| Literature DB >> 32759818 |
Mathieu Gand1, Kevin Vanneste1, Isabelle Thomas2, Steven Van Gucht2, Arnaud Capron3, Philippe Herman4, Nancy H C Roosens1, Sigrid C J De Keersmaecker1.
Abstract
The current COronaVIrus Disease 2019 (Entities:
Keywords: COVID-19; RT-qPCR; SARS-CoV-2; WGS data; bioinformatics tool; detection; diagnosis; in silico specificity evaluation; mismatches; primers and probes
Mesh:
Substances:
Year: 2020 PMID: 32759818 PMCID: PMC7432934 DOI: 10.3390/ijms21155585
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Overview of the 12 RT-qPCR tests, each including one or several assays, investigated in this study.
| Assay | Technology | Target | Primer and Probe Sequences (5′-3′) | Amplicon’s Starting Positio ¶ | Amplicon Length | Annealing T °C | Intended Specificity | Guidelines for Overall Interpretation of the Assay | Source |
|---|---|---|---|---|---|---|---|---|---|
| 1 | TaqMan | ORF1b | Fw CCCTGTGGGTTTTACACTTAA | 13,341 | 119 | NC | NC * | NC1 | China CDC, |
| Rv ACGATTGTGCATCAGCTGA | |||||||||
| P CCGTCTGCGGTATGTGGAAAGGTTATGG | |||||||||
| 1 | TaqMan | N | Fw GGGGAACTTCTCCTGCTAGAAT | 28,880 | 99 | NC | NC * | ||
| Rv CAGACATTTTGCTCTCAAGCTG | |||||||||
| P TTGCTGCTGCTTGACAGATT | |||||||||
| 2 ** | TaqMan | RdRp-P1 | Fw GTGARATGGTCATGTGTGGCGG | 15,430 | 100 | 58 °C |
| The E target can be used for a first screening. Then, positive results must be confirmed by RdRp sets, which must both be positive for the specific detection of SARS-CoV-2. | Charité Hospital, |
| Rv CARATGTTAAASACACTATTAGCATA | |||||||||
| P CCAGGTGGWACRTCATCMGGTGATGC | |||||||||
| 2 ** | TaqMan | RdRp-P2 | Fw GTGARATGGTCATGTGTGGCGG | 15,430 | 100 | 58 °C | SARS- | ||
| Rv CARATGTTAAASACACTATTAGCATA | CoV-2 | ||||||||
| P CAGGTGGAACCTCATCAGGAGATGC | |||||||||
| 2 *** | TaqMan | E | Fw ACAGGTACGTTAATAGTTAATAGCGT | 26,268 | 113 | 58 °C |
| ||
| Rv ATATTGCAGCAGTACGCACACA | |||||||||
| P ACACTAGCCATCCTTACTGCGCTTCG | |||||||||
| 2 **** | TaqMan | N | Fw CACATTGGCACCCGCAATC | 28,705 | 128 | 58 °C | NC | ||
| Rv GAGGAACGAGAAGAGGCTTG | |||||||||
| P ACTTCCTCAAGGAACAACATTGCCA | |||||||||
| 3 | TaqMan | RdRp-IP2 | Fw ATGAGCTTAGTCCTGTTG | 12,689 | 108 | 58 °C | SARS- | RdRp-IP2 and RdRp-IP4 must be detected for SARS-CoV-2 determination. The E target can be used as a confirmatory result. | Institut Pasteur, |
| Rv CTCCCTTTGTTGTGTTGT | CoV-2 | ||||||||
| P AGATGTCTTGTGCTGCCGGTA | |||||||||
| 3 | TaqMan | RdRp-IP4 | Fw GGTAACTGGTATGATTTCG | 14,079 | 107 | 58 °C | SARS- | ||
| Rv CTGGTCAAGGTTAATATAGG | CoV-2 | ||||||||
| P TCATACAAACCACGCCAGG | |||||||||
| 3 *** | TaqMan | E | Fw ACAGGTACGTTAATAGTTAATAGCGT | 26,268 | 113 | 58 °C |
| ||
| Rv ATATTGCAGCAGTACGCACACA | |||||||||
| P ACACTAGCCATCCTTACTGCGCTTCG | |||||||||
| 4 | TaqMan | N-1 | Fw GACCCCAAAATCAGCGAAAT | 28,286 | 72 | 55 °C | SARS- | Both N-1 and N-2 tests must be positive to confirm the detection of SARS-CoV-2. If only one target is detected, the result of the test is inconclusive. | US CDC, |
| Rv TCTGGTTACTGCCAGTTGAATCTG | CoV-2 | ||||||||
| P ACCCCGCATTACGTTTGGTGGACC | |||||||||
| 4 | TaqMan | N-2 | Fw TTACAAACATTGGCCGCAAA | 29,163 | 67 | 55 °C | SARS- | ||
| Rv GCGCGACATTCCGAAGAA | CoV-2 | ||||||||
| P ACAATTTGCCCCCAGCGCTTCAG | |||||||||
| 4 † | TaqMan | N-3 | Fw GGGAGCCTTGAATACACCAAAA | 28,680 | 72 | 55 °C | SARS- | ||
| Rv ACAATTTGCCCCCAGCGCTTCAG | CoV-2 | ||||||||
| P AYCACATTGGCACCCGCAATCCTG | |||||||||
| 5 | TaqMan | N | Fw AAATTTTGGGGACCAGGAAC | 29,124 | 158 | 60 °C | SARS- | NA | NIID, |
| Rv TGGCAGCTGTGTAGGTCAAC | CoV-2 § | ||||||||
| P ATGTCGCGCATTGGCATGGA | |||||||||
| 6 | TaqMan | ORF1b/ | Fw TGGGGYTTTACRGGTAACCT | 18,777 | 132 | 60 °C |
| The N gene detection is recommended for a first screening and the Orf1b/nsp14 detection as a confirmatory test. Mixed positive/negative results between the 2 targets should be regarded as undetermined. | HKU Med, |
| nsp14 | Rv AACRCGCTTAACAAAGCACTC | ||||||||
| P TAGTTGTGATGCWATCATGACTAG | |||||||||
| 6 | TaqMan | N | Fw TAATCAGACAAGGAACTGATTA | 29,144 | 110 | 60 °C |
| ||
| Rv CGAAGGTGTGACTTCCATG | |||||||||
| P GCAAATTGTGCAATTTGCGG | |||||||||
| 7 | TaqMan | N | Fw CGTTTGGTGGACCCTCAGAT | 28,319 | 57 | 55 °C | SARS- | NA | NIH, |
| Rv CCCCACTGCGTTCTCCATT | CoV-2 § | ||||||||
| P CAACTGGCAGTAACCA | |||||||||
| 8 | TaqMan | RdRp/ | Fw CGCATACAGTCTTRCAGGCT | 16,219 | 134 | 55 °C | SARS- | The primers and probe set targeting RdRp/Hel is the most sensitive of Assay 8 and can be used alone for the specific detection of SARS-CoV-2 with no cross-reactivity with other human coronaviruses. | Chan et al. |
| Hel | Rv GTGTGATGTTGAWATGACATGGTC | CoV-2 | |||||||
| P TTAAGATGTGGTGCTTGCATACGTAGAC | |||||||||
| 8 | TaqMan | S | Fw CCTACTAAATTAAATGATCTCTGCTTTACT | 22,711 | 158 | 55 °C | SARS- | ||
| Rv CAAGCTATAACGCAGCCTGTA | CoV-2 | ||||||||
| P CGCTCCAGGGCAAACTGGAAAG | |||||||||
| 8 | TaqMan | N | Fw GCGTTCTTCGGAATGTCG | 29,209 | 97 | 55 °C | SARS- | ||
| Rv TTGGATCTTTGTCATCCAATTTG | CoV-2 | ||||||||
| P AACGTGGTTGACCTACACAGST | |||||||||
| 9 | TaqMan | ORF1a | Fw AGAAGATTGGTTAGATGATGATAGT | 3192 | 118 | 58 °C | SARS- | NA | Lu et al. |
| Rv TTCCATCTCTAATTGAGGTTGAACC | CoV-2 | ||||||||
| P TCCTCACTGCCGTCTTGTTGACCA | |||||||||
| 10 | SYBR | RdRP | Fw CATGTGTGGCGGTTCACTAT | 15,440 | 118 | NC | SARS- | The main objective of this assay was the determination of patients negative for SARS-CoV-2. Thus, for a negative result, the 4 targets must remain undetected. Presence of SARS-CoV-2 is suspected if at least one target is detected, but further investigations need to confirm this. | Won et al. [ |
| Green | Rv TGCATTAACATTGGCCGTGA | CoV-2 | |||||||
| 10 | SYBR | S | Fw CTACATGCACCAGCAACTGT | 23,113 | 100 | NC | SARS- | ||
| Green | Rv CACCTGTGCCTGTTAAACCA | CoV-2 | |||||||
| 10 | SYBR | E | Fw TTCGGAAGAGACAGGTACGTT | 26,258 | 107 | NC | SARS- | ||
| Green | Rv CACACAATCGATGCGCAGTA | CoV-2 | |||||||
| 10 | SYBR | N | Fw CAATGCTGCAATCGTGCTAC | 28,731 | 118 | NC | SARS- | ||
| Green | Rv GTTGCGACTACGTGATGAGG | CoV-2 | |||||||
| 11 ∥ | SYBR | N-1 | Fw GCCTCTTCTCGTTCCTCATCAC | 28,816 | 111 | NC | SARS | N and ORF1a targets can be detected in SARS-CoV-2 and possibly in SARS-CoV even if there are 2 SNPs of difference. S targets should be detected in SARS-CoV-2 only, but some variants can be missed. Consequently, a combination of these targets must be used for test development. | Sigma-Aldrich |
| Green | Rv AGCAGCATCACCGCCATTG | ||||||||
| 11 ∥ | SYBR | N-2 | Fw AGCCTCTTCTCGTTCCTCATCAC | 28,815 | 102 | NC | SARS | ||
| Green | Rv CCGCCATTGCCAGCCATTC | ||||||||
| 11 ∥ | TaqMan | ORF1a-3 | Fw CCGCAAGGTTCTTCTTCGTAAG | 618 | 146 | NC | SARS | ||
| Rv TGCTATGTTTAGTGTTCCAGTTTTC | |||||||||
| P AAGGATCAGTGCCAAGCTCGTCGCC | |||||||||
| 11 ∥ | TaqMan | ORF1a-4 | Fw GGCTTACCGCAAGGTTCTTC | 612 | 152 | NC | SARS | ||
| Rv TGCTATGTTTAGTGTTCCAGTTTTC | |||||||||
| P AAGGATCAGTGCCAAGCTCGTCGCC | |||||||||
| 11 ∥ | TaqMan | S-5 | Fw CAGGTATATGCGCTAGTTATCAGAC | 23,564 | 97 | NC | SARS- | ||
| Rv CCAAGTGACATAGTGTAGGCAATG | CoV-2 | ||||||||
| P AGACTAATTCTCCTCGGCGGGCACG | |||||||||
| 11 ∥ | TaqMan | S-6 | Fw GCAGGTATATGCGCTAGTTATCAG | 23,563 | 187 | NC | SARS- | ||
| Rv ACACTGGTAGAATTTCTGTGGTAAC | CoV-2 | ||||||||
| P AGACTAATTCTCCTCGGCGGGCACG | |||||||||
| 12 | TaqMan | E | Fw ACTTCTTTTTCTTGCTTTCGTGGT | 26,294 | 82 | 60 °C | SARS- | NA | Huang et al. |
| Rv GCAGCAGTACGCACACAATC | CoV-2 | ||||||||
| P CTAGTTACACTAGCCATCCTTACTGC |
E: envelope protein; Hel: helicase; N: nucleocapsid protein; nsp-14: non-structural protein 14; ORF1: Open Reading Frame 1; RdRp: RNA-dependent RNA polymerase; S: spiking protein. Fw: forward primer sequence; Rv: reverse primer sequence; P: probe sequence. NC: Not Communicated; NA: Not Adapted because assay is single target. SARS: SARS-CoV-2 and possibly SARS-CoV; Sarbeco: Sarbecovirus—i.e., SARS-CoV, SARS-CoV-2, and SARS-related coronaviruses. CDC: Center for Disease Control and prevention. NIID: National Institute for Infectious Diseases. NIH: National Institute for Health. Assays_number (target list): all the targets of a RT-qPCR test developed by an institute or a scientific team. Assay_number_target: one specific target of a RT-qPCR test developed by an institute or a scientific team. *: Assays_1 (ORF1b and N) was developed for SARS-CoV-2 detection but the authors of these assays did not define the intended specificity of each target included in it. **: Assay_2_RdRp-P1 and Assay_2_RdRp-P2 are using the same primers but with different probes. ***: Assay_2_E and Assay_3_E are using the same primers and probe sets for the detection of the E gene. ****: The N target was less investigated by the authors of Assays_2 (RdRp-P1, RdRp-P2, E, and N) because it was less sensitive than the other targets. Thus, the RT-qPCR test from Charité Hospital (Germany) can be performed with RdRp and E detection only. †: The third N target was present in the first version (February) of Assays_4 (N-1, N-2 and N-3) but was removed in a revised version (March). Thus, the US CDC RT-qPCR test can be performed with N-1 and N-2 detection only. ‡: Even though Assays_6 (Orf1b/nsp14 and N) are indicated to be specific to Sarbecovirus, the authors mentioned that they were developed for SARS-CoV-2 detection, as SARS-CoV is supposedly eradicated. §: The intended specificity was not clearly stated in the original protocol, but these assays were developed for SARS-CoV-2 detection. ∥: Primers and probes of Assays_11 (N-1, N-2, ORF1a-3, ORF1a-4, S-5, and S-6) were designed by Sigma-Aldrich to help the competent authorities in the diagnosis of COVID-19. However, to the best of our knowledge, no commercial kit has been developed yet. ¶: Positioning based on reference genome NC_045512.2.
Figure 1Location of the sequence amplified by each evaluated primer set in Table 2. Genome (NC_045512.2). The SARS-CoV-2 genome (~29,000 nt) is composed of genes coding for structural proteins, such as the Spike protein (S), Envelope protein (E), and Nucleocapsid protein (N); and non-structural proteins located in the Open Reading Frame 1ab (ORF1ab), such as RNA-dependent RNA polymerase (RdRp), Helicase (H), and non-structural protein 14 (nsp14). The orange rectangles in the figure show the approximate size and location in these genes of the target sequence that is amplified by each of the evaluated primer sets. The corresponding assay reference number is indicated in black, and its targeted gene in green (Table 1). Two labels connected to the same orange rectangle indicate that the targeted amplified sequences are overlapping. The exact starting point of each of the forward primers and the length of their corresponding amplicons are available in Table 1.
Inclusivity evaluation of primers and probe sets using SCREENED with the first SARS-CoV-2 genome batch 07042020 for all the RT-qPCR tests.
| Assay | Target | Genomes with Mismatches in the First Five Nucleotides of the Primer’s 3′ End | Genomes with >10% Mismatches in the Annealing Sites of Primers and Probes | False Negative Results *** | Inclusivity | ||
|---|---|---|---|---|---|---|---|
| Number * | Modifications ** | Number * | Modifications ** | ||||
| 1 | ORF1b | 1 | Fw GTGGGTTTTACA | 0 | - | 1 | 99.96% |
| 1 | N | 1 | Rv CAGACATTTTGCTCTCAA | 358 | Fw | 359 | 86.03% |
| 2 | RdRp-P1 | 0 | - | 1 | Pb CCAGGTGG | 1 | 99.96% |
| 2 | RdRp-P2 | 0 | - | 0 | - | 0 | 100% |
| 2 | E | 0 | - | 0 | - | 0 | 100% |
| 2 | N | 4 | Fw CACATTGGCACCCG | 0 | - | 5 | 99.81% |
| 1 | Rv GAGGAACGAGAAGAG | ||||||
| 3 | RdRp-IP2 | 3 | Rv CTCCCTTTGTTGTGTT | 0 | - | 3 | 99.88% |
| 3 | RdRp-IP4 | 0 | - | 0 | - | 0 | 100% |
| 3 | E | 0 | - | 0 | - | 0 | 100% |
| 4 | N-1 | 7 | Rv TCTGGTTACTGCCAGTTGAA | 0 | - | 7 | 99.73% |
| 4 | N-2 | 1 | Fw TTACAAACATTGGCC | 0 | - | 1 | 99.96% |
| 4 | N-3 | 0 | - | 0 | - | 0 | 100% |
| 5 | N | 3 | Fw AAATTTTGGGGACCA | 0 | - | 8 | 99.69% |
| 4 | Fw AAATTTTGGGGACCAGGAA | ||||||
| 1 | Rv TGGCA | ||||||
| 6 | ORF1b/nsp14 | 0 | - | 0 | - | 0 | 100% |
| 6 | N | 2 | Rv CGAAGGTGTGACTTC | 0 | - | 2 | 99.92% |
| 7 | N | 7 | Fw CGTTTGGTGGACCCTCAG | 0 | - | 7 | 99.73% |
| 8 | RdRp/Hel | 0 | - | 0 | - | 0 | 100% |
| 8 | S | 0 | - | 0 | - | 0 | 100% |
| 8 | N | 1 | Fw GCGTTCTTCGGAATGTC | 0 | - | 1 | 99.96% |
| 9 | ORF1a | 0 | - | 0 | - | 0 | 100% |
| 10 | RdRp | 8 | Rv TGCATTAACATTGGCCGT | 0 | - | 8 | 99.69% |
| 10 | S | 0 | - | 0 | - | 0 | 100% |
| 10 | E | 0 | - | 0 | - | 0 | 100% |
| 10 | N | 1 | Rv GTTGCGACTACGTGATGAG | 0 | - | 1 | 99.96% |
| 11 | N-1 | 3 | Fw GCCTCTTCTCGTTCCTCA | 0 | - | 8 | 99.69% |
| 5 | FW GCCTCTTCTCGTTCCTCAT | ||||||
| 11 | N-2 | 3 | Fw AGCCTCTTCTCGTTCCTCA | 0 | - | 8 | 99.69% |
| 5 | Fw AGCCTCTTCTCGTTCCTCAT | ||||||
| 11 | ORF1a-3 | 0 | - | 0 | - | 0 | 100% |
| 11 | ORF1a-4 | 0 | - | 0 | - | 0 | 100% |
| 11 | S-5 | 9 | Fw CAGGTATATG | 0 | - | 11 | 99.57% |
| 1 | Fw CAGGTATATGCGCTAGTTATCA | ||||||
| 1 | Fw CAGGTATATGCGCTAGTTATC | ||||||
| 11 | S-6 | 9 | Fw GCAGGTATATG | 0 | - | 11 | 99.57% |
| 1 | Fw GCAGGTATATGCGCTAGTTATCG | ||||||
| 1 | Fw GCAGGTATATGCGCTAGTTATC | ||||||
| 12 | E | 0 | - | 0 | - | 0 | 100% |
-: No modifications retrieved by SCREENED. *: Number of genomes having the type of mismatches investigated from a total of 2569 unique representative genomes. **: Detected mismatches are indicated in bold in the 5′-3′ sequence of forward primers (Fw), reverse primers (Rv), and probes (Pb). The mismatch in bold, and underlined is an additional SNP not specific to the parameters investigated by SCREENED. ***: The total number of genomes that did not produce a positive signal for the evaluated primers and probe sets considered as false negative results. No false negative results were obtained due to minimum alignment length lower than 90%.
Figure 2Sampling time and location for genomes that showed three mismatches in the sequence of Assay_1_N′s forward primer. Three mismatches between the forward primer sequence of Assay_1_N targeting N gene and 358 SARS-CoV-2 genomes were retrieved by SCREENED. Part (A) of the figure shows the occurrence of these genomes over time since the 25th of February 2020, and the arrows represent their first apparition in each continent according to the color legend in Part B. Ten of the 358 genomes with the described mismatches were not included in this figure, as their time of collection was not available. Part (B) of the figure shows the location where these genomes were collected. One of the 358 genomes with the described mismatches was not included in this figure, as its location was not communicated.
Figure 3Diversity in the SARS-CoV-2 genomes of the target sequences amplified by the evaluated primer and probe sets. Clustering of the targeted genomic sequences amplified by the 30 evaluated primers was performed by SCREENED for each of the 12 RT-qPCR assays. The present chart shows the repartition of the amplicons from each genome in their sequence identity clusters (i.e., a set of targeted amplicons exhibiting exactly the same sequence), illustrating the overall sequence diversity according to the color key on the right of the figure for all primer and probe sets. For the majority of the assays, more than 97% of the amplicons were clustered in one large cluster. For Assay_1_N, Assay_11_N-1, and Assay_11_N-2, a second large cluster containing ~14% of the amplicons emerged. A varying amount of other clusters is present for the different methods, containing however only a very limited number of amplicons. Note that the y-axis, presenting the percentage of amplicons per cluster, starts at 75% to allow better the visual interpretation of amplicon diversity, since the first 75% always belongs to the first large cluster per primer and probe set.
SNPs present in an abnormally large number of SARS-CoV-2 genomes.
| Assay | Target | Modifications * | Number of Genomes with the Modification(s) |
|---|---|---|---|
| 2 | RdRp-P1 | Pb CCAGGTGGAAC | 2566 (99.88%) |
| 2 | RdRp-P1&P2 | Rv CAAATGTTAAA | 2569 (100%) |
| 5 | N | Rv TGGCA | 2569 (100%) |
| 8 | RdRp/Hel | Rv | 2569 (100%) |
| 10 | E | Rv CACACAATCGA | 2567 (99.92%) |
*: Mismatches are indicated in bold in the 5′-3′ sequence of reverse primers and probe (Pb). These mismatches were determined by multiple alignment and not by SCREENED because these mismatches are not considered to prevent amplification, but potentially can result in false negative signals if secondary mismatches appear. †: The reverse primer of Assay_5_N was corrected in a revised version of the protocol [41], but is not yet included in the WHO guidance document.
Exclusivity evaluation of primers and probe sets using SCREENED with the non-SARS-CoV-2 genome batch 23042020 for all the RT-qPCR tests.
| Assay | Target | Genomes Giving a Positive Signal | False Positive Results * | Exclusivity |
|---|---|---|---|---|
| 1 | ORF1b | 0 | 0 | 100% |
| 1 | N | 0 | 0 | 100% |
| 2 | RdRp-P1 | 172 SARS-related coronavirus | 0 | 100% |
| 2 | RdRp-P2 | 5 SARS-related coronavirus and | 7 | 99.75% |
| 2 | E | 179 SARS-related coronavirus and | 0 | 100% |
| 2 | N | 162 SARS-related coronavirus and | 0 | 100% |
| 3 | RdRp-IP2 | 0 | 0 | 100% |
| 3 | RdRp-IP4 | 0 | 0 | 100% |
| 3 | E | 179 SARS-related coronavirus and | 0 | 100% |
| 4 | N-1 | 0 | 0 | 100% |
| 4 | N-2 | 0 | 0 | 100% |
| 4 | N-3 | 13 SARS-related coronavirus and | 0 | 100% |
| 5 | N | 0 | 0 | 100% |
| 6 | ORF1b/nsp14 | 170 SARS-related coronavirus and | 0 | 100% |
| 6 | N | 179 SARS-related coronavirus and | 0 | 100% |
| 7 | N | 0 | 0 | 100% |
| 8 | RdRp/Hel | 0 | 0 | 100% |
| 8 | S | 0 | 0 | 100% |
| 8 | N | 0 | 0 | 100% |
| 9 | ORF1a | 0 | 0 | 100% |
| 10 | RdRP | 0 | 0 | 100% |
| 10 | S | 0 | 0 | 100% |
| 10 | E | 181 SARS-related coronavirus and | 186 | 92.32% |
| 10 | N | 2 SARS-related coronavirus | 2 | 99.92% |
| 11 | N-1 | 0 | 0 | 100% |
| 11 | N-2 | 0 | 0 | 100% |
| 11 | ORF1a-3 | 2 SARS-related coronavirus | 2 | 100% |
| 11 | ORF1a-4 | 0 | 0 | 100% |
| 11 | S-5 | 0 | 0 | 100% |
| 11 | S-6 | 0 | 0 | 100% |
| 12 | E | 178 SARS-related coronavirus and | 184 | 92.41% |
*: SARS-related coronavirus and bat-coronavirus were not counted as false positive results if detected by primer and probe sets designed to have a broad specificity to other members of the Coronaviridae family (see Table 2). No false positive results were obtained due to a minimum alignment length lower than 90%.
Inclusivity evolution of the four RT-qPCR assays analyzed with SCREENED using the second batch of SARS-CoV-2 genomes.
| Assay | Target | Genomes with Mismatches in the First Five Nucleotides of the Primer’s 3′ End | Genomes with too Many Mismatches in the Annealing Sites of Primers and Probes | False Negative Results *** | Inclusivity | ||
|---|---|---|---|---|---|---|---|
| Number * | Modifications ** | Number * | Modifications ** | ||||
| 1 | ORF1b | 0 | - | 0 | - | 0 | 100% |
| 1 | N | 1 | Fw GGGGAACTTCTCCTGCTA | 241 | Fw | 247 | 74.54% |
| 4 | Fw GGGGAACTTCTCCTGCTA | 1 | Fw
| ||||
| 2 **** | RdRp-P1 | 1 | Fw GTGAAATGGTCATGTGT | 0 | - | 2 | 99.79% |
| 1 | Fw GTGAAATGGTCATGTGTGG | 0 | - | ||||
| 2 **** | RdRp-P2 | 1 | Fw GTGAAATGGTCATGTGT | 0 | - | 2 | 99.79% |
| 1 | Fw GTGAAATGGTCATGTGTGG | 0 | - | ||||
| 2 | E | 0 | - | 0 | - | 0 | 100% |
| 2 | N | 0 | - | 0 | - | 0 | 100% |
| 4 | N-1 | 0 | - | 0 | - | 0 | 100% |
| 4 | N-2 | 0 | - | 0 | - | 0 | 100% |
| 4 | N-3 | 0 | - | 0 | - | 0 | 100% |
| 8 | RdRp/Hel | 0 | - | 0 | - | 0 | 100% |
| 8 | S | 0 | - | 0 | - | 0 | 100% |
| 8 | N | 1 | Rv TTGGATCTTTGTCATCCAATTT | 0 | - | 1 | 99.90% |
-: No modifications retrieved by SCREENED. *: Number of genomes exhibiting the type of mismatches investigated. **: Mismatches are indicated in bold in the 5′-3′ sequence of forward primers (Fw), reverse primers (Rv), and probes (Pb). ***: The total number of genomes which did not produce a positive signal for the evaluated primers and probe sets, according to SCREENED, were determined as false negative results. No false negative results were obtained due to a minimum alignment length lower than 90%. ****: The primers targeting the RdRp gene for Assay_2_RdRp-P1 and Assay_2_RdRp-P2 are identical, but the probe is different (not indicated in this table).
Figure 4Comparison of amplicon diversity in the SARS-CoV-2 genomes collected before and after the 7th of April 2020 for Assay_1_N and Assay_8_S. The chart shows for Assay_1_N and Assay_8_S the repartition of the sequence amplified in the genomes downloaded before (2569) and after (968) the 7th of April, in their clusters. After one month, the diversity in the region targeted by Assay_1_N increased, while the region targeted by Assay_8_S stayed highly conserved.