Addgene) encoding N-terminally 3xFlag-tagged TMCO1 or Nicalin (tag inserted after the signal peptide), under the control of a CMV promoter. Cells were transfected using the TransIT-293 transfection reagent (Mirus) and selected for 14 days by treatment with 0.7 mg/ml G418 (Invitrogen), with selection media changed every 3 days. Selected cells were maintained in DMEM supplemented with 10% FBS, penicillin/streptomycin, and 0.3 mg/ml G418. Expression was verified by western blot.Cells were checked approximately every three months for mycoplasma contamination using the Universal Mycoplasma Detection Kit (ATCC), and were found to be negative.
Isolation of TMCO1-ribosome complexes for interaction analysis
For mass spectrometry, approximately 2 × 108 of wild-type (control) and 3xFlag-TMCO1 cells were pelleted, resuspended in ice cold hypotonic lysis buffer (10 mM Hepes pH 7.4, 10 mM potassium acetate, 1 mM magnesium chloride) and incubated on ice for 15 min. Unless otherwise noted, all buffers included emetine at a final concentration of 50 µg/ml. Cells were lysed with 25 strokes of a pre-chilled dounce tissue grinder with a tight-fitting pestle, then 250 mM sucrose and 1 mM PMSF was added to the lysate. Nuclei were pelleted by centrifugation at 700 x g for 3 min. The membrane-containing supernatant was removed and put on ice. The pellet was washed with 1 ml ice cold assay buffer (50 mM Hepes pH 7.4, 250 mM sucrose, 250 mM potassium acetate, 10 mM magnesium chloride) and centrifuged again, and the supernatant combined with the membrane fraction. Membranes were sedimented at 10,000 x g for 10 min at 4°C and resuspended in assay buffer to an A260 of ~50.Monosomes were generated by treating the resuspended membranes with 1 mM calcium acetate and 10,000 U of micrococcal nuclease (NEB, M0247S), and incubating at 25°C for 10 min. Nuclease activity was stopped by adding EGTA to a final concentration of 2 mM. Membranes were solubilized in ice cold assay buffer supplemented with 2.5% digitonin (Calbiochem 11024-24-1) for 15 min on ice, and insoluble material was removed by centrifugation at 10,000 x g for 10 min at 4°C.TMCO1-ribosome complexes were affinity purified by incubating solubilized material with M2 Flag affinity gel (Sigma, A2220) for 1 hr at 4°C with gentle end-over-end mixing. Unbound material was removed by centrifugation, the resin was washed twice with five bed volumes of ice-cold wash buffer (50 mM Hepes pH 7.4, 250 mM sucrose, 350 mM potassium acetate, 10 mM magnesium chloride, 0.25% digitonin), and twice with five bed volumes of assay buffer supplemented with 0.25% digitonin. Bound material was eluted in two successive 30 min incubations with two bed volumes of ice-cold assay buffer supplemented with 0.25% digitonin and 0.5 mg/ml 3xFlag peptide, at 4°C with gentle end-over-end mixing. The ribosome containing fraction was obtained by sedimenting the IP elutions through a 1 mL sucrose cushion (1 M sucrose, 150 mM potassium chloride, 50 mM Tris pH 7.5, 5 mM magnesium chloride, 0.1% digitonin) at 250,000 x g for 2 hr in a TLA100.3 rotor.Ribosome pellets were resuspended in 50 mM Hepes pH 7.4, 100 mM sodium chloride, 1% SDS. Proteins were then methanol-chloroform extracted, FASP trypsin-digested, TMT-labeled and analyzed in a single 180 min LC-MS/MS run at the Proteomics and Mass Spectrometry Facility at Harvard University. Enrichment ratios were calculated as Flag IP/control IP for all peptides identified more than once.Small-scale IPs were performed similarly, using microsomes isolated from stably integrated 3xFlag-TMCO1 or 3xFlag-NicalinHEK293 cells.
Isolation of complexes for XL-MS and cryo-EM
Affinity purification of TMCO1-ribosome complexes for XL-MS and cryo-EM was done as described above with the following changes. Typically, XL-MS samples were produced from ~4×109 cells, and cryo-EM samples from ~7×108 cells. Emetine was not used. To remove any contaminating DNA, isolated membranes were treated with 5 U/ml RNase Free DNase (Promega, M6101) for 15 min at room temperature. Following affinity purification, TMCO1-ribosome complexes were isolated via sedimentation through a 300 µl sucrose cushion (0.5 M sucrose, 150 mM potassium acetate, 50 mM Hepes pH 7.4, 5 mM magnesium chloride, 0.25% digitonin) at 355,000 x g for 45 min in a TLA120.1 rotor. Pellets were resuspended in 150 mM potassium acetate, 50 mM Hepes pH 7.4, 5 mM magnesium chloride, 0.25% digitonin, and concentration determined by A260.
Chemical cross-linking and mass spectrometry
Approximately 85 μg of purified TMCO1-ribosome complexes were resuspended in 150 mM potassium acetate, 50 mM Hepes pH 7.4, 5 mM magnesium chloride, 0.25% digitonin to a concentration of 0.5 mg/ml. Crosslinking was performed by adding disuccinimidyl suberate (DSS, Thermo Fisher, 21555) (prepared as a fresh 10 mM stock in DMSO) to a final concentration of 0.5 mM and incubating for 30 min at 35°C. Crosslinking reactions were mixed by lightly agitating the tube every 5 min during incubation, and quenched by adding 100 mM Tris pH 8. Reactions were TCA precipitated before processing for mass spectrometry. Pellets were washed with ice cold acetone to remove excess lipid and detergent, and then pelleted again.For mass spectrometry, the TCA precipitated material was resuspended in 8 M Urea and 10 mM TCEP, heated at 56°C for 20 min, alkylated with 15 mM iodoacetamide (30 min at room temperature), and then quenched with 15 mM dithiothreiotol (15 min at room temperature). The sample was then diluted to 2 M Urea and digested overnight with 1 µg trypsin (Promega Gold) for 4 hr at 37°C. A second aliquot of 1 µg trypsin was then added and digestion was allowed to proceed overnight. The digestion mixture was acidified to 0.5% TFA and diluted 6-fold prior to desalting on a Peptide C18 MacroTrap column (Michrom Bioresources) controlled by Akta Purifier (GE Healthcare Life Sciences) and evaporated to dryness. Crosslinked products were brought up in 10 µl of SEC buffer (70:30 H2O:ACN with 0.1% TFA) and enriched by size-exclusion chromatography (Superdex Peptide, GE Healthcare Life Sciences) as in Leitner et al., 2012. 100 µl fractions eluting between 0.9 and 1.4 ml were dried, resuspended in 0.1% formic acid for MS analysis. The fractions starting at 0.9 ml and 1.3 ml were combined prior to evaporation to make four MS fractions.Samples were reconstituted in 5 µl of 0.1% formic acid for mass spectrometry. LC-MS analysis was performed with an Orbitrap Fusion Lumos mass spectrometer (Thermo Scientific) coupled with a nanoelectrospray ion source (Easy-Spray, Thermo) and M-Class NanoAcquity UPLC system (Waters). Crosslink enriched fractions were separated on a 50 cm x 75 μm ID PepMap C18 column (Thermo). 2.5 µl of sample was loaded onto the column and eluted running a gradient from 3.5% solvent B (A: 0.1% formic acid in water, B: 0.1% in ACN) to 25% B in 175 min followed by a second gradient to 30% B over 10 min. Precursor scans were acquired in the Orbitrap from 375 to 1500 m/z (resolution: 120000, AGC Target: 4.0e5, max injection time: 50 ms). Precursor ions were selected for dissociation using the following criteria: peptide monoisotopic precursor determination, charge state between 3–9, intensity greater than 5e4, and a 30 s dynamic exclusion window. Each precursor that passed the selection criteria was subjected to subsequent HCD and ETD MS2 scans (resolution: 30000, quadrupole isolation window: 1.6 m/z units, HCD NCE: 28%, HCD AGC Target: 1.0e5, HCD max injection time: 150 ms, ETD collision time: calibrated charge dependent ETD parameters, ETD supplemental activation: 10% EThcD, ETD AGC Target: 2.0e5, ETD max injection time: 200 ms). Nine product ion scans of each type were performed for each precursor scan.Separate peaklists were generated for ETD and HCD scans using Proteome Discoverer 2.2 (Thermo) and searched using Protein Prospector 5.23.0 (66). The search database consisted of the sequences of 82 human ribosomal protein components in addition to 10 sequences corresponding to the membrane associated components: TMCO1, Nicalin, NOMO1, NOMO2, NOMO3, Sec61A1, Sec61A2, Sec61β, Sec61γ, TMEM147 and CCDC47. The sequence of TMCO1 contained the N-terminal 3xFlag tag (reported crosslinked residue numbers reference the endogenous sequence). The three NOMO isoforms are highly homologous and in most cases cross-links to NOMO could not be assigned a specific isoform. These proteins were confirmed to be the dominant components of the sample by MS analysis of late eluting SEC fractions (corresponding to linear peptides). The 92 target proteins were concatenated with a decoy database consisting of 10 randomized amino acid sequences of for each target sequence (1012 total protein sequences searched). ETD peaklists were searched using Prospector instrument type ESI-ETD-high-res and HCD peaklists were searched using ESI-Q-high-res. Other search parameters were: mass tolerance of 7 ppm (precursor) and 15 ppm (product); fixed modifications of carbamidomethylation on cysteine; variable modifications of peptide N-terminal glutamine conversion to pyroglutamate, oxidation of methionine, and ‘dead-end’ modification of lysine and the protein N-terminus by semi-hydrolyzed BS3, protein N-terminal acetylation, protein N-terminal methionine loss, and incorrect monoisotopic precursor selection (neutral loss of 1 Da); crosslinking reagent was DSS/BS3; trypsin specificity was used with three missed cleavages and three variable modifications per peptide were allowed. The top 85 product ion signals were used for the search. Searches were performed using 64 cores on an HPC cluster and took about 4 hr to complete.Cross-link spectral matches (CSM) were initially kept with peptide scores above 20, score difference above 0, and length of each peptide between 4–25 residues. A linear support vector machine (SVM) model was constructed to classify CSMs between decoy and target classes (Trnka et al., 2014). Features selected for the SVM classifier were: score difference, percent of ions matched, precursor charge state, rank of each peptide, and length of each peptide. Models were trained on half of the dataset and parameters were chosen to give a specificity of 90% tested on the other half of the data. Separate classifiers were built for ETD and HCD results. The best scoring CSM per unique cross-linked residue pair was selected and the ETD and HCD results were merged. The distribution of cross-linked residue pairs with one and two incorrectly identified peptides was modeled using essentially the same logic as (Fischer and Rappsilber, 2017), but extending their analysis to account for the 10x increased size of decoy database. The number of target-target hits with one wrong peptide is given by:and the number with both wrong is given by:where TT, TD, and DD are the number of target-target, target-decoy, and decoy-decoy hits, and k is the scaling factor describing the ratio in size of the decoy database to size of the target database. In this case k = 10. The final list of cross-links was reported at an SVM score of 1.5 which corresponded to a 0.55% FDR. Distance analysis was performed by measuring the Cα-Cα distances between all ribosome cross-links against an EM reconstruction of the human 80S ribosome (PDB ID 4ug0). At the reporting threshold of 1.5, the violation rate (fraction of mappable cross-links > 35 Å) was 8.7%.
Cryo-EM sample preparation and data acquisition
Quantifoil 1.2/1.3 200 mesh grids coated in a 2 nm carbon film (Ted Pella, Inc) were glow discharged for 30 s immediately before use. Using an FEI Vitrobot, 2.5 μl of ~100 nM sample was applied to each grid, which was then incubated for 15 s at 22°C and 100% humidity, blotted for 11 s, and flash frozen in liquid ethane. Data were collected on an FEI Titan Krios at 300 KV using Latitude S (Gatan) software, targeting defocus values from −2.5 to −1.0 μm. Exposure movies were recorded using a Gatan K3 energy filter and direct electron detector in super resolution mode at 64,000x magnification (super resolution pixel size of 0.68 Å) and a total exposure of 50e-/Å2 fractionated over 40 frames.
Data processing
5562 super resolution movies were summed and motion corrected using Motioncor2 (Zheng et al., 2017) with 2x binning, generating corrected micrographs with a pixel size of 1.36 Å. Contrast transfer function (CTF) parameters were estimated using GCTF (Zhang, 2016). 1,049,128 Particles were picked using the semi-autonomous particle picking algorithm in Relion3.1 (70). All 2D classification, 3D classification, and 3D refinement steps were performed in Relion3.1. Reference-free 2D classification was used to discard non-ribosome containing particles. An initial round of 3D classification using a reference 80S ribosome (EMD-5592) low pass filtered to 60 Å as an initial model was used to isolate particles with clear ribosomal features. Particles in the best classes from this initial round of classification were further examined via a second round of 3D classification against the same initial model. Five classes from this second round of 3D classification showed clear density for 40S and 60S ribosomal subunits, tRNAs, and luminal density below the micelle. Particles from these classes were used for an initial 3D refinement (286,091 particles). CTF refinement was used to estimate beamtilt across the dataset and refine per-particle defocus values. The ribosome density in this initial map was further refined by focused refinement using local angular searches and a mask around the ribosome density (Figure 2—figure supplement 3, yellow mask). Non-translocon density was then removed from the particle set using signal subtraction and a mask surrounding the translocon (Figure 2—figure supplement 3, cyan mask). These signal subtracted particles were subjected to 3D classification without alignment. One of the classes from this classification showed strong density for the TMCO1 translocon (82,684 particles, 28.8%). Particles from this class were refined using a translocon mask and local angular searches, producing a 3.8 Å reconstruction (Map 1, EMD-21426). We also reverted these particles to their original, ribosome-containing state for further analysis without signal subtraction. This produced a 3.4 Å reconstruction of the entire ribosome-translocon complex (Map 2, EMD-21427). Focused refinement with a translocon mask (Figure 2—figure supplement 3, magenta mask) and local angular searches produced a 3.8 Å reconstruction with improved translocon density (Map 3, EMD-21435). Where noted, maps were sharpened by applying a B-factor determined by the automated methods implemented in Relion3.1 (70). Additionally, local resolution estimation and filtering was performed using automated methods implemented in Relion3.1.
Figure 2—figure supplement 3.
Cryo-EM data processing workflow.
Initial rounds of 3D classification yielded five classes containing tRNA density and luminal density extending below the detergent micelle. These were subjected to additional 3D refinement followed by 3D classification with signal subtraction, using a mask encompassing the translocon and part of the ribosomal large subunit (cyan). 3D refinement of the major translocon-containing class was performed with the signal subtracted particles (Map 1), or with unsubtracted particles subjected first to global refinement (Map 2), followed by focused refinement (Map 3) using a mask around the translocon (magenta). The three final maps are shown with their resolutions and EMD deposition codes.
Model building and refinement
We used the 60S ribosomal subunit, A/P and P/E tRNAs and the nascent chain from the human 80S ribosome-nascent chain complex structure (PDB ID 6OM0), and the Sec61 complex from the mammalian 80S ribosome-Sec61-OST structure (PDB ID 6FTI) as starting points for model building. Homology models for TMEM147 and Nicalin were generated in iTasser (Yang et al., 2015), using the γ-secretase subunits, APH-1 and Nicastrin, as templates (PDB ID 5A63). TMCO1 and CCDC47 models were generated with RaptorX-Contact (Wang et al., 2017; Xu, 2019).All three maps were used for model building. The 60S ribosomal subunit (with tRNAs and poly-Ala nascent chain) was initially fitted as a rigid body into the 3.4 Å globally refined map (Map 2) (sharpened and low-pass filtered by local resolution) using UCSF Chimera (Pettersen et al., 2004), and then manually adjusted with rigid-body and real-space refinement using COOT 0.9-pre (Emsley et al., 2010). The Sec61 and TMEM147-Nicalin complexes, TMCO1 and CCDC47 were placed into focused (Map 3) and signal subtracted (Map 1) maps (unsharpened, and low-pass filtered by local resolution) as rigid bodies, and then adjusted using tightly restrained real-space refinement in COOT. No density was assigned to NOMO or the CCDC47 lumenal and transmembrane domains.Real-space refinement of the model (60S and translocon) was done with PHENIX (Afonine et al., 2018), against the focused map (Map 3) (unsharpened, and low-pass filtered by local resolution). Three rounds of global minimization and group B-factor refinement were performed with tight secondary structure, reference model, rotamer, and Ramachandran restraints applied. Secondary structure- and reference model restraints were determined from the starting models. Hydrogen-bonding and base-pair and stacking parallelity restraints were applied to the rRNA. Final model statistics are provided in Table 1. Structure figures were generated with UCSF Chimera and PyMOL (http://www.pymol.org).
RIP-seq analysis
Affinity purified TMCO1-ribosome complexes were isolated as described above (‘Isolation of TMCO1-ribosome complexes for interaction analysis’), with the following changes. ~ 108 cells were processed for each of three biological replicates. All buffers were made using DEPC-treated RNase free water. Solubilized membranes were incubated with M2 Flag affinity gel (Sigma, A2220) for 2 hr at 4°C with end-over-end mixing. To remove contaminating DNA, 1 U RNase-Free DNase (Promega, M6101) was added to the sample during resin binding. Unbound material was removed and the resin was washed four times with five column volumes of wash buffer to remove contaminating ribosomes. TMCO1-ribosome complexes were isolated by centrifugation as before. After centrifugation, the final pellet was resuspended in 250 mM sucrose, 300 mM potassium acetate, 50 mM Hepes pH 7.4, 5 mM magnesium acetate, 50 µg/mL emetine and 0.1% digitonin, flash frozen and stored at −80°C until ready for sequencing.All mRNA sequencing was performed at the University of Chicago Genomics Facility. For each of three biological replicates, RNA was extracted, ribosomal RNA was removed by RiboZero and cDNA libraries were prepared. Fragment sizes were determined by Bioanalyzer, and samples were pooled for sequencing on an Illumina HiSeq 4000. 50 bp single-end sequence reads were aligned to the human GRCh38 reference transcriptome using STAR (v2.6.1) (Dobin et al., 2013) and gene transcript abundance was quantified by featureCounts using the Subread package (v1.6.3) (Liao et al., 2013). Possible batch effects were adjusted using the SVA package (Leek et al., 2012) in R. An IP enrichment score was calculated as follows: IP enrichment = (Flag IP abundance - Control IP abundance)/Total membrane abundance, where ‘Total membrane abundance’ was determined by mRNA sequencing the total membrane fraction in HEK293 TRex cells, as described below. Only genes with mean CPM higher than 0.5 were considered confidently identified and used in the analysis.For mRNA sequencing of total membrane-associated mRNAs, membrane suspensions from three biological replicates of parental HEK293 TRex cells were prepared as above, with the inclusion of 1 U/mL SuperaseIn and 50 µg/mL emetine at all times. Membranes were washed twice with 250 mM sucrose, 150 mM potassium acetate, 50 mM Hepes pH 7.4, 5 mM magnesium acetate, 50 µg/mL emetine, and then RNA was Trizol extracted. For each biological replicate, ribosomal RNA was removed by Oligo-dT affinity purification and cDNA libraries were prepared, sequenced, and analyzed as described above.
Analysis of membrane protein expression levels and glycosylation patterns
For each replicate of the expression analysis, 750,000 cells were plated on poly-L-lysine coated plates and grown overnight. Cells were harvested by centrifugation, lysed using RIPA buffer (1% triton, 0.5% deoxycholate, 0.1% SDS and 1X protease inhibitor cocktail), and EAAT1 protein levels analyzed by SDS-PAGE and western blotting. Immunoblots were quantified using ImageJ (Schneider et al., 2012).For EAAT1, Integrin α5 and TRAPα glycosylation analysis, RIPA cell lysates were reduced with 2% β−mercaptoethanol and denatured by heating for 10 min at 65°C. Samples were then incubated with EndoH (NEB) or PNGaseF (Promega) for 7 hr at 37°C, and analyzed by SDS-PAGE and western blotting.For mRNA quantitation, total RNA was Trizol extracted (Ambion). cDNA (1000 ng) was synthesized using gDNA Clear cDNA Synthesis Kit (Bio-rad). qPCR was performed using iTaq Universal SYBR Green Supermix (Bio-rad) via CFX96 Touch Real-Time PCR Detection System (Bio-rad). Primers used for mRNA quantification were: EAAT1 fwd 5’-TTCCTGGGGAACTTCTGATG-3’, EAAT1 rev 5’-CCATCTTCCCTGATGCCTTA-3’, GAPDH fwd 5’-ACAACTTTGGTATCGTGGAAGG-3’, and GAPDH rev 5’-GCCATCACGCCACAGTTTC-3’.In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:Mechanistic explanations for polytopic transmembrane protein biogenesis remain incomplete. The textbook model of how the Sec61 translocon guides hydrophobic transmembrane segments from the ribosome into the ER membrane cannot yet account for how polytopic membrane proteins are inserted into the ER membrane with their proper topology, tertiary packing, or oligomerization status. In an exciting step towards closing this gap, McGilvray and Anghel et al. report the discovery of a massive, multi-component translocon-associated complex. This complex comprises TMCO1, Sec61α/β/γ, as well as CCDC47 and the Nicalin-TMEM147-NOMO complex. Together, this complex appears to harbor multiple routes into the ER membrane, and loss of the complex comprises the biosynthesis of polytopic membrane proteins.Decision letter after peer review:Thank you for submitting your article "An ER translocon for multi-pass membrane protein biogenesis" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Adam Frost as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Suzanne Pfeffer as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Vladimir Denic (Reviewer #2).The reviewers and senior editor have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.As the editors have judged that your manuscript is definitely of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is 'in revision at eLife'. Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)Summary:Mechanistic explanations of polytopic membrane protein biogenesis remain incomplete. The textbook understanding of how Sec61 guides hydrophobic transmembrane segments from the ribosome into the ER membrane rests on detailed biochemistry and near-atomic resolution structures. The textbook model, however, cannot yet explain how polytopic membrane proteins are inserted into the ER membrane with their proper topology, tertiary transmembrane segment packing, or oligomerization because the Sec61 translocon can only accommodate, at most, two transmembrane helices. In an exciting step towards explaining the biogenesis of polytopic membrane proteins, McGilvray and Anghel et al. report the discovery of a new Sec61-associated complex with roles in polytopic membrane protein biogenesis.Their story starts with biochemical characterization of proteins that copurify with detergent-solubilized TMCO1-a protein that the Keenan group has previously hypothesized to have a role in membrane protein biogenesis due to its homology with YidC/Oxa1 family proteins. Mass spectrometry and western blotting revealed that TMCO1 copurifies with 80S ribosomes, Sec61α/β/γ, as well as CCDC47 and the Nicalin-TMEM147-NOMO complex. Multi-class 3D reconstructions using cryoEM suggests an intricate assembly of these factors organized around the exit tunnel of the ribosome. Analysis of the transmembrane segments from the Sec61 complex, TMCO1, CCDC47, TMEM147, and Nicalin further suggests the complex is organized around a membrane cavity and that this organization may be consistent with multiple routes into the membrane, including re-entry from the lumenal face and additional pores flanking the canonical pore of the Sec61 complex. Finally, Riboseq measurements of the TMCO1-copurifying messages showed that the TMCO1-bound ribosomes are strongly enriched for multi-pass membrane proteins. Cells lacking components of this TMCO1 complex are unable to properly make a reporter client, the trimeric glutamate transporterEAAT1. In summary, the identification of a new translocation machine for multi-pass membrane protein biogenesis warrants publication by eLife. Several aspects of the author's structure/function model, however, are beyond the resolution limits of the current study and will require additional functional tests or less declarative claims.Essential revisions:1) The manuscript does not provide direct evidence that the novel Sec61-associated complex mediates the insertion of polytopic membrane proteins. The reduced levels of EAAT1 in cells lacking these factors are consistent with a role in membrane protein biogenesis, but reduced levels could be due by a defect in ER targeting and nascent protein aggregation/degradation. Among other approaches, the authors could assess proper translocation by monitoring the N-glycosylation of a nascent and topologically-defined substrate.2) The mass spectrometry, western blots, and cryoEM maps may be consistent with the existence of two or more assemblies, rather than a single complex containing all five of the accessory proteins (TMCO1, CCDC47, Nicalin, TMEM147, and NOMO). Specifically, there are no cross-links between the TMEM147-Nicalin-NOMO complex and Sec61/CCDC47/TMCO1. Thus, while the cross-linking demonstrates that TMCO1 and CCDC47 engage the ribosome and Sec61, one simple explanation of the remaining hybrid peptides is that the TMEM147/Nicalin/NOMO complex is distinct from Sec61/CCDC47/TMCO1 complex. Without conclusive functional or biochemical characterization to demonstrate that this is indeed a unitary complex, this claim should be removed. Most importantly, providing biochemical evidence for the presence of TMEM147 in the TMCO1 complex is an essential request.3) A recurrent and motivating theme of the manuscript concerns the claim that TMCO1 possesses a "three-TMD core, which harbors a groove lined with conserved charged and polar residues…the TMCO1 groove opens directly into the lipid-filled cavity at the center of the translocon, revealing a pathway by which a hydrophobic segment could be inserted from the cytosol into a protected membrane environment." This notion is attractive speculation, but at this resolution, the structural evidence is not sufficiently strong to support the model. While Figure 2E suggests a groove, at this resolution we cannot place the charged or polar residues with confidence. The RaptorX-based modeling, as summarized in Figure 2—figure supplement 7, appears compelling, but both the surface properties and roles of this groove remain unresolved. Without testing loss-of-function mutants along the groove, this aspect of the structural model is unsupported. Considering that the architecture of the bacterial holotranslocon is strikingly different in terms of the relationship between the YidC groove and SecYEG, show in Figure 4—figure supplement 1, it is premature to conclude that TMCO1 functions as proposed.4) Related to point 3, the transmembrane region appears to be ~7Å on average in resolution. The cross-links determined by mass spectrometry are helpful constraints, but from Figure 2 and its associated supplements we cannot be sure the TMs have all been placed correctly. Among other uncertainties, for example, the NOMO C-term has extensive cross-links with Sec61γ. Could NOMO be at the center of the assembly, near Sec61γ, rather than CCDC47? Similarly, how reliable is the assignment of the Nicalin TM versus the TMs of TMEM147? At this resolution, side chains and many loops are invisible or, at best, ambiguous.[Editors' note: further revisions were suggested prior to acceptance, as described below.]Thank you for submitting your article "An ER translocon for multi-pass membrane protein biogenesis" for consideration by eLife. Your article has been re-reviewed by the original peer reviewers, and the evaluation has been overseen by Reviewing Editor Adam Frost and Suzanne Pfeffer as the Senior Editor.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in eLife but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data. In this case, the reviewers felt that one issue could be dealt with textually but they required one additional experiment be carried out prior to formal acceptance. We hope you will find these comments constructive.We are pleased to accept your work for publication, pending the resolution of two issues.First, the revised manuscript does not directly demonstrate that the reduced expression of a putative client, EAAT1, in TMCO1 KO cells is due to a membrane insertion defect. It remains possible, if unlikely, that clients like EAAT1 depend on the TMCO1 complex for ER targeting rather than membrane insertion. Your new experiments show that loss of TMCO1 does not lead to a general deficiency in ER targeting for clients that are not expected to depend on the TMCO1-containing complex (single-pass membrane proteins); but falls short of demonstrating client insertion via the TMCO1, CCDC47, Nicalin, TMEM147 and NOMO complex. We ask you to acknowledge this caveat in your Discussion section, perhaps following the sentence, "The biochemical function of the TMCO1 translocon is unclear," and before the sentence that begins, "The simplest possibility…".Second, the absence of SDS-PAGE, protein blot or mass spectrometry data indicating that TMEM147 co-purifies with the holocomplex belies the claim that "…a cluster of eight TMDs visible near the Sec61 hinge were unambiguously assigned to the Nicalin-TMEM147 sub-complex". The placement of the TMEM147-Nicalin helices is such a central aspect of the structural model that given the resolution limits in the membrane, independent biochemical evidence for the presence of TMEM147 within the complex remains an essential request, despite the informative hybrid peptides between TMEM147 and the ribosome. We note that there are literature reports of ER-localized, N-terminal epitope-tagged TMEM147 reagents that may be useful in this regard.Essential revisions:1) The manuscript does not provide direct evidence that the novel Sec61-associated complex mediates the insertion of polytopic membrane proteins. The reduced levels of EAAT1 in cells lacking these factors are consistent with a role in membrane protein biogenesis, but reduced levels could be due by a defect in ER targeting and nascent protein aggregation/degradation. Among other approaches, the authors could assess proper translocation by monitoring the N-glycosylation of a nascent and topologically-defined substrate.To address the possibility that reduced EAAT1 levels in cells lacking TMCO1 components is due to a general defect in ER targeting, insertion or glycosylation, we monitored the biogenesis of two single-pass membrane proteins, integrin α5 and TRAPα, in wild-type and TMCO1 knockout cells. These secretory pathway transmembrane proteins are not expected to be clients of the TMCO1 translocon. As shown in a modified Figure 5—figure supplement 1, we see no change in the steady-state expression levels of either protein. Moreover, analysis of EndoH and PNGase sensitivity is consistent with proper trafficking in the TMCO1 knockout cells. While the precise biochemical function(s) of the TMCO1 translocon remains to be defined, these data indicate that disruption of TMCO1 does not lead to a general defect in membrane protein biogenesis.2) The mass spectrometry, western blots, and cryoEM maps may be consistent with the existence of two or more assemblies, rather than a single complex containing all five of the accessory proteins (TMCO1, CCDC47, Nicalin, TMEM147, and NOMO). Specifically, there are no cross-links between the TMEM147-Nicalin-NOMO complex and Sec61/CCDC47/TMCO1. Thus, while the cross-linking demonstrates that TMCO1 and CCDC47 engage the ribosome and Sec61, one simple explanation of the remaining hybrid peptides is that the TMEM147/Nicalin/NOMO complex is distinct from Sec61/CCDC47/TMCO1 complex. Without conclusive functional or biochemical characterization to demonstrate that this is indeed a unitary complex, this claim should be removed. Most importantly, providing biochemical evidence for the presence of TMEM147 in the TMCO1 complex is an essential request.Our previous attempts to identify ribosomes engaged with translocon sub-complexes (e.g., Sec61-CCDC47-TMCO1 or Sec61-Nicalin-TMEM147-NOMO) in the natively-isolated samples by cryoEM were unsuccessful, despite extensive efforts at further in silico classification. Nevertheless, to more rigorously show that these ribosome-associated accessory components are part of a unitary complex, we repeated the original purifications using cells overexpressing stably integrated 3xFlag-TMCO1 or 3xFlag-Nicalin. As shown in a new Figure 1—figure supplement 1, TMCO1, CCDC47 and NOMO all co-purify in the ribosome-bound fraction following 3xFlag-Nicalin immunoprecipitation. This provides further evidence that these components can be isolated as a single, ribosome-associated complex. We also show in a new Figure 1—figure supplement 1 that in the absence of ribosomes, only components of the known Nicalin-TMEM147-NOMO complex remain associated, indicating that TMCO1, CCDC47 and the pre-formed Nicalin-TMEM147-NOMO assemble in the context of the ribosome.None of the commercial anti-TMEM147 antibodies we tested could detect TMEM147, whether in total lysate, microsomal membrane preparations, or natively isolated TMCO1-ribosome complexes. This is likely because the longest extra-membrane TMEM147 loop is only 5 residues long, making it difficult to detect by western blot. Nevertheless, several lines of evidence support the conclusion that TMEM147 is part of the ribosome-bound TMCO1 translocon: (1) previous studies demonstrate that TMEM147 is a core component of the Nicalin-NOMO complex (Dettmer et al., 2010); (2) we observe a cluster of crosslinked peptides between TMEM147 and uL24 by mass spectrometry (between K94 of TMEM147 and K110, K113 and K116 of uL24); and (3) we visualize all seven predicted TMEM147 TMs in the cryoEM maps (additional view now shown in an expanded Figure 2—figure supplement 5). Even at moderate resolution these helical densities are observed to form an unusual inverted-V shape. TMEM147 and Nicalin are evolutionarily related to the APH1-Nicastrin subcomplex of human γ-secretase, for which high resolution structures are available (e.g., PDB ID 5A63), and in these structures, the seven TMs of APH1 adopt a similarly distinctive, inverted-V shape. Moreover, assigning TMEM147 to this density places the single Nicalin TM into helical density at precisely its evolutionarily predicted location – packed against TM1 of TMEM147. Thus, even in the absence of additional biochemical evidence, our data strongly suggest that TMEM147 is a bona fide component of the TMCO1 translocon. We clarify these points in the main text.3) A recurrent and motivating theme of the manuscript concerns the claim that TMCO1 possesses a "three-TMD core, which harbors a groove lined with conserved charged and polar residues…the TMCO1 groove opens directly into the lipid-filled cavity at the center of the translocon, revealing a pathway by which a hydrophobic segment could be inserted from the cytosol into a protected membrane environment." This notion is attractive speculation, but at this resolution, the structural evidence is not sufficiently strong to support the model. While Figure 2E suggests a groove, at this resolution we cannot place the charged or polar residues with confidence. The RaptorX-based modeling, as summarized in Figure 2—figure supplement 7, appears compelling, but both the surface properties and roles of this groove remain unresolved. Without testing loss-of-function mutants along the groove, this aspect of the structural model is unsupported. Considering that the architecture of the bacterial holotranslocon is strikingly different in terms of the relationship between the YidC groove and SecYEG, show in Figure 4—figure supplement 1, it is premature to conclude that TMCO1 functions as proposed.We have revised the manuscript to temper statements that are not directly supported by the data. This includes removing references to the hydrophilic/charged funnel in TMCO1, and explicitly stating in the Discussion that “[t]he biochemical function of the TMCO1 translocon is unclear.” The key points here are: (i) we have shown that TMCO1 is structurally similar to other members of the Oxa1 superfamily of membrane biogenesis factors; (ii) that it possesses a cytosolic funnel that opens to the membrane; and (iii) that it lines a large, lipid-filled cavity at the heart of the translocon. These points are unambiguous, even in the absence of TMCO1 side chain density, and they lead us to propose that the TMCO1 translocon functions as an insertase and an intramembrane chaperone. Future mechanistic studies will test this model.That YidC and TMCO1 might assemble in different orientations relative to the Sec complex in these two very different assemblies is not a contradiction. On the contrary: members of the superfamily are highly divergent (~10-20% sequence identity) and have evolved to function in very different contexts. Indeed, YidC is thought to function co- and post-translationally, in both Sec-dependent and Sec-independent modes. EMC3 functions as part of a large multi-subunit complex in both co- and post-translational modes yet doesn’t appear to directly contact Sec61 or ribosomes. And Get1 functions as part of a dedicated post-translational insertase in complex with Get2. Despite these different contexts, a core function of these proteins – moving transmembrane segments into the bilayer – appears to be conserved. We now clarify this point in the Discussion.Nevertheless, we also opted to remove the bacterial holotranslocon comparison from the text. This is for two reasons. First, this model is derived from a low (~14 Å overall) resolution cryoEM reconstruction, making it difficult to reliably assign the six different bacterial subunits to the density. Second, the bacterial holotranslocon structure was obtained in the absence of the ribosome, which may alter the relative arrangement of YidC and SecYEG. Although there are no structures of a ribosome-SecYEG-YidC complex, we note that a low resolution cryoEM structure of YidC (by itself) bound to a ribosome-nascent chain complex suggests that YidC contacts L24 (Kedrov et al., 2016), which is consistent with the location of TMCO1 in our structure (bacterial L24 ~ humanuL24). Thus, we decided to remove the apples-to-oranges comparison with the bacterial holotranslocon.4) Related to point 3, the transmembrane region appears to be ~7Å on average in resolution. The cross-links determined by mass spectrometry are helpful constraints, but from Figure 2 and its associated supplements we cannot be sure the TMs have all been placed correctly. Among other uncertainties, for example, the NOMO C-term has extensive cross-links with Sec61γ. Could NOMO be at the center of the assembly, near Sec61γ, rather than CCDC47? Similarly, how reliable is the assignment of the Nicalin TM versus the TMs of TMEM147? At this resolution, side chains and many loops are invisible or, at best, ambiguous.We are able to unambiguously place TMCO1, CCDC47, Nicalin and TMEM147 into the moderate resolution translocon density using deep-learning based structure prediction methods (TMCO1 and CCDC47), homology modeling based on the previously described evolutionary relationship between TMEM147-Nicalin and the APH1-Nicastrin subunits of γsecretase (Dettmer et al., 2010), and the distinctive features of the resulting models. These assignments are fully consistent with the XL-MS, which was not used to provide additional constraints during the modeling, but to validate the final model.The main ambiguity in our model lies with the single-pass NOMO subunit. Weak density is visible adjacent to TM2 and TM6 of TMEM147, where the unstructured ~46 residue cytosolic C-terminus of NOMO would be well-positioned to satisfy the experimentally observed crosslinks with the ribosomal subunits eL19, eL24, eL38, uL29, uL23 and the N-terminal region of Sec61γ. In the absence of additional density, however, we chose not to assign NOMO.Regardless of the exact location of NOMO, the cytosolic domain of CCDC47 is unambiguously assigned, as evidenced by the fit of its distinctive coiled-coil and globular domains (the cytosolic region of NOMO is too small), and a series of regio-specific crosslinks to ribosomal subunits, TMCO1 and Sec61. Similarly, placement of the seven TMs of TMEM147 and the single Nicalin TM into density is unambiguous (see Response #2), satisfying the evolutionary constraints provided by homology to γ-secretase, and positioning the large lumenal domain of Nicalin into the low-resolution lobe of density on the lumenal side of the translocon. This assignment is also consistent with the experimentally observed cross-links between TMEM147 and uL24.We clarify these points throughout the manuscript, including an expanded Figure 2—figure supplement 5, that provides more detail for the map-to-model fits.[Editors' note: further revisions were suggested prior to acceptance, as described below.]We are pleased to accept your work for publication, pending the resolution of two issues.First, the revised manuscript does not directly demonstrate that the reduced expression of a putative client, EAAT1, in TMCO1 KO cells is due to a membrane insertion defect. It remains possible, if unlikely, that clients like EAAT1 depend on the TMCO1 complex for ER targeting rather than membrane insertion. Your new experiments show that loss of TMCO1 does not lead to a general deficiency in ER targeting for clients that are not expected to depend on the TMCO1-containing complex (single-pass membrane proteins); but falls short of demonstrating client insertion via the TMCO1, CCDC47, Nicalin, TMEM147 and NOMO complex. We ask you to acknowledge this caveat in your Discussion section, perhaps following the sentence, "The biochemical function of the TMCO1 translocon is unclear," and before the sentence that begins, "The simplest possibility…".We have modified the text accordingly.Second, the absence of SDS-PAGE, protein blot or mass spectrometry data indicating that TMEM147 co-purifies with the holocomplex belies the claim that "…a cluster of eight TMDs visible near the Sec61 hinge were unambiguously assigned to the Nicalin-TMEM147 sub-complex". The placement of the TMEM147-Nicalin helices is such a central aspect of the structural model that given the resolution limits in the membrane, independent biochemical evidence for the presence of TMEM147 within the complex remains an essential request, despite the informative hybrid peptides between TMEM147 and the ribosome. We note that there are literature reports of ER-localized, N-terminal epitope-tagged TMEM147 reagents that may be useful in this regard.Our initial attempts to immunoprecipitate the ribosome-associated assembly via an N-terminally 3xFlag-tagged TMEM147 were unsuccessful – possibly because the N-terminal tag is inaccessible to the antibody in the context of the TMCO1 translocon, or because the tag prevents assembly of the intact ribosome-translocon complex. However, after screening additional commercially available antibodies, we succeeded in finding one that specifically recognizes endogenous TMEM147 (confirmed by blotting against recombinant 3xFlag-tagged TMEM147). As shown now in a modified Figure 1C, TMEM147 co-purifies with the TMCO1 translocon.
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Antibody
Anti-FLAG M2 Affinity Gel (mouse monoclonal)
Sigma
Cat# A2220, RRID:AB_10063035
Antibody
Rabbit polyclonal, FLAG
Sigma
Cat# F7425, RRID:AB_439687
WB (1:1000)
Antibody
Rabbit, polyclonal TMCO1
Anghel et al., 2017
WB (1:1000)
Antibody
Rabbit, polyclonal Sec61β
Görlich et al., 1992
WB (1:10000)
Antibody
Mouse, monoclonal EAAT1
Santa Cruz
Cat# sc-515839
WB (1:1000)
Antibody
Rabbit, polyclonal Sec61α
Thermo Fisher
Cat# PA5-21773, RRID:AB_11152794
WB (1:1000)
Antibody
Rabbit, polyclonal L17
Abgent
Cat# AP9892b, RRID:AB_10613776
WB (1:1000)
Antibody
Mouse monoclonal STT3A
Novus
Cat# H00003703-M02, RRID:AB_2198043
WB (1:1000)
Antibody
Mouse monoclonal Tubulin
Abcam
Cat# ab7291, RRID:AB_2241126
WB (1:1000)
Antibody
Rabbit polyclonal Integrin α5
Cell Signaling
Cat# 4705, RRID:AB_2233962
WB (1:1000)
Antibody
Rabbit polyclonal Nicalin
Bethyl
Cat# A305-623A-M, RRID:AB_2782781
WB (1:1000)
Antibody
Rabbit polyclonal TMEM147
Thermo Fisher
Cat# PA5-95876, RRID:AB_2807678
WB (1:1000)
Antibody
Goat polyclonal Nomo1
Thermo Fisher
Cat# PA5-47534, RRID:AB_2607776
WB (1:1000)
Antibody
Rabbit polyclonal CCDC47
Bethyl
Cat# A305-100A, RRID:AB_2631495
WB (1:1000)
Cell line (H. sapiens)
Flp-In T-REx 293
Thermo Fisher
Cat# R78007
Cell line (H. sapiens)
Flp-In T-REx 293, 3xFlag-Cas9
Anghel et al., 2017
3xFlag-Cas9 integrated into FRT site
Cell line (H. sapiens)
Flp-In T-REx 293, 3xFlag-Cas9, 3xFlag-TMCO1
Anghel et al., 2017
Obtained by CRISPR-Cas9; one nonfunctional and one N-terminally tagged TMCO1 allele
Cell line (H. sapiens)
Flp-In T-REx 293, 3xFlag-Cas9, ΔTMCO1
Anghel et al., 2017
TMCO1 disrupted by CRISPR-Cas9
Cell line (H. sapiens)
Flp-In T-REx 293, 3xFlag-Cas9, ΔNicalin
This paper
Nicalin disrupted by CRISPR-Cas9
Cell line (H. sapiens)
Flp-In T-REx 293, 3xFlag-Cas9, ΔCCDC47
This paper
CCDC47 disrupted by CRISPR-Cas9
Cell line (H. sapiens)
Flp-In T-REx 293, 3xFlag-Cas9, ΔTMCO1, ΔNicalin
This paper
Nicalin disrupted by CRISPR-Cas9 in ΔTMCO1 background
Cell line (H. sapiens)
Flp-In T-REx 293, 3xFlag-Cas9, ΔTMCO1, ΔCCDC47
This paper
CCDC47 disrupted using CRISPR-Cas9 in ΔTMCO1 background
Authors: Marie Morimoto; Helen Waller-Evans; Zineb Ammous; Xiaofei Song; Kevin A Strauss; Davut Pehlivan; Claudia Gonzaga-Jauregui; Erik G Puffenberger; Charles R Holst; Ender Karaca; Karlla W Brigatti; Emily Maguire; Zeynep H Coban-Akdemir; Akiko Amagata; C Christopher Lau; Xenia Chepa-Lotrea; Ellen Macnamara; Tulay Tos; Sedat Isikay; Michele Nehrebecky; John D Overton; Matthew Klein; Thomas C Markello; Jennifer E Posey; David R Adams; Emyr Lloyd-Evans; James R Lupski; William A Gahl; May Christine V Malicdan Journal: Am J Hum Genet Date: 2018-10-25 Impact factor: 11.025
Authors: Katharina Braunger; Stefan Pfeffer; Shiteshu Shrimal; Reid Gilmore; Otto Berninghausen; Elisabet C Mandon; Thomas Becker; Friedrich Förster; Roland Beckmann Journal: Science Date: 2018-03-08 Impact factor: 47.728
Authors: A O Caglayan; H Per; G Akgumus; H Gumus; J Baranoski; M Canpolat; M Calik; A Yikilmaz; K Bilguvar; S Kumandas; M Gunel Journal: Clin Genet Date: 2013-02-20 Impact factor: 4.438
Authors: Alexander Leitner; Roland Reischl; Thomas Walzthoeni; Franz Herzog; Stefan Bohn; Friedrich Förster; Ruedi Aebersold Journal: Mol Cell Proteomics Date: 2012-01-27 Impact factor: 5.911
Authors: Lakshmi E Miller-Vedam; Bastian Bräuning; Katerina D Popova; Nicole T Schirle Oakdale; Jessica L Bonnar; Jesuraj R Prabu; Elizabeth A Boydston; Natalia Sevillano; Matthew J Shurtleff; Robert M Stroud; Charles S Craik; Brenda A Schulman; Adam Frost; Jonathan S Weissman Journal: Elife Date: 2020-11-25 Impact factor: 8.140
Authors: Jarred W Rensvold; Evgenia Shishkova; Yuriy Sverchkov; Ian J Miller; Arda Cetinkaya; Angela Pyle; Mateusz Manicki; Dain R Brademan; Yasemin Alanay; Julian Raiman; Adam Jochem; Paul D Hutchins; Sean R Peters; Vanessa Linke; Katherine A Overmyer; Austin Z Salome; Alexander S Hebert; Catherine E Vincent; Nicholas W Kwiecien; Matthew J P Rush; Michael S Westphall; Mark Craven; Nurten A Akarsu; Robert W Taylor; Joshua J Coon; David J Pagliarini Journal: Nature Date: 2022-05-25 Impact factor: 69.504
Authors: Pau Castel; Srisathiyanarayanan Dharmaiah; Matthew J Sale; Simon Messing; Gabrielle Rizzuto; Antonio Cuevas-Navarro; Alice Cheng; Michael J Trnka; Anatoly Urisman; Dominic Esposito; Dhirendra K Simanshu; Frank McCormick Journal: Proc Natl Acad Sci U S A Date: 2021-08-17 Impact factor: 11.205
Authors: Mark Sicking; Sven Lang; Florian Bochen; Andreas Roos; Joost P H Drenth; Muhammad Zakaria; Richard Zimmermann; Maximilian Linxweiler Journal: Cells Date: 2021-04-27 Impact factor: 6.600
Authors: Nathan H Cho; Keith C Cheveralls; Andreas-David Brunner; Kibeom Kim; André C Michaelis; Preethi Raghavan; Hirofumi Kobayashi; Laura Savy; Jason Y Li; Hera Canaj; James Y S Kim; Edna M Stewart; Christian Gnann; Frank McCarthy; Joana P Cabrera; Rachel M Brunetti; Bryant B Chhun; Greg Dingle; Marco Y Hein; Bo Huang; Shalin B Mehta; Jonathan S Weissman; Rafael Gómez-Sjöberg; Daniel N Itzhak; Loïc A Royer; Matthias Mann; Manuel D Leonetti Journal: Science Date: 2022-03-11 Impact factor: 63.714