Pulmonary arterial hypertension is a fatal disorder of the lung circulation in which accumulation of vascular cells progressively obliterates the pulmonary arterioles. This results in sustained elevation in pulmonary artery pressure leading eventually to right heart failure. Approximately, 80% of familial and 20% of sporadic idiopathic pulmonary arterial hypertension cases are caused by mutations in the bone morphogenetic protein receptor type 2 (BMPR2). Nonsense mutations in BMPR2 are amongst the most common mutations found, where the insertion of a premature termination codon causes mRNA degradation via activation of the nonsense-mediated decay pathway leading to a state of haploinsufficiency. Ataluren (PTC124), a compound that permits ribosomal read-through of premature stop codons, has been previously reported to increase BMPR2 protein expression in cells derived from pulmonary arterial hypertension patients harbouring nonsense mutations. In this study, we characterised the effects of PTC124 on a range of nonsense BMPR2 mutations, focusing on the R584X mutation both in vitro and in vivo. Treatment with PTC124 partially restored BMPR2 protein expression in blood outgrowth endothelial cells isolated from a patient harbouring the R584X mutation. Furthermore, a downstream bone morphogenetic protein signalling target, Id1, was rescued by PTC124 treatment. Mutant cells also exhibited increased lipopolysaccharide-induced permeability, which was reversed by PTC124 treatment. Increased proliferation and apoptosis in R584X blood outgrowth endothelial cells were also significantly reduced by PTC124. Moreover, oral PTC124 increased lung BMPR2 protein expression in mice harbouring the R584X mutation (Bmpr2 +/R584X ). Our findings provide support for future experimental medicine studies of PTC124 in pulmonary arterial hypertension patients with specific nonsense BMPR2 mutations.
Pulmonary arterial hypertension is a fatal disorder of the lung circulation in which accumulation of vascular cells progressively obliterates the pulmonary arterioles. This results in sustained elevation in pulmonary artery pressure leading eventually to right heart failure. Approximately, 80% of familial and 20% of sporadic idiopathic pulmonary arterial hypertension cases are caused by mutations in the bone morphogenetic protein receptor type 2 (BMPR2). Nonsense mutations in BMPR2 are amongst the most common mutations found, where the insertion of a premature termination codon causes mRNA degradation via activation of the nonsense-mediated decay pathway leading to a state of haploinsufficiency. Ataluren (PTC124), a compound that permits ribosomal read-through of premature stop codons, has been previously reported to increase BMPR2 protein expression in cells derived from pulmonary arterial hypertensionpatients harbouring nonsense mutations. In this study, we characterised the effects of PTC124 on a range of nonsense BMPR2 mutations, focusing on the R584X mutation both in vitro and in vivo. Treatment with PTC124 partially restored BMPR2 protein expression in blood outgrowth endothelial cells isolated from a patient harbouring the R584X mutation. Furthermore, a downstream bone morphogenetic protein signalling target, Id1, was rescued by PTC124 treatment. Mutant cells also exhibited increased lipopolysaccharide-induced permeability, which was reversed by PTC124 treatment. Increased proliferation and apoptosis in R584X blood outgrowth endothelial cells were also significantly reduced by PTC124. Moreover, oral PTC124 increased lung BMPR2 protein expression in mice harbouring the R584X mutation (Bmpr2 +/R584X ). Our findings provide support for future experimental medicine studies of PTC124 in pulmonary arterial hypertensionpatients with specific nonsense BMPR2 mutations.
Pulmonary arterial hypertension (PAH) is a devastating disorder characterised by
excessive fibroblasts, endothelial cells and smooth muscle cells in the lung
vasculature. These aberrant cellular processes cause progressive occlusion of the
pulmonary arterioles leading to a sustained elevation in pulmonary artery pressure
and eventually right heart failure. Current therapies slow disease progression while
also alleviating symptoms, but the only cure remains lung transplantation.
Approximately 80% of families with PAH, and 20% of apparently idiopathic PAH cases,
are due to autosomal dominant heterozygous germline mutations in the bone
morphogenetic protein receptor type 2 (BMPR2).[1-4] BMP signalling regulates many
processes related to growth, survival, differentiation and development. Upon BMP
ligand stimulation, the constitutively phosphorylated BMPR2 heterodimerises with BMP
type I receptors at the cell surface. A cascade of downstream signalling occurs
through phosphorylation of proteins known as receptor-mediated Smads (R-Smads).
R-Smads complex with the common partner Smad, Smad4, and translocate to the nucleus
driving expression of target genes including the family of inhibitors of DNA-binding
(Ids 1–4).[5] We have previously shown that mutations in BMPR2 cause
loss-of-function with a reduction in expression of many downstream signalling
targets, and altered growth responses to BMP ligands.[6-11]Nonsense mutations introduce premature stop codons into the sequence of DNA. If the
mRNA transcript is expressed and translated, this can result in a truncated,
potentially non-functional protein. Alternately, the mutant transcript is unstable
and is rapidly removed by nonsense-mediated mRNA decay (NMD),[12] leading to complete absence of the mutant protein. It is estimated that 12%
of known disease-causing mutations in the Human Gene Mutation Database are due to
nonsense mutations,[13] but the functional impact of the premature stop codon can be difficult to
predict. Previous studies proposed that variants close to the 3′ end of a transcript
might avoid NMD.[14] However, a recent large-scale RNA-seq study suggested that up to 68% of
variants predicted to cause NMD actually escape RNA surveillance.[15] Since the discovery of mutations in BMPR2 predisposing
individuals to PAH, over 300 distinct mutations have been identified with a
significant proportion due to nonsense mutations (approximately 30%).[3,16,17]Aminoglycosides such as gentamicin have been used in proof-of-concept studies to
suppress NMD as a way of treating cystic fibrosis (CF) and Duchenne muscular
dystrophy (DMD).[18-20] Indeed,
gentamicin has been tested successfully in premature termination codon (PTC)
BMPR2 mutations models.[21,22] However, the risk of renal and
otic toxicities due to the requirement of high doses have precluded the use of
gentamicin as a therapeutic in this setting. Ataluren (also known as PTC124) is a
small molecule non-aminoglycosideoxodiazole that promotes the read-through of
premature stop codons. Using a high-throughput discovery screen, PTC124 was
discovered and tested in vitro and in vivo as a potentially safer alternative to
gentamicin.[23,24] In clinical trials for both CF and DMD, PTC124 appeared safe
and showed some promising efficiacy.[24-26] Given these promising
findings, Drake et al. investigated the ability of PTC124 to improve BMP signalling
and reverse the hyperproliferative phenotype in nonsense mutant
BMPR2 endothelial cells.[27]In this study, we further characterised the potential therapeutic properties of
PTC124 on a range of PTCs across the BMPR2 gene in patient-derived
cells, and found major differences in the restoration of BMPR2 protein expression
between BMPR2 mutations. Furthermore, we developed a mouse knock-in
model for one of these mutations (R584X) to provide proof-of-concept that this
approach might be useful in vivo for specific BMPR2 nonsense
mutations.
Materials and methods
Cell culture and treatments
Human blood outgrowth endothelial cells (BOECs) were isolated from peripheral
blood of PAH patients and healthy controls as previously described.[28-30] All blood donors provided
informed consent in accordance with the human study protocol – 07/H0306/134
(Cambridgeshire 3 Research Ethics Committee). Cells were cultured and expanded
in Endothelial Cell Growth Medium-2 (EGM-2) (minus heparin) (Lonza, Slough, UK)
with 10% Foetal Bovine Serum (FBS) (Thermo Fisher Scientific, Hemel Hempstead,
UK). All experiments were performed with passage 5–7 cells. Human or mouse
pulmonary artery smooth muscle cells (PASMCs) were isolated as previously
described and cultured in DMEM (Invitrogen) containing 20% (v/v) FBS and A/A
(DMEM/20% FBS).[31] The Royal Papworth Hospital ethical review committee approved the use of
the human tissues (Ethics Ref 08-H0304-56 + 5), and informed consent was
obtained from all subjects. Recombinant humanBMP9 was purchased from R&D
Systems (Oxfordshire, UK). PTC124 was a kind gift from PTC Therapeutics (South
Plainfield, NJ, USA) and was used at 100 µM overnight in all in vitro
experiments.
Immunoblotting
Frozen lung tissue was homogenised in lysis buffer (250 mM Tris-HCl, pH 6.8, 4%
SDS, 20% v/v glycerol and 1 × EDTA-free protease inhibitor cocktail – Roche,
West Sussex, UK) and sonicated for approximately 1 min and then centrifuged for
15 min at 15,000 × g. BOECs were lysed in lysis buffer (50 mM
Tris-HCl, pH 8, 150 mM NaCl, 1% Igepal, 0.5% sodium deoxycholate, 0.1% SDS and
1 × EDTA-free protease inhibitor cocktail). The protein concentration was
determined using the Bio-Rad Lowry assay (Bio-Rad Laboratories, Hemel Hempstead,
UK), using Bovine Serum Albumin (BSA) as the standard. Cell lysates (20–100 µg
protein) were separated by SDS-PAGE and proteins were transferred to
polyvinylidene fluoride membranes by semidry blotting (GE Healthcare,
Buckinghamshire, UK). Membranes were then blocked and probed with a rabbit
monoclonal antibody toward Id1 (clone 195-14, CalBioreagents, San Mateo, CA) or
a mouse monoclonal antibody against BMPR2 (clone 18I, BD Transduction
Laboratories, Wokingham, Berkshire, UK). After washing, blots were incubated
with secondary anti-mouse/rabbit horseradish peroxidase antibody (Dako,
Cambridgeshire, UK) for 1 h at room temperature. As a loading control, all blots
were re-probed with a monoclonal antibody for either α-tubulin (clone DM1A,
Sigma-Aldrich) or β-actin (clone AC-15, Sigma-Aldrich). Densitometry was
performed using ImageJ software. Membranes were developed using enhanced
chemiluminescence (GE Healthcare).
Endothelial monolayer permeability
Monolayer permeability was assessed as described previously.[32] Briefly, transwell inserts (Corning, Corning, NY) were coated for 1 h at
37℃ with 0.1 mg/ml bovine skin collagen (Sigma), washed twice with water and
rinsed with medium before plating cells. BOECs (400,000 cells in 100 µl Complete
EGM-2 medium) were plated in the top chamber and 700 µl of medium was added to
the bottom chamber 24 h before addition of fresh medium to both chambers, with
or without 5 ng/ml BMP9 or PTC124 (100 µM) in the upper chamber. After 30 min,
25 nM horseradish peroxidase (HRP) was added to the top chamber, with or without
0.4 µg/ml lipopolysaccharide (LPS) (Sigma). Medium (20 µl) was collected from
the lower chamber every 15 min for 60 min. The HRP content of this medium was
determined by measuring absorbance at 490 nm after the addition of 150 µl of
o-phenylenediamine dihydrochloride buffer to each well of a
96-well plate.
Cell proliferation
For assessment of BOEC proliferation, cells were seeded at 40,000 cells/well in
24-well plates and left to adhere overnight. After 24 h, cells were then exposed
to the stated treatments in EBM-2 containing 2% FBS and A/A. Treatments were
replenished every 48 h. For assessment of mouse PASMC proliferation, cells were
seeded at 30,000 cells/well in 24-well plates and left to adhere overnight.
After 24 h, cells were then exposed with or without PTC124 100 µM in complete
culture media for 48 h. At the relevant time points, cells were trypsinised and
counted on a haemocytometer using trypan blue exclusion to assess cell
viability.
Apoptosis
Prior to addition of an apoptotic stimulus, BOECs were transferred into EBM-2
basal media (Lonza) with 2% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin and
0.25 mg/ml amphotericin B, but without any growth factor supplements for 16 h.
During this incubation, cells were maintained with or without PTC124 (100 µM)
for the indicated period. Following the 16 h incubation, cells were either left
unstimulated or treated for 6 h with 10 ng/ml Tumour Necrosis Factor-a (TNFα)
and 20 µg/ml cycloheximide to induce apoptosis. Following the apoptotic
stimulus, cells were trypsinised and stained with FITC-conjugated annexin V and
propidium iodide (PI, BD Biosciences, Wokingham, UK) as per the manufacturer's
instructions and assessed by flow cytometry. Apoptotic cells were defined as
positive for Annexin-V staining and negative for PI staining.
RNA preparation and quantitative reverse transcriptase polymerase chain
reaction
Total RNA was extracted using the RNeasy Mini Kit with DNAse digestion (Qiagen,
West Sussex, UK). cDNA was prepared from ∼1 µg of RNA using the High Capacity
Reverse Transcriptase kit (Applied Biosystems, California, USA), according to
the manufacturer's instructions. All qPCR reactions were prepared in MicroAmp®
optical 384-well reaction plates (Applied Biosystems) using 50 ng/µl cDNA with
SYBR®Green Jumpstart™ Taq Readymix™ (Sigma-Aldrich), ROX reference dye
(Invitrogen) and sense and anti-sense primers (all 200 nM). Primers for human:
BMPR2, ACTB; mouse: Bmpr2, Actb, B2m and
Hprt were all designed using Primer3 (http://primer3.sourceforge.net/). Reactions were amplified on a
QuantStudio 6Flex Real-Time PCR system (Applied Biosystems). In human BOECs,
target gene expression was normalised to ACTB and the
difference in the amount of product produced was expressed as a fold change.
Relative expression of each target gene was identified using the comparative
2-(ΔΔCt) method. In mouse lung, target gene expression was normalised to
Actb, B2m and Hprt and the difference
expression represented as relative expression.
Puromycin incubation and RNA isolation
The following protocol was adapted from Hamid and colleagues.[22] BOECs or PASMCs were cultured in full growth media in 6 cm dishes until
confluence and then incubated with or without puromycin (100 µg/ml, Sigma
Aldrich) 16 h prior to harvesting. RNA was harvested using the RNeasy Mini kit
(Qiagen) following the manufacturer's instructions.
Reverse transcriptase polymerase chain reaction of BMPR2
Total RNA (∼3 µg) was used as a template for cDNA synthesis. Following the
manufacturer's protocol, first-strand cDNA synthesis was performed using
SuperScript™ First-Strand System (Thermo Fisher Scientific) with an oligo-dT
primer. A tenth of the first-strand reaction volume was then used as a template
for PCR amplification. Reverse transcriptase polymerase chain reaction (RT-PCR)
primers were as follows: W9X – CTTTGCCCTCCTGATTCTTGG (forward) and
CTGCTGCCTCCATCATGTTC (reverse); R213X – GAACATGATGGAGGCAGCAG (forward) and
CTCGATGGGAAATTGCAGGT (reverse); R321X – CACCACTCAGTCCACCTCAT (forward) and
GCGCACCAGTCTATTTCCAG (reverse); R584X – AGACTGTTGGGACCAGGATG (forward) and
CGTGAGTCCTGTGGTGTTTG (reverse); R899X – CAACAAGCTGGCCATGATGA (forward) and
TGCAAGGTAAACAGCAGTGC (reverse). RT-PCR amplification was conducted using the
Elongase™ Enzyme Mix (Thermo Fisher Scientific). Cycling parameters were as
follows: initialisation step – 30 s at 94℃; amplification step (55 cycles) – 94℃
for 30 s, 58℃ for 30 s, 68℃ for 3 min 30 s; extension step – 68℃ for 5 min.
cDNA products were visualised by agarose gel electrophoresis.
DNA sequencing of RT-PCR products
Prior to sequencing, BMPR2 RT-PCR products were purified with
ExoSAP-IT™ PCR Product Cleanup reagent (Thermo Fisher Scientific) according to
the manufacturer's protocol. Sequencing reactions were performed using the
BigDye™ Terminator v3.1 Cycle Sequencing kit (Thermo Fisher Scientific)
according to the manufacturer's protocol. Samples were then sequenced.
Bmpr2+/R584X knock-in mouse model
For all animal work, group sizes were determined using estimates of variance and
minimum detectable differences between the groups that were based on our past
experience with rodent models of PAH. Animals were randomised using an assigned
animal identification number, allowing investigators performing all
cardiopulmonary phenotyping procedures and histological analyses to be blinded
to animal genotype and treatment group. All animal work was carried out in
accordance with the UK Animals (Scientific Procedures) Act 1986 and approved
under Home Office Project License 80/2460.The Bmpr2 knock-in mouse model was generated by GenOway (Lyon, France).
Supplementary Fig. 5 depicts an overview of the strategy used to generate the
R584X mutant. A targeting vector containing the R584X mutation in exon 12 was
generated. Upstream of the 3′ short homology arm a lox-P
flanked neomycin cassette was inserted. PCR screening and Southern blot
screening were conducted to detect homologous recombination after
electroporation into embryonic stem (ES) cells. Sequence analysis was then
conducted to ascertain presence of the R584X mutation. Recombined ES cell clones
were injected into blastocysts. To generate chimeric male carrying the
recombined locus, blastocysts were implanted in pseudo-pregnant females and
allowed to develop to term. Chimerism was assessed based on coat colour.
Chrimeric males were then bred with Cre-deleter mice to excise the loxP-flanked
neomycin cassette. Progeny was assessed by genotype analysis.
PTC124 treatment of Bmpr2+/R584X animals
Littermate controls (Bmpr2; n = 12) and R584X knock-in (Bmpr2; n = 12) mice were randomised into two groups. One group
was fed chow supplemented with PTC124 (0.3% PTC124) supplied by PTC Therapeutics
(South Plainfield, NJ, USA) for two weeks. The other group was fed a standard
chow diet for two weeks. Mice were anesthetised with isoflurane inhalation and
then either assessed haemodynamically or mice were exsanguinated and the lungs
were removed for further analysis. Lungs were either fixed in situ in the
distended state by infusion of 10% buffered formalin into the pulmonary artery
(at 25 mmHg pressure) via the trachea and overnight fixation in 4% formalin
prior to embedding in paraffin, or immediately frozen in liquid nitrogen for
protein or RNA isolation.Where indicated in the relevant results section, catheterisation of the right
ventricle (RV) was undertaken via cannulation of the right internal jugular vein
using a Millar SPR-139 catheter (Millar Instruments, Houston, TX) connected to
PowerLab hardware utilising LabChart 8 (ADInstruments, Oxford, UK). Mice were
then sacrificed and the hearts and lungs were harvested. Right ventricular
hypertrophy (RVH) was assessed by removing the heart and dissecting the RV free
wall from the left ventricle plus septum (LV + S) and weighing separately. The
degree of RVH was determined from the ratio RV/LV + S.
Assessment of pulmonary vascular remodelling
In order to assess pulmonary arteriolar muscularisation, sections of fixed mouse
lung tissue (5 µm in thickness) were labelled with monoclonal mouse-anti-smooth
muscle α-actin (SMA) (clone 1A4, Dako, Glostrup, Denmark), followed by
polyclonal goat anti-mouse HRP. To detect staining, the Dako ARK™ kit (Dako) was
used in accordance with the manufacturer's instructions. Antibody staining was
visualised using 3-3' diaminobenzidine hydrochloride as substrate-chromogen and
counterstained with Carrazzi haematoxylin. Pulmonary arteriolar muscularisation
was assessed by the identification of alveolar ducts and categorisation of the
accompanying intra-acinar artery as non-, partially or fully muscularised, by
the degree of SMA immunostaining. A minimum of 20 vessels with diameters ranging
from 25 to 75 µm were categorised as either fully, partially or
non-muscularised. Assessment of muscularisation was performed in a blinded
fashion by a single researcher, to reduce operator variability, who was not
aware of the group allocation of the samples being analysed.
PTC124 measurement in serum
PTC124 concentration in mouse serum was conducted using Liquid Chromatography
with Mass Spectrometry (LC/MS/MS). Serum was isolated from blood samples
collected in EDTA tubes at days 7 and 14 by tail vein bleed. Blood samples were
centrifuged at 2000 × g for 5 min, and the serum fraction was
extracted and stored at −80℃. Samples were analysed using LC/MS/MS by PTC
Therapeutics using a UPLC I-Class System and Xevo TQ-S Spectrometer (Waters
Corporation, Milford, MA, USA). Briefly, a standard curve of PTC124 was
generated (0.01–5 μg/ml). Samples were diluted with 16% methanol and 1 µg/ml
D4-124 in acetonitrile. Samples were placed on an automatic shaker for 5 min
before centrifugation at 2000 r/min for 2 min prior to injecting onto the
LC/MS/MS system.
Statistics
All data were analysed using GraphPad Prism. Data are presented as mean ± SEM.
Data were analysed by one-way/two-way ANOVA with post-hoc Tukey's honestly
significant difference (HSD) analysis or paired two-tailed Student's t-test
where indicated. P < 0.05 was considered significant.
Results
Reduced BMPR2 protein expression in BOECs from patients harbouring nonsense
BMPR2 mutations versus controls
BOECs were available from four patients with nonsense mutations in
BMPR2 (W9X, R213X, R321X and R584X), and one patient with a
missense mutation in the kinase domain of BMPR2 (C347R). A
further PASMC line was available from a PAH patient with a nonsense
BMPR2 mutation (R899X) (Supplementary Fig. 1 and Table 1).
BMPR2 protein expression was assessed in BOECs from control subjects and
BMPR2 mutant PAH patients. In all mutation patients, BMPR2
protein expression was significantly reduced when compared to BOECs isolated
from controls (Fig. 1a
and b). In addition, BMPR2 mRNA expression in nonsense
BMPR2 mutations was significantly reduced (Fig. 1c).
Fig. 1.
Puromycin treatment increases BMPR2 R584X mutant
transcript. (a) Protein lysates were extracted from blood outgrowth
endothelial cells (BOECs) from wild-type (n = 3)
and BMPR2 mutant (n = 5) patients. Lysates were
immunoblotted for BMPR2 and loading control, α-tubulin. (b)
Densitometry analysis of the ratio between BMPR2 and α-tubulin. (c)
BMPR2 mRNA expression of BOECs harbouring
nonsense mutations was assessed and normalised to
ACTB. (d and e) BOECs harbouring a R584X or
R321X were treated overnight with puromycin (100 mg/ml). Following
RNA isolation, amplified RT-PCR products were sequenced.
Chromatograms for R584X (d) and R321X (e) show the effects of
puromycin treatment on transcript expression. One-way ANOVA.
*P ≤ 0.05. Error bars represent mean ± SEM.
BMPR2: bone morphogenetic protein receptor type 2.
Puromycin treatment increases BMPR2R584X mutant
transcript. (a) Protein lysates were extracted from blood outgrowth
endothelial cells (BOECs) from wild-type (n = 3)
and BMPR2 mutant (n = 5) patients. Lysates were
immunoblotted for BMPR2 and loading control, α-tubulin. (b)
Densitometry analysis of the ratio between BMPR2 and α-tubulin. (c)
BMPR2 mRNA expression of BOECs harbouring
nonsense mutations was assessed and normalised to
ACTB. (d and e) BOECs harbouring a R584X or
R321X were treated overnight with puromycin (100 mg/ml). Following
RNA isolation, amplified RT-PCR products were sequenced.
Chromatograms for R584X (d) and R321X (e) show the effects of
puromycin treatment on transcript expression. One-way ANOVA.
*P ≤ 0.05. Error bars represent mean ± SEM.BMPR2: bone morphogenetic protein receptor type 2.
NMD contributes to reduced expression of mutant transcripts
The reduced mRNA and protein expression and the absence of truncated BMPR2
protein species is consistent with the mutations giving rise to an unstable mRNA
transcript that is susceptible to NMD, leading to a state of haploinsufficiency.
To assess the abundance of wild-type and mutant mRNA species, heterozygous
mutant BOECs from PAH patients were used. The relative abundance of wild-type
and mutant transcripts was assessed by sequencing of cDNA following RT-PCR. In
general, all nonsense mutations gave rise to a greatly reduced level of mutant
transcript, as evidenced by very low chromatogram signals (Fig. 1d and e; Supplementary Fig. 2a and
c). The level of mutant transcript varied between mutations with R584X showing
the highest transcript level and W9X the lowest. To demonstrate whether NMD was
contributing to the reduced mutant transcript level, BOECs were treated with
puromycin to suppress NMD. Treatment with puromycin increased transcripts of the
mutant alleles for all mutations (Fig. 1d and e; Supplementary Fig. 2a)
except W9X (Supplementary Fig. 2c). We also assessed the effect of puromycin
treatment in PASMCs harbouring a R899X mutation. The baseline R899X transcript
level was also greatly reduced, but increased following treatment with puromycin
(Supplementary Fig. 2b). In Table 2, the predominant transcript is highlighted in bold and the
relative fold-change of the mutant transcript versus the wild-type is
detailed, ± puromycin treatment.
Table 2.
Puromycin treatment of BMPR2 mutant BOECs.
Wild-type allele
Mutant allele
Puromycin negative
Ratio of M/W (fold change)
Puromycin positive
Ratio of M/W (fold change)
W9X
TGG
TGA
TGG
0.079
TGG
0.106
R213X
CGA
TGA
CGA
0.154
CGA
0.609
R321X
CGA
TGA
CGA
0.153
CGA
0.568
R584X
CGA
TGA
CGA
0.587
TGA
1.697
R899X
CGA
TGA
CGA
0.259
CGA
0.545
Note: The fold change is calculated by the ratio of the mutant
allele peak height/wild-type peak height in the appropriate
chromatograms.
Puromycin treatment of BMPR2 mutant BOECs.Note: The fold change is calculated by the ratio of the mutant
allele peak height/wild-type peak height in the appropriate
chromatograms.
PTC124 treatment improves BMPR2 protein expression and downstream signalling
in R584X cells
BOECs harbouring heterozygous R213X, R321X and R584X mutations were treated with
PTC124 (100 µM) for 24 h. BMPR2 protein expression was significantly increased
by PTC124 in R584X mutant cells but not in R213X or R321X cells (Fig. 2a and b). It is
worth noting that PTC124 had no effect upon BMPR2 protein expression in control
BOECs (Supplementary Fig. 3). Furthermore, PTC124 consistently increased Id1
protein levels as a marker of BMPR2 signalling in R584X mutant BOECs (Fig 2c and d). No effect
on Id1 levels was observed in control BOECs (Supplementary Fig. 3).
Fig. 2.
PTC124 treatment increases BMPR2 protein expression and downstream
signalling in R584X mutant BOECs. (a) BOECs isolated from patients
harbouring R213X, R321X and R584X were treated with either PTC124
(100 µM) for 24 h. Lysates were immunoblotted for BMPR2 and loading
control, α-tubulin (n = 3). (b) Densitometry
analysis of the ratio between BMPR2 and α-tubulin. (c) R584X mutant
BOECs were treated with PTC124 (100 µM) for 24 h. Representative
immunoblot for Id1 and loading control, α-tubulin
(n = 3). (d) Densitometry analysis of the ratio
of α-tubulin compared to Id1 (n = 3). Student's
t-test. *P ≤ 0.05. Error bars represent
mean ± SEM.
BMPR2: bone morphogenetic protein receptor type 2.
PTC124 treatment increases BMPR2 protein expression and downstream
signalling in R584X mutant BOECs. (a) BOECs isolated from patients
harbouring R213X, R321X and R584X were treated with either PTC124
(100 µM) for 24 h. Lysates were immunoblotted for BMPR2 and loading
control, α-tubulin (n = 3). (b) Densitometry
analysis of the ratio between BMPR2 and α-tubulin. (c) R584X mutant
BOECs were treated with PTC124 (100 µM) for 24 h. Representative
immunoblot for Id1 and loading control, α-tubulin
(n = 3). (d) Densitometry analysis of the ratio
of α-tubulin compared to Id1 (n = 3). Student's
t-test. *P ≤ 0.05. Error bars represent
mean ± SEM.BMPR2: bone morphogenetic protein receptor type 2.
Endothelial dysfunction in the R584X mutant is restored by PTC124
treatment
We next questioned whether PTC124 could restore the functional impact of
BMPR2 mutation on endothelial cells. First, we examined the
effect of PTC124 on endothelial barrier integrity. Monolayer integrity was
determined by measuring the amount of horseradish peroxidase leak into the
bottom chamber in transwell experiments. Consistent with the results of our
previous studies,[11] BMP9 treatment inhibited LPS-induced monolayer permeability in both
wild-type and BMPR2 mutant cells (Fig. 3a and b; Supplementary Fig. 4a and
b). Furthermore, the BMPR2 mutant BOECs demonstrated greater
permeability in the presence of LPS compared to wild-type cells (Fig. 4a and b;
Supplementary Fig. 4a and b). Treatment with PTC124 had no effect on monolayer
integrity after LPS stimulation in wild-type or R321X BOECs (Fig. 3a; Supplementary
Fig. 4a and b). However, in R584X BOECs, PTC124 alone significantly reduced the
LPS-induced permeability (Fig.
3b).
Fig. 3.
PTC124 treatment promotes monolayer integrity in R584X mutant BOECs.
Permeability was assessed in monolayers of wild-type (a)
(n = 3) and R584X mutant (b)
(n = 3) BOECs treated with either PTC124
(100 µM) or BMP9 (5 ng/ml) and/or LPS (400 ng/ml). Colorimetric
absorbance of HRP was measured after incubation periods every 15 min
until 1 h. One-way ANOVA. *P ≤ 0.05. Error bars
represent mean ± SEM.
PTC124 treatment prevents apoptosis and hyperproliferation in R584X
mutant BOECs. (a) Quantification of apoptotic
(Annexin-V+/PI–) wild-type
(n = 3) and R584X mutant BOECs
(n = 3) after PTC124 treatment for 24 h prior
to the addition of TNFα (10 ng/ml) and cycloheximide
(20 microgram/ml) for six hours. (b) Proliferation assessment of
wild-type (n = 3) and R584X mutant
(n = 3) BOECs after day 6, following PTC124
(100 µM) or BMP9 (5 ng/ml) treatment. One-way ANOVA.
*P ≤ 0.05, **P ≤ 0.01,
***P ≤ 0.001, ****P ≤ 0.0001.
Error bars represent mean ± SEM.
PTC: premature termination codon; BMP: bone morphogenetic
protein.
PTC124 treatment promotes monolayer integrity in R584X mutant BOECs.
Permeability was assessed in monolayers of wild-type (a)
(n = 3) and R584X mutant (b)
(n = 3) BOECs treated with either PTC124
(100 µM) or BMP9 (5 ng/ml) and/or LPS (400 ng/ml). Colorimetric
absorbance of HRP was measured after incubation periods every 15 min
until 1 h. One-way ANOVA. *P ≤ 0.05. Error bars
represent mean ± SEM.LPS: lipopolysaccharide; PTC: premature termination codon.PTC124 treatment prevents apoptosis and hyperproliferation in R584X
mutant BOECs. (a) Quantification of apoptotic
(Annexin-V+/PI–) wild-type
(n = 3) and R584X mutant BOECs
(n = 3) after PTC124 treatment for 24 h prior
to the addition of TNFα (10 ng/ml) and cycloheximide
(20 microgram/ml) for six hours. (b) Proliferation assessment of
wild-type (n = 3) and R584X mutant
(n = 3) BOECs after day 6, following PTC124
(100 µM) or BMP9 (5 ng/ml) treatment. One-way ANOVA.
*P ≤ 0.05, **P ≤ 0.01,
***P ≤ 0.001, ****P ≤ 0.0001.
Error bars represent mean ± SEM.PTC: premature termination codon; BMP: bone morphogenetic
protein.Since increased endothelial apoptosis is considered a critical response to injury
in BMPR2 mutant endothelial cells, we next examined the effect
of PTC124 treatment on apoptosis. As previously reported,[11] we observed that BOECs harbouring BMPR2 mutants
demonstrate an increased susceptibility to TNFα-induced apoptosis (Fig. 4a; Supplementary
Fig. 5a). Only BOECs with the R584X mutation showed reduced apoptosis when
treated with PTC124 (Fig.
4a). TNFα-induced apoptosis in BOECs harbouring the R321X mutation
was unaffected by treatment with PTC124 (Supplementary Fig. 5a).Finally, we assessed the hyperproliferation of mutant BOECs and the effect of
PTC124 treatment. Our group has previously shown that BOECs with
BMPR2 deficiency are hyperproliferative.[9] Both BOECs harbouring the R321X and R584X mutations exhibited
hyperproliferation when compared to wild-type BOECs (Fig. 4b; Supplementary Fig. 5b). Again,
only the R584X mutation was significantly affected by PTC124 treatment with a
similar reduction in hyperproliferation compared to BMP9 treatment (Fig. 4b). Only BMP9
treatment significantly reduced hyperproliferation in R321X mutant cells
(Supplementary Fig. 5b).
PTC124 improves BMPR2 protein expression in a R584X mouse model
Given that PTC124 exerted promising effects on endothelial function and BMPR2
protein expression in vitro, we developed a knock-in mouse harbouring a
heterozygous R584X mutation (Bmpr2) (Supplementary Fig. 6) to test the effects of PTC124 in vivo. Similar to
the findings in patient-derived BOECs, BMPR2 protein and mRNA was significantly
reduced in the Bmpr2mouse lungs compared to littermate controls (Fig. 5a, b and e). Mutant
Bmpr2 and littermate controls were fed either standard chow or chow
supplemented with 0.3% PTC124 over a two-week period. Treatment with PTC124
significantly increased BMPR2 protein expression in Bmpr2mouse lungs (Fig.
5a and d), with no effect observed in wild-type animals (Fig. 5a and c).
Furthermore, mRNA levels in either wild-type or R584X mutant animals in the
presence of PTC124 remained unaffected (Fig. 5f and g).
Fig. 5.
PTC124 treatment rescues low BMPR2 protein expression. Littermate
controls (Bmpr2) and R584X knock-in (Bmpr2) mice were randomised into two treatment groups. One group
was fed chow supplemented with PTC124 and the other group were fed a
standard chow diet for two weeks. (a) Lungs were isolated from
wild-type (Bmpr2) (n = 3); wild-type plus PTC124
(Bmpr2 + PTC124) (n = 3); R584X knock-in
(Bmpr2) (n = 3); R584X knock-in
(Bmpr2 + PTC124) (n = 3). Protein lysates were
extracted and immunoblotted for BMPR2 and loading control, α-tubulin
(n = 3). (b) Densitometry analysis of the ratio
between BMPR2 and α-tubulin in Bmpr2 versus Bmpr2. (c) Densitometry analysis of the ratio between BMPR2 and
α-tubulin in Bmpr2 versus Bmpr2 + PTC124. (d) Densitometry analysis of the ratio between
BMPR2 and α-tubulin in Bmpr2 versus Bmpr2 + PTC124. (e to g) Lungs were isolated from wild-type
(Bmpr2) (n = 7); wild-type plus PTC124
(Bmpr2 + PTC124) (n = 4); R584X knock-in
(Bmpr2) (n = 7); R584X knock-in
(Bmpr2 + PTC124) (n = 3). Bmpr2
mRNA expression was assessed and normalised to three endogenous
controls (Actb, B2m and Hprt). (h)
PTC124 levels was measured by MS/LC/LC in the serum of PTC124
treated animals at day 7 and day14. Student's t-test.
*P ≤ 0.05, **P < 0.01,
****P < 0.0001. Error bars represent
mean ± SEM.
PTC: premature termination codon; BMPR2: bone morphogenetic protein
receptor type 2.
PTC124 treatment rescues low BMPR2 protein expression. Littermate
controls (Bmpr2) and R584X knock-in (Bmpr2) mice were randomised into two treatment groups. One group
was fed chow supplemented with PTC124 and the other group were fed a
standard chow diet for two weeks. (a) Lungs were isolated from
wild-type (Bmpr2) (n = 3); wild-type plus PTC124
(Bmpr2 + PTC124) (n = 3); R584X knock-in
(Bmpr2) (n = 3); R584X knock-in
(Bmpr2 + PTC124) (n = 3). Protein lysates were
extracted and immunoblotted for BMPR2 and loading control, α-tubulin
(n = 3). (b) Densitometry analysis of the ratio
between BMPR2 and α-tubulin in Bmpr2 versus Bmpr2. (c) Densitometry analysis of the ratio between BMPR2 and
α-tubulin in Bmpr2 versus Bmpr2 + PTC124. (d) Densitometry analysis of the ratio between
BMPR2 and α-tubulin in Bmpr2 versus Bmpr2 + PTC124. (e to g) Lungs were isolated from wild-type
(Bmpr2) (n = 7); wild-type plus PTC124
(Bmpr2 + PTC124) (n = 4); R584X knock-in
(Bmpr2) (n = 7); R584X knock-in
(Bmpr2 + PTC124) (n = 3). Bmpr2
mRNA expression was assessed and normalised to three endogenous
controls (Actb, B2m and Hprt). (h)
PTC124 levels was measured by MS/LC/LC in the serum of PTC124
treated animals at day 7 and day14. Student's t-test.
*P ≤ 0.05, **P < 0.01,
****P < 0.0001. Error bars represent
mean ± SEM.PTC: premature termination codon; BMPR2: bone morphogenetic protein
receptor type 2.To confirm that mice provided with PTC124 chow attained plasma levels of PTC
consistent with a pharmacological effect,[24] blood samples were taken at 7 and 14 days for measurement of PTC124 using
mass spectrometry. Both mutant and control animals had similar levels of PTC124
at 7- and 14-days treatment (Fig. 5h). PTC124 levels was undetectable in control animals fed
standard chow (<0.02 µg/ml).No differences were identified in either right ventricular systolic pressure, RVH
or vascular remodelling at six months of age (Supplementary Fig. 7a, b and c).
Interestingly, during the breeding of this mouse line, we noted that parental
heterozygous mating occasionally gave rise to homozygous Bmpr2mice. Given that homozygous Bmpr2–/– usually
die in utero, this further suggests that the R584X mutation may have a lower
impact on BMPR2 function than other mutations.[33]
PTC124 inhibits hyperproliferation in Bmpr2+/R584X PASMCs
One well recognised phenotype of human and mouseBMPR2 mutant
PASMCs is heightened proliferation in serum.[34,35] Consistent with this,
PASMCs derived from Bmpr2mice exhibited increased cell number in the presence of serum after six
days in culture (Fig.
6). Culture of Bmpr2 PASMCs in the presence of PTC124 effectively attenuated the
hyperproliferation, with no impact on the proliferation rate of PASMCs from
wild-type mice.
Fig. 6.
Bmpr2 PASMCs hyperproliferation is rescued by PTC124 treatment.
Mouse PASMCs were isolated from lungs of wild-type or R584X mutant
animals. Proliferation assessment of Bmpr2 (n = 3) and Bmpr2 (n = 3) PASMCs after day 6, following PTC124
(100 µM) treatment. One-way ANOVA. *P ≤ 0.05. Error
bars represent mean ± SEM.
PTC: premature termination codon; BMPR2: bone morphogenetic protein
receptor type 2.
Bmpr2 PASMCs hyperproliferation is rescued by PTC124 treatment.
Mouse PASMCs were isolated from lungs of wild-type or R584X mutant
animals. Proliferation assessment of Bmpr2 (n = 3) and Bmpr2 (n = 3) PASMCs after day 6, following PTC124
(100 µM) treatment. One-way ANOVA. *P ≤ 0.05. Error
bars represent mean ± SEM.PTC: premature termination codon; BMPR2: bone morphogenetic protein
receptor type 2.
Discussion
Nonsense mutations account for approximately 30% of BMPR2 mutations
underlying heritable PAH.[16] We have previously proposed that correcting premature stop codons introduced
by these mutations might be an approach to treat patients with PAH who carry these mutations.[27] Ataluren (PTC124) has been used in clinical trials in the treatment of CF and
DMD promoting translational read-through of truncating mutations in CF transmembrane
conductance regulator (CFTR) and dystrophin, respectively.[24-26] Our findings suggest that
nonsense mutations in BMPR2 that lead to the introduction of a PTC
trigger robust NMD and do not lead to the expression of a truncated BMPR2 protein.
In fact, the impact of NMD is such that the mutant BMPR2
transcripts are generally expressed at a very low level. This is of major importance
for therapeutic approaches, such as PTC124, that act by enhancing translational
read-through of the mRNA. In the absence of BMPR2 mRNA, these drugs
lack the substrate to initiate ribosomal translation into protein. Nevertheless, we
identified at least one BMPR2 mutation, R584X, that demonstrated
measurable levels of mRNA. In this specific case, we were able to show that PTC124
increased the expression of BMPR2 protein and downstream signalling both in vitro
and in vivo.We have previously established a number of functional assays such as vascular
permeability, apoptosis and proliferation to test the effectiveness of BMP9
treatment on endothelial cell function.[11] Using these methods, we assessed the ability of PTC124 to rescue the R584X
mutant BOECs. We compared cells harbouring the R584X mutation with BOECs expressing
R321X, a BMPR2 mutation that previously showed little or no
increase in BMPR2 protein expression following PTC124 treatment. Both cell lines
exhibited increased vascular permeability compared to the wild-type controls in the
presence of LPS which was abrogated by BMP9 treatment. Only cells expressing R584X
mutation responded to PTC124 treatment. Of note, no differences were observed with
combined BMP9 and PTC124 treatment. Furthermore, the significant increase in
apoptosis in both mutant cell lines was only normalised by PTC124 treatment in the
R584X BOECs. Similarly, the hyperproliferation phenotype of both
BMPR2 mutants was only corrected by PTC124 in the R584X mutant
line. Interestingly, BMP9 attenuated the increased proliferation in both
BMPR2 mutant cells.Given these findings, a knock-in R584Xmouse model was established. Unfortunately, a
lack of haemodynamic or vascular remodelling phenotype was observed in the model.
Our experience with other genetic mouse models such as the C118W knock-in mouse, the
R899X knock-in, or Bmpr2 heterozygous null mouse is that these
animals develop mild or no pulmonary hypertension, sometimes age-related, but do
exhibit morphological evidence of pulmonary vascular remodelling.[11,34,36] Therefore, the
lack of a pulmonary hypertension phenotype in the Bmpr2mouse model is not unexpected. It was more surprising that the mouse
exhibited no evidence of pulmonary vascular remodelling. One explanation is that the
deficiency of Bmpr2 in this mouse is less profound than in other
Bmpr2 deficient models. This is supported by the appearance of
homozygous Bmpr2mice in our breeding colony. Nevertheless, the Bmpr2mouse proved a useful model to demonstrate proof-of-concept and target
engagement in the presence of PTC124. Correction of molecular phenotypes was
observed in these animals in the presence of PTC124. First, PTC124 was administered
in the diet and serum levels indicated therapeutic levels of the drug at weeks 1 and
2 post administration in both wild-type and Bmpr2mice. Similar to our in vitro observations in human BOECs, Bmpr2 protein and
mRNA expression was significantly reduced in the mutant animals. Treatment with the
PTC124 significantly enhanced Bmpr2 protein expression. Furthermore, PTC124 reduced
the hyperproliferation of PASMCs isolated from the R584X mutant mouse model.It appears that PTC124 may have a limited therapeutic role for PAH patients
harbouring nonsense mutations in BMPR2. The reasons for this could
include the efficiency of NMD triggered by these different mutations. The
disease-causing PTC mutations we investigated were localised to four domains of the
BMPR2 protein – extracellular, transmembrane, kinase and cytoplasmic tail domain.
However, the impact and efficiency of NMD are hard to predict. The most commonly
proposed mechanism of NMD is the canonical exon junction complex (EJC)
model.[37,38] Ordinarily, EJC proteins bind at exon–exon junctions until they
are stripped from mRNAs by the translating ribosome following nuclear export.
However, if a PTC is present 50 nucleotides upstream of the last exon boundary, then
the EJC remains bound triggering NMD. A proposed exception to this model occurs when
PTC transcripts in close proximity to the start codon circumvent NMD by reinitiating
translation.[39,40] Lindeboom and colleagues used matched exome and transcriptome
data from over 9000 humantumours to further understand the principles governing NMD.[41] First, in the humantumour data, the NMD efficiency correlated with the
proximity of the PTC to the start codon and the last exon.[41] Second, significant reduction in NMD was observed in PTCs that were found in
the extremely long exons. Furthermore, the distance between PTC and the downstream
exon junction leads to lower degradation rates.[41] Applying the rules to the PTC mutations we tested in BMPR2 may go some way to
deciphering why R584X is more susceptible to treatment with PTC124. All mutations
tested were 50 nucleotides upstream of the last exon boundary. Only R584X and R899X
are located in an exceptionally long exon (exon 12), and the R584X mutation is
furthest away from the normal translational stop codon. Therefore, this could make
the R584X mutation more likely to be less efficient at NMD.DMD is caused by mutations in the dystrophin protein. More than 7000 mutations are
associated with either DMD or Becker muscular dystrophy.[42] As the largest human gene, DMD is susceptible to a high mutation rate, which
underlies the large variation of mutations detected in the gene. The majority of DMDpatients have deletions or duplications in one or more exons, but a small proportion
of patients are due to small insertions or deletions (∼20%) with a number due to
nonsense mutations inserting a premature stop codon with approximately ∼10% of
dystrophinopathies due to nonsense mutations.[43] In a phase 2b controlled trial, PTC124 was shown to slow disease progression,
in boys ≥5 years with a nonsense mutation dystrophinopathy, using the six-minute
walk distance (6MWD) as the primary endpoint.[44] However, in a subsequent phase 3 randomised, double-blinded trial with
PTC124, there was no significant difference between the placebo and treated groups
based on 6MWD.[45] However, the authors of this study proposed that clinical significance was
reached in a subgroup of patients. The authors concluded that ongoing trials should
be conducted to assess the long-term benefits and safety of PTC124.The efficacy of PTC124 has been assessed in CF. In approximately 5–10% of CF
patients, nonsense mutations in the gene encoding the CFTR are causative of disease[46] and exhibit a severe clinical phenotype.[47] A preclinical investigation suggested that PTC124 improved the generation of
functional CFTR in an animal model of CF due to a nonsense mutation (G542X).[48] Also, a short-term proof-of-concept trial in patients with nonsense mutations
improved epithelial electrophysiological abnormalities caused by dysfunctionalCFTR.[25] An extended 12-week study with PTC124 in 19 patients with at least one CFTR
nonsense mutation improved total chloride transport.[26] Furthermore, improved CFTR function was associated with improved pulmonary
function and reduced CF-related coughing. However, in 2017, PTC therapeutics
abandoned a 48-week phase 3 clinical trial as the two primary endpoints were un-met.[49]Overall, the clinical trials for both CF and DMD provided inconclusive evidence for
the effectiveness of PTC124 as a therapy. However, every study reported that the
drug was well tolerated with few toxic side effects. As discussed above, the rules
governing NMD are complex and efficiency depends on the location of the PTC in the
gene. As we have shown in this study, it is possible that PTC124 could provide
benefit to a specific subset of PAH patients where NMD is less efficient. For
example, apart from R584X, there are seven nonsense mutations (Y543X, R597X, Q657X,
E661X, E672X, Y708X and Q720X) in exon 12 of BMPR2 that might be
benefited by drugs that enhance translational read-through.[3,17,50] The availability of BOECs
derived from patients provides an opportunity to test in vitro whether individual
BMPR2 mutations might benefit from PTC124. This approach could
be used as a biomarker in experimental medicine studies and to select patients for
inclusion in clinical trials.
Table 1.
Demographics of BMPR2 mutant BOECs.
Gender
Age
Ethnicity
mPAP
W9X
Female
35
Caucasian
65
R213X
Female
36
Asian
40
R321X
Male
45
Caucasian
46
R584X
Female
79
Caucasian
52
R899X
Female
30
N/A
N/A
C347R
Male
27
Caucasian
N/A
Demographics of BMPR2 mutant BOECs.Click here for additional data file.Supplemental material, sj-pdf-1-pul-10.1177_2045894020935783 for Targeting
translational read-through of premature termination mutations in
BMPR2 with PTC124 for pulmonary arterial hypertension by Lu
Long, Xudong Yang, Mark Southwood, Stephen Moore, Alexi Crosby, Paul D. Upton,
Benjamin J. Dunmore and Nicholas W. Morrell in Pulmonary Circulation
Authors: K M Dent; D M Dunn; A C von Niederhausern; A T Aoyagi; L Kerr; M B Bromberg; K J Hart; T Tuohy; S White; J T den Dunnen; R B Weiss; K M Flanigan Journal: Am J Med Genet A Date: 2005-04-30 Impact factor: 2.802
Authors: J P Clancy; Z Bebök; F Ruiz; C King; J Jones; L Walker; H Greer; J Hong; L Wing; M Macaluso; R Lyrene; E J Sorscher; D M Bedwell Journal: Am J Respir Crit Care Med Date: 2001-06 Impact factor: 21.405
Authors: Xudong Yang; Lu Long; Mark Southwood; Nung Rudarakanchana; Paul D Upton; Trina K Jeffery; Carl Atkinson; Hailan Chen; Richard C Trembath; Nicholas W Morrell Journal: Circ Res Date: 2005-04-21 Impact factor: 17.367
Authors: Stefan Gräf; Matthias Haimel; Marta Bleda; Charaka Hadinnapola; Laura Southgate; Wei Li; Joshua Hodgson; Bin Liu; Richard M Salmon; Mark Southwood; Rajiv D Machado; Jennifer M Martin; Carmen M Treacy; Katherine Yates; Louise C Daugherty; Olga Shamardina; Deborah Whitehorn; Simon Holden; Micheala Aldred; Harm J Bogaard; Colin Church; Gerry Coghlan; Robin Condliffe; Paul A Corris; Cesare Danesino; Mélanie Eyries; Henning Gall; Stefano Ghio; Hossein-Ardeschir Ghofrani; J Simon R Gibbs; Barbara Girerd; Arjan C Houweling; Luke Howard; Marc Humbert; David G Kiely; Gabor Kovacs; Robert V MacKenzie Ross; Shahin Moledina; David Montani; Michael Newnham; Andrea Olschewski; Horst Olschewski; Andrew J Peacock; Joanna Pepke-Zaba; Inga Prokopenko; Christopher J Rhodes; Laura Scelsi; Werner Seeger; Florent Soubrier; Dan F Stein; Jay Suntharalingam; Emilia M Swietlik; Mark R Toshner; David A van Heel; Anton Vonk Noordegraaf; Quinten Waisfisz; John Wharton; Stephen J Wort; Willem H Ouwehand; Nicole Soranzo; Allan Lawrie; Paul D Upton; Martin R Wilkins; Richard C Trembath; Nicholas W Morrell Journal: Nat Commun Date: 2018-04-12 Impact factor: 14.919
Authors: Imbisaat Geti; Mark L Ormiston; Foad Rouhani; Mark Toshner; Mehregan Movassagh; Jennifer Nichols; William Mansfield; Mark Southwood; Allan Bradley; Amer Ahmed Rana; Ludovic Vallier; Nicholas W Morrell Journal: Stem Cells Transl Med Date: 2012-11-29 Impact factor: 6.940
Authors: Benjamin J Dunmore; Rowena J Jones; Mark R Toshner; Paul D Upton; Nicholas W Morrell Journal: Cardiovasc Res Date: 2021-09-28 Impact factor: 10.787