Fatty acid synthase contributes to epithelial-mesenchymal transition and invasion of salivary adenoid cystic carcinoma through PRRX1/Wnt/β-catenin pathway.

Fatty acid synthase (FASN) has been shown to be selectively up-regulated in cancer cells to drive the development of cancer. However, the role and associated mechanism of FASN in regulating the malignant progression of salivary adenoid cystic carcinoma (SACC) still remains unclear. In this study, we demonstrated that FASN inhibition attenuated invasion, metastasis and EMT of SACC cells as well as the expression ofPRRX1, ZEB1, Twist, Slug and Snail, among which the level of PRRX1 changed the most obviously. Overexpression of PRRX1 restored migration and invasion in FASN knockdown cells, indicating that PRRX1 is an important downstream target of FASN signalling. Levels of cyclin D1 and c-Myc, targets of Wnt/β-catenin pathway, were significantly decreased by FASN silencing and restored by PRRX1 overexpression. In addition, FASN expression was positively associated with metastasis and poor prognosis of SACC patients as well as with the expression of PRRX1, cyclin D1 and c-Myc in SACC tissues. Our findings revealed that FASN in SACC progression may induce EMT in a PRRX1/Wnt/β-catenin dependent manner.

INTRODUCTION

Salivary adenoid cystic carcinoma (SACC) is one of the most common salivary gland malignant tumours and accounts for 21%‐24% of adenocarcinoma. , The clinical and biological characteristics of SACC are unique, for instance, high aggressiveness, propensity for perineural invasion, and distant spread to the lung and bone. , , Surgery has been the main available treatment, because SACC has low sensitivity to the radiation and chemotherapy. However, the effect of complete surgical excision is not satisfactory, which results in the poor prognosis. , Hence, it is essential to identify the mechanism about the malignant progression to seek effective and specific target treatment of SACC.

Reprogramming of fatty acid metabolism has been shown to fuel the proliferation and invasion of cancer cells to lead to the malignant progression of cancer by providing phospholipid and cholesterol for the synthesis of cancer cell membrane as well as energy source via β oxidation. , , Fatty acid synthase (FASN), one of key enzymes in reprogramming of fatty acid metabolism, effectively prolonged fatty acid to produce palmitic acid of 16‐carbon. , Recently, FASN has been shown to be overexpressed in breast cancer, lung cancer and colon cancer and associated with poor prognosis of patients. , , Furthermore, FASN can accelerate the development of tumour by promoting the proliferation, invasion, migration and metastasis of cancer. LV‐FASN‐siRNA inhibited the proliferation of non‐small cell lung cancer (NSCLC) cells. Osthole, as FASN inhibitor, could block the migration and invasion of human breast cancer cells mediated by hepatocyte growth factor (HGF). Meanwhile, FASN can also be viewed as an inducer of epithelial‐mesenchymal transition (EMT). In the EMT‐induced cancer stem cells, FASN knockdown attenuated the expression of Vimentin and N‐cadherin. FASN depletion imposed mesenchymal‐like breast cancer tissues to undergo the MET in xenograft nude mice model. However, the role of FASN in the development of SACC still remains unclear.

Here, we first used inhibitor or shRNA to suppress the expression of FASN to detect its role in the proliferation, apoptosis, migration, invasion and EMT of SACC cells. Then, we identified the role of PRRX1/Wnt/β‐catenin pathway in the FASN‐induced EMT. Further, we verified whether FASN silencing inhibited the growth and metastasis of SACC in vivo. In addition, the expression of FASN in SACC samples and its association with the prognosis of patients were analysed by immunohistochemistry(IHC). Our findings revealed that FASN might activate Wnt/β‐catenin pathway by PRRX1 to facilitate SACC EMT and invasion, which provided a possible new approach for SACC therapy.

MATERIALS AND METHODS

Lentivirus transfection

The FASN‐shRNA, FASN overexpression, PRRX1‐overexpression and their negative control lentiviral vectors were synthesized by Guangzhou Cyagen Biosciences Inc SACC‐LM or SACC‐83 cells were infected by recombinant lentiviruses with 5μg/ml of polybrene (Sigma‐Aldrich) with 24 hours. And the stable clones were selected by conditioned medium with 5 μg/mL of puromycin (Sigma‐Aldrich).

Real‐time (RT)‐PCR

Total RNA from SACC cells was isolated by using the TRIzol (Invitrogen). Then, cDNA was synthesized with Transcriptor First Strand cDNA Synthesis Kit (QIAGEN), and SYBR Green Mix (QIAGEN) was subjected to RT‐PCR, according to the manufacturer instructions. PCR products were verified by melting curve analysis. For relative expression calculation, the 2−ΔΔCt method was used with normalizing to β‐actin. The primers for PCR: FASN (F: 5′‐CCATCTACAACATCGACACCA‐3′, R: 5′‐CTTCCACACTATGCTCAGGTAG‐3′); E‐cadherin (F: 5′‐CCCAGAGACTGGTGCCATTT‐3′, R: 5′‐TCTGTGGCGATGATGAGAGC‐3′; N‐cadherin (F: 5′‐CGGTGCCATCATTGCCATCCT‐3′, R: 5′‐GTCATAGTCCTGGTCTTCTTCTCC‐3′); Vimentin (F: 5′‐AAAGCGTGGCTGCCAAGA AC‐3′, R: 5′‐GTGACTGCACCTGTCTCCGGTA‐3′); PRRX1 (F: 5′‐TATCTCTCCTGGGGGACAGC‐3′, R: 5′‐CGTTATGAAGCC CCTCGTGT‐3′); ZEB1 (F: 5′‐ACTCTGATTCTACACCGC‐3′, R: 5′‐TGTCACATTGATAGGGCTT‐3′); Twist (F: 5′‐GTCCGCAGTCTTACGAGGAG‐3′, R: 5′‐TGGAGGACCTGGTAGAGGAA‐3′); Snai1 (F: 5′‐CTCAAGATGCACATCCGAAGC‐3′, R: 5′‐GCCTGGCACTGGTACTTCTTG‐3′); Slug (F: 5′‐TGCGATGCCCAGTCTAGAAA‐3′, R: 5′‐AAAAGGCTTCTCCCCCGTGT‐3′); β‐actin (F: 5′‐TG AGAC CTTCAACACCCCAGCCATG‐3′, R: 5′‐CGTAGATGGGCACAGT GTGGGTG‐3′).

Western blot

The total protein from SACC cells was extracted by RIPA (Beyotime Biotechnology), and equal amounts of protein from each sample were separated by 8% SDS‐PAGE before transferred to PVDF membranes (Millipore). After blocked with 4% bovine serum albumin (BSA), the membranes were incubated for 2 hours with antibodies. The procedure was carried out following manufacturer's instructions.

CCK‐8 assay

A total of 2 × 103 cells per well were seeded in 96‐well plates cells and were cultured in 10% FBS medium for 12, 24, 48 and 72 hours. The absorbance values at 490 nm for each well were measured to assess the cell proliferation, according to the manufacturer's protocol of Cell Counting Kit (CCK)‐8 assay (DOJINDO, Japan).

Flow cytometric analysis

SACC‐LM or SACC‐83 were seeded in 6‐well plate with 2 × 105 cells per well. The apoptosis was assessed with Annexin V‐PE apoptosis detection kit following its protocol (KeyGEN BioTECH). The cells were harvested and stained by Annexin V‐PE or/and PI for 15 min at room temperature and were analysed with FACSCalibur flow cytometer.

Wound healing assay

The SACC cells were plated in 6‐well plate and grown to 80%‐90% confluence, and scratch wounds were made by using a 200 μL pipette tip. Images were captured after 0 and 24 hours with a microscope, and experiments were carried out in triplicate.

Transwell invasion assay

1.0 × 105 cells in 200 µL of DMEM without FBS were filled in upper chamber with Matrigel‐coated membrane. After 24 hours, the invasion cells were fixed with 90% methanol and stained by 0.1% Crystal Violet. Images were captured five fields per filter.

Xenograft tumour model assay

Female 4‐week‐old BALB/c nude mice were purchased from the Experimental Animal Center of Sichuan University, China. A total of 5 × 106 FASN‐shRNA2 or its control cells were injected subcutaneously mice, respectively (four mice per group). Bodyweight and tumour volumes of each mouse were recorded per 5 days for 25 days. Tumour sizes were calculated by the formula V = 1/2 (a ∗ b2) mm3 (a is the longest diameter and b is the shortest diameter of the xenograft tumour). After 25 days, the mice were killed and tumours were dissected, fixed and sectioned to IHC staining. For the lung metastasis model, eight female 4‐week‐old BALB/c nude mice (Experimental Animal Center of Sichuan University, China) were randomized into two groups, and a total of 1 × 106 FASN‐shRNA2 or its control cells via the tail vein. After 4 weeks, the mice were killed and their lungs were harvested, fixed with formalin, sectioned and subjected to HE staining. And for study conducted on mice, the protocols were approved by the Animal Care and Use Committee of the West China Medical Center, Sichuan University, China (No. WCCSIRB‐D‐2015‐125).

Patients and sample collection

Tissue samples were obtained from 91 SACC patients, none of whom received pre‐operative chemotherapy, hormone therapy or radiotherapy, and 25 salivary glands at Department of Oral and Maxillofacial Surgery, West China Hospital of Stomatology, Sichuan University. The principal clinicopathologic features of SACC patients were summarized in Table 1. The protocols of study on human specimens were approved by the Institutional Ethics Committee of the West China Medical Center, Sichuan University, China (No.WCHSIRB‐D‐2014‐131). Before study, each participating patient signed consent forms.

Table 1

Clinicopathological parameters of SACC patients and their correlation with FASN expression

Clinicopathological features	Number	FASN expression		p value
		low expression n (%)	high expression n (%)
Age
<50	37	15 (40.54)	22 (59.46)	1.000
≥50	54	21 (38.89)	33 (61.11)
Gender
Male	45	16 (35.56)	29 (64.44)	.522
Female	46	20 (43.48)	26 (56.52)
Location
Major salivary gland	43	23 (53.48)	20 (46.51)	.018
Minor salivary gland	48	13 (27.08)	35 (72.92)
Histological subtype
Tubular/cribriform	66	31 (46.97)	35 (53.03)	.030
Solid	25	5 (20.00)	20 (80.00)
Clinical stage				.036
I + II	28	16 (57.14)	12 (42.86)
III + IV	63	20 (31.75)	43 (68.25)
Perineural invasion
Yes	39	9 (20.08)	30 (76.92)	.009
No	52	27 (51.92)	25 (48.08)
Distant metastasis
Yes	44	10 (22.73)	34 (77.27)	.002
No	47	26 (55.32)	21 (44.68)
Recurrence
Yes	42	11 (26.19)	31 (73.81)	.019
No	49	25 (51.02)	24 (48.98)

Immunohistochemistry

The samples were fixed, embedded, cut into 4 μm sections and stained using a conventional immunohistochemistry procedure. Sections were incubated with FASN antibody (dilution 1:50; Proteintech), PRRX1 antibody (dilution 1:80; Novus Biologicals), cyclin D1 antibody (dilution 1:150; Proteintech) and c‐Myc antibody (dilution 1:150; Proteintech) for 2 hours, before incubated with secondary antibodies at room temperature for 30 minutes. The semiquantification of IHC results was observed and analysed by two independent pathologists. The percentage of positive cells was counted in five areas at 200× magnification per slide and was categorized into following groups: 0, <5% (−); 1, 5%‐25% (+); 2, 25%‐50% (++); 3, >50% (+++). The 0 and 1 were low expression groups, and 2 and 3 belonged to high expression groups.

Statistical analysis

Quantitative data were expressed as mean ± SD and analysed by SPSS 17.0 software, using either ANOVA or t tests. A value of P < .05 was considered significantly different.

RESULTS

FASN silencing reduced the proliferation of SACC cells

To investigate the effect of FASN on the proliferation and apoptosis of SACC cells, we knocked down FASN with two different shRNAs via lentiviral vector (Figure 1A), and the mRNA and protein levels of FASN in FASN‐shRNA2 SACC‐83 and SACC‐LM cells were significantly decreased measured by RT‐PCR and Western blot (Figure 1B). Thus, FASN‐shRNA2 SACC‐83 and SACC‐LM cells were chosen for further study. CCK‐8 assay showed that at various time points, FASN knockdown inhibited the proliferation of SACC cells (Figure 1C), but flow cytometry demonstrated that the depletion of FASN did not affect the apoptosis of SACC cells (Figure 1D). Similarly, we applied overexpressed lentiviral vector to transfect these SACC cells and found that overexpression of FASN increased the proliferation of SACC‐83 and SACC‐LM cells (Figure S1a,b).

Figure 1

FASN silencing reduced the proliferation and had no effect on the apoptosis of SACC cells. A, Representative images of GFP expression in SACC cells after transfecting with lentivirus vectors (Scale bar = 20 μm). B, SACC‐LM and SACC‐83 cells were transfected with FASN‐shRNA1, FASN‐shRNA2 or Control shRNA via lentivirus vectors. RT‐PCR and Western blot examined the effect of FASN silencing by shRNA. The data showed that FASN‐shRNA2 significantly inhibited the expression of FASN. Each experiment was repeated 3 times. Error bars represent the mean ± SD of triplicate experiments. *P < .05. C, CCK8 assay was used to examine the cell growth rates in Control shRNA, FASN‐shRNA2, FASN‐shRNA2 + FASN‐overexpression group of SACC‐LM and SACC‐83. The data showed that the cell growth rate was significantly suppressed in FASN‐shRNA2 cells, and FASN overexpression rescued the growth of cells. Error bars represent the mean ± SD of triplicate experiments. *P < .05. D, Flow cytometry was used to examine the cell apoptosis in Control shRNA, FASN‐shRNA2, FASN‐shRNA2 + FASN‐overexpression group of SACC‐LM and SACC‐83, respectively. Data showed the FASN had no effect on the apoptosis of cells. Each experiment was repeated 3 times

Then, we restored the FASN expression in FASN‐shRNA2 SACC cells via FASN‐overexpression lentiviral vector and found that the up‐regulation of FASN restored the growth but had no effect on the apoptosis of SACC cells (Figure 1C,D). It showed that FASN silencing led to reduced cell proliferation but unchanged apoptosis of SACC cells.

Knockdown of FASN inhibited the migration and invasion of SACC cells through EMT

Using wound healing and Transwell invasion assays, compared to the control, we observed a significant decrease in the migration and invasion of FASN‐shRNA2 SACC cells (Figure 2A,B) and an obvious increase in the migration and invasion of FASN‐overexpression SACC cells (Figure S1c,d). Furthermore, RT‐PCR showed that a marked decrease in the levels of N‐cadherin and Vimentin and a significant increase in E‐cadherin level caused by FASN inhibition (Figure 2C), accompanied by a reversion of epithelial phenotype. The similar data were obtained in SACC cells treatment with the inhibitor of FASN (Cerulenin) (Figure 2A–C). These confirmed that FASN silencing inhibited the migration and invasion as well as EMT of SACC cells.

Figure 2

Knockdown of FASN inhibited the migration, invasion and EMT of SACC cells. A, Invasion assay examined the cell invasion ability in Control shRNA, FASN‐shRNA2, Cerulenin, FASN‐shRNA2 + FASN‐overexpression group of SACC‐LM and SACC‐83, respectively. The invasion ability of FASN silencing group was significantly inhibited. The FASN overexpression could rescue the invasion ability of SACC cells. The mean was derived from cell counts of 3 fields, and each experiment was repeated 3 times. Error bars represent the mean ± SD of triplicate experiments. *P < .05. B, Migration assay examined the cell migration ability in Control shRNA, FASN‐shRNA2, Cerulenin, FASN‐shRNA2 + FASN‐overexpression group of SACC‐LM and SACC‐83, respectively. The migration ability of FASN silencing group was significantly inhibited. The FASN overexpression could rescue the migration ability SACC cells. The mean was derived from area of wound of 3 fields, and each experiment was repeated 3 times. Error bars represent the mean ± SD of triplicate experiments. *P < .05. C, RT‐PCR was used to detect the mRNA expression of E‐cadherin, N‐cadherin and Vimentin in Control shRNA, FASN‐shRNA2, Cerulenin, FASN‐shRNA2 + FASN‐overexpression group of SACC‐LM and SACC‐83, respectively. The data showed that the mRNA expression of N‐cadherin and Vimentin was inhibited in FASN‐shRNA2 cells, and FASN up‐regulated its expression, while E‐cadherin showed opposite change. Each experiment was repeated 3 times. Error bars represent the mean ± SD of triplicate experiments. *P < .05

Then, we overexpressed FASN in FASN‐shRNA2 SACC cells and observed that the up‐regulation of FASN restored the migration and invasion abilities of SACC cells(Figure 2A,B), enhanced the expression of N‐cadherin and Vimentin and decreased the expression of E‐cadherin (Figure 2C). Taken together, these findings demonstrated that FASN might regulate the migration and invasion of SACC by orchestrating EMT phenotypes.

PRRX1 was required for FASN‐associated EMT and invasion of SACC cells

We measured the levels of EMT‐associated transcriptional factors (TFs) ZEB1, Twist, PRRX1, Slug and Snail in SACC cells. As shown in Figure 3A, the increased levels of ZEB1, Twist, PRRX1, Slug and Snail in the FASN overexpressed cells and decreased levels in the FASN‐shRNA2 cells were observed. Next, in the FASN‐shRNA2 cells, we used the overexpression vector of PRRX1 whose level showed the most obvious change among these five EMT‐TFs (Figure 3A) and found that the expression of E‐cadherin was down‐regulated, while Vimentin was enhanced (Figure 3B). Additionally, and the migration and invasion abilities of PRRX1 overexpression cells were increased compared with FASN‐shRNA2 cells (Figure 3C,D) with a fibroblastic morphology. These results indicated that PRRX1‐induced EMT enhanced the migratory and invasive capacities of SACC cells.

Figure 3

FASN triggered EMT through PRRX1 in SACC cells A, RT‐PCR and Western blot were used to detect the mRNA expression of PRRX1, ZEB1, Twist, Slug and Snail in vector, FASN‐overexpression, Control shRNA, FASN‐shRNA2 group of SACC‐LM and SACC‐83, respectively. The data showed that the mRNA and protein expressions of PRRX1, ZEB1, Twist, Slug and Snail were inhibited in FASN‐shRNA2 cells, and FASN overexpression up‐regulated their expression. Among these factors, PRRX1 showed the most remarkable change. Each experiment was repeated 3 times. Error bars represent the mean ± SD of triplicate experiments. *P < .05. B, RT‐PCR was used to detect the mRNA expression of E‐cad and Vimentin in Control shRNA, FASN‐shRNA2, FASN‐shRNA2 + PRRX1 group of SACC‐LM and SACC‐83, respectively. The data showed that the expression of E‐cadherin was down‐regulated, while Vimentin was enhanced in FASN‐shRNA2 SACC cells, compared with the control. Overexpression of PRRX1 could rescue the expression of E‐cad and Vimentin in FASN‐shRNA2 SACC cells. The mean was derived from cell counts of 3 fields, and each experiment was repeated 3 times. Error bars represent the mean ± SD of triplicate experiments. *P < .05. C, Invasion assay examined the cell invasion ability in Control shRNA, FASN‐shRNA2, FASN‐shRNA2 + PRRX1 group of SACC‐LM and SACC‐83, respectively. The PRRX1 overexpression could rescue the invasion ability SACC cells. The mean was derived from cell counts of 3 fields, and each experiment was repeated 3 times. Error bars represent the mean ± SD of triplicate experiments. *P < .05. D, Migration assay examined the cell migration ability in Control shRNA, FASN‐shRNA2, FASN‐shRNA2 + PRRX1 group of SACC‐LM and SACC‐83, respectively. The PRRX1 overexpression could rescue the migration ability SACC cells. The mean was derived from cell counts of 3 fields, and each experiment was repeated 3 times. Error bars represent the mean ± SD of triplicate experiments. *P < .05

PRRX1 increased the expression of Wnt/β‐catenin

Wnt/β‐catenin pathway has previously been demonstrated to mediate the function of PRRX1. Therefore, we evaluated the mRNA and protein expressions of cyclin D1 and c‐Myc in SACC cells, both of which were downstream targets of Wnt/β‐catenin pathway. We found that the two target factors were significantly decreased in the protein and mRNA levels in FASN‐shRNA2 SACC‐83 and SACC‐LM cells, which was restored by overexpressing PRRX1 (Figure 4A,B). These results suggested that FASN enhanced PRRX1 expression to promote the EMT and the migration and invasion of SACC cells, in which Wnt/β‐catenin pathway involved.

Figure 4

PRRX1 increased the expression of Wnt/β‐catenin. A, RT‐PCR was used to detect the mRNA expression of cyclin D1 and c‐Myc in Control shRNA, FASN‐shRNA2, FASN‐shRNA2 + PRRX1 group of SACC‐LM and SACC‐83, respectively. The data showed that the mRNA expression of cyclin D1 and c‐Myc was inhibited in FASN‐shRNA2 cells, and PRRX1 overexpression reversed this change. Each experiment was repeated 3 times. Error bars represent the mean ± SD of triplicate experiments. *P < .05. B, Western blot was used to detect the protein expression of cyclin D1 and c‐Myc in Control shRNA, FASN‐shRNA2, FASN‐shRNA2 + PRRX1 group. The data showed that the protein expression of cyclin D1 and c‐Myc was inhibited in FASN‐shRNA2 cells, and PRRX1 overexpression reversed this change. Each experiment was repeated 3 times

FASN suppression reduced SACC growth and lung metastasis in xenograft model

To further assess the role of FASN in growth and metastasis of SACC, FASN‐ shRNA2 cells or their control were injected subcutaneously and intravenously via the tail vein into nu/nu mice, respectively. After 25 days, the mice in the control group present cachexia status with 18.67 g ± 0.893 g of average bodyweight while the mice of FASN‐shRNA2 group slightly lost weight with 21.39 g ± 1.075 g. And the growth of the tumour in FASN‐shRNA2 group significantly slowed down compared with the control (P < .05, Figure 5A). This indicated that FASN down‐regulation could inhibit the growth of SACC. Moreover, FASN expression was decreased in the tumour tissue of FASN‐shRNA2 group, accompanied by the down‐regulation of PRRX1, cyclin D1 and c‐Myc (Figure 5B).

Figure 5

FASN promoted tumour growth and metastasis in xenograft model. A, The bodyweight and volume of the xenograft tumours of nude mice with FASN‐shRNA2 and the control SACC cells, respectively. After 25 days, the bodyweight of mice in the control group was obviously lower than the mice of FASN‐shRNA2 group. And the growth of the tumour in FASN‐shRNA2 group significantly slowed down compared with the control. *P < .05. B, The expressions of FASN, PRRX1, cyclin D1 and c‐Myc were stained by IHC in xenograft tumours. FASN positive staining was mainly located in cytoplasm, and PRRX1, cyclin D1 and c‐Myc positive staining was mainly located in nucleus. The expression of PRRX1, cyclin D1 and c‐Myc was significantly down‐regulated in FASN‐shRNA2 group. Representative images of IHC staining were showed. Scale bar = 20 μm. C, The HE staining and PCK IHC showed that there were less metastatic nodules in FASN knockdown group compared to the control group. Representative images of HE staining and PCK IHC were showed

In addition, compared with the control SACC cells intravenously via the tail vein, HE staining confirmed that there were less tumour metastatic lumps in the lung tissue of the FASN‐shRNA2 SACC cells, which was confirmed by IHC (Figure 5C). The statistical results showed that only 50% of the mice implanted with FASN‐shRNA2 SACC cells produced spontaneous lung metastases while it was 100% in control group. This indicated that silencing FASN in SACC cells was prone to reduce the rate of the metastasis in SACC.

Overexpression of FASN associated with the poor prognosis of SACC patients

We examined the expression of FASN in SACC patients who received surgery in the West China Hospital of Stomatology, Sichuan University in China, from 2000 to 2006 by immunohistochemical staining. FASN positive staining was mainly located in cytoplasm. The rate of FASN high expression in SACC patients was 60.44% (55/91), while the expression of FASN was negative in salivary gland tissue (Figure 6A). In SACC, the different FASN expression levels were closely correlated with tumour location, pathological classification, clinic stage, local invasion, distant metastasis and recurrence, while the age and gender of patients were not significant (Table 1, *P < .05). Additionally, there was a significant correlation of FASN expression with both disease‐free survival (DFS) and overall survival (OS) (Figure 6B). This indicated that FASN may imply the poor prognosis in SACC patients. Simultaneously, we also examined the expressions of PRRX1, cyclin D1 and c‐Myc in the SACC tissue. PRRX1, cyclin D1 and c‐Myc positive staining was mainly located in nucleus. The correlation analysis shows that FASN expression was positively related with PRRX1(r = 0.7285, P < .0001), cyclin D1(r = 0.5930, P < .0001) and c‐Myc expression (r = 0.6121, P < .0001, Figure 6C).

Figure 6

Overexpression of FASN associated with the metastasis and poor prognosis of SACC patients. A, The expression of FASN was assessed by IHC in 91 SACC samples and 25 salivary gland tissues. FASN positive staining was mainly located in cytoplasm. FASN showed positive expression in 55 SACC tissues and negative expression in all salivary gland tissues. Representative images of IHC staining were shown. Scale bar = 20 μm B, The DFS and OS curves in SACC tissue with the positive or negative expression of FASN. Data showed that the positive FASN SACC patients showed a lower DFS and OS than SACC patients with negative expression (P < .001). C, The expression of PRRX1, cyclin D1 and c‐Myc in SACC was assessed by IHC. PRRX1, cyclin D1 and c‐Myc positive staining was mainly located in nucleus. The expression of PRRX1, cyclin D1 and c‐Myc in SACC tissues was closely associated with the FASN level. Representative images of IHC staining were shown (P < .001)

DISCUSSION

It is widely accepted that FASN, a key enzyme of de novo fatty acid synthesis, supports cancer progression. , Here, we demonstrated that FASN silencing inhibited the proliferation, migration and invasion of SACC cells, and the overexpression of FASN could restore the proliferation, migration and invasion in FASN silencing cells. Then, we found that FASN promoted the migration and invasion of SACC cells by inducing EMT in a PRRX1/Wnt/β‐catenin dependent manner. In the xenograft mice model, FASN silencing could suppress the growth and lung metastasis of SACC. In addition, we also demonstrated the level of FASN was increased in SACC tissues and the elevated level of FASN was positively related to the tumour location, pathological classification, clinic stage, local invasion, distant metastasis, recurrence and poor prognosis of SACC patients. Hence, our finding showed that FASN might contribute to the progression of SACC through activating the PRRX1/Wnt/β‐catenin pathway.

First, the data showed that FASN silencing led to weaken the proliferation of SACC cells and overexpression of FASN could rescue the proliferation ability in the FASN silencing cells in vitro. And the inhibition of FASN led to reduction of the growth of SACC in mice model. Similarly, in human colorectal cancer cell (CRC), the silencing of FASN expression by shRNA resulted to the decrease of cell proliferation. Lu et al found that loss of functions of FASN suppressed the proliferation of CRC, while FASN overexpression played the opposite role in vitro. Sun et al showed that siRNA induced FASN knockdown attenuated the proliferation of gastric cancer cells via the mTOR/Gli1 signalling pathway in vitro. Then, we showed the inhibition of FASN had no significant effect on the apoptosis of SACC cells. However, Sun et al showed that silencing of FASN induced cell apoptosis in suspended osteosarcoma (OS) cells as determined by flow cytometry. In human hepatoma Hep3B, fenofibrate could cause cells apoptosis by serving as inhibitor of thioesterase domain of FASN. This distinction might be caused by the difference of tumour cell types.

Further, we demonstrated FASN could promote the migration, invasion and EMT of SACC cells via gain‐ and loss‐of‐function studies in vitro and boost lung metastasis of SACC in vivo, which were in line with previous reports. Singh et al found that overexpression of miR‐195 inhibited breast cancer cell migration and invasion as well as EMT by decreasing the levels of FASN to regulate lipid homeostasis. Yang et al demonstrated that in NSCLC cell lines, cisplatin‐resistant cells up‐regulated FASN level and exhibited increased EMT and higher metastatic potential. In ovarian cancer, FASN could inhibit the activity of the E‐cadherin promoter versus enhance the activity of the N‐cadherin promoter via luciferase assay. However, Jiang et al indicated that overexpression of Snail1, a transcription factor mediating EMT, led to down‐expression of FASN in NSCLC. Meanwhile, FASN suppression could induce EMT accompanied by enhanced migration and invasion in vitro as well as metastasis in xenograft mice model. Zielinska et al found that FASN silencing could reverse the hyperglycaemia‐induced EMT and enhance invasive ability via caveolin‐1‐dependent manner in ERα‐positive BC cells. More work should be carried out in the future to elucidate this difference caused by FASN.

However, it is still unclear that how FASN induces the EMT in SACC cells. Previous studies uncovered that the EMT mediated by a series of transcript factors, including PRRX1, ZEB1, Twist, Slug, and Snail. Here, our data demonstrated that the up‐regulation or down‐regulation of FASN caused the increase or decrease of PRRX1 level in vitro and in vivo, respectively. Moreover, the overexpression of PPRX1 could restore EMT in FASN knockdown SACC cells. Hence, our data demonstrated that the PRRX1 mediated the FASN‐induced EMT in SACC. Although there was lack of the research focused on the relationship between FASN and PRRX1, our previous data showed that PRRX1 participated in the reprogramming of fatty acid metabolism in SACC. Besides, our previous study showed that PRRX1 contributed to EMT via miR‐642b‐3p in head and neck squamous cell carcinoma (HNSCC). Chen et al exhibited that HSP27 mediated TGF‐β1‐induced EMT in SACC cells by increasing the expression of Snail1 and PRRX1. In triple‐negative breast cancer, miR‐655 suppressed EMT by down‐regulating the expression of PRRX1. Thus, PRRX1may serve as the downstream of FASN to induce EMT in SACC.

Activity of Wnt/β‐catenin pathway promoted the β‐catenin to translocate into the nucleus which resulted in the loss of E‐cadherin. , Besides, cyclin D1 and c‐Myc, direct target genes of β‐catenin, showed enhanced levels after the activity of Wnt/β‐catenin pathway , and played a critical role in the EMT of cancers including pancreatic cancer, NSCLC and oral squamous cell carcinoma. Hence, we inferred that Wnt/β‐catenin pathway mediated the process of PRRX1 inducing EMT in SACC. Our data showed that the overexpression of PRRX1 could reverse the decrease of cyclin D1 and c‐Myc caused by FASN silencing in vitro, and the expressions of cyclin D1 and c‐Myc were down‐regulation when PRRX1 reduced in FASN‐shRNA xenograft tumours. Similarly, in gastric cancer, Guo et al found that overexpression of PRRX1 up‐regulated the intranuclear levels of β‐catenin and c‐Myc and promoted EMT, and XAV939, inhibitor of the Wnt/β‐catenin signing, abolish the role of PRRX1.

Additionally, the up‐regulation of FASN led to the high levels of PRRX1, cyclin D1 and c‐Myc in SACC tissues. And the expression of FASN was positive correlation with clinic stage, metastasis and recurrence and could be a biomarker of prognosis of SACC patients. These findings were in accordance with the previous data. In 95 human glioma specimens, the FASN level correlated with WHO grades, who mainly expressed in high‐grade gliomas. In 113 CRC tissues and 32 adjacent non‐tumorous tissues, CRC tissues presented FASN positive staining, whereas the normal tissues showed FASN negative staining, and FASN level positively correlated with the metastasis of CRC patients.

In summary, this study confirmed that FASN could promote the proliferation, migration and invasion of SACC cells in vitro and the growth and lung metastasis in vivo, which were at least partly explained by functioning as an inducer of EMT via PRRX1/Wnt/β‐catenin pathway. Besides, the FASN was selectively expressed in SACC tissues rather than salivary gland and associated with the poor prognosis of SACC patients. This might help to understand the role of FASN in SACC and provide a new door for SACC treatment.

CONFLICT OF INTEREST

There are no conflicts of interest.

Figure S1

Click here for additional data file.