Genetic characterization of a new radish introgression line carrying the restorer gene for Ogura CMS in Brassica napus.

Creating a homologous restorer line for Ogura cytoplasmic male sterility (Ogu-CMS) in Brassica napus is meaningful for the wider application of Ogu-CMS system in rapeseed production. Previously, an independent development of a new Ogu-CMS restorer line (CLR650) was reported locally from crossing between Raphanobrassica (AACCRR, 2n = 56) and B. napus and a new version of Ogu CMS lines CLR6430 derived from CLR650 was characterized in this study. The results showed that the fertility restoration gene in CLR6430 presented a distorted segregation in different segregating populations. However, the majority of somatic cells from roots had a regular chromosome number (2n = 38) and no radish signal covered a whole chromosome was detected using GISH. Thirty-two specific markers derived from the introgressed radish fragments were developed based on the re-sequencing results. Unique radish insertions and differences between CLR6430 and R2000 were also identified through both radish-derived markers and PCR product sequences. Further investigations on the genetic behaviors, interactions between the fertility restoration and other traits and specific molecular markers to the introgression in CLR6430 were also conducted in this study. These results should provide the evidence of nucleotide differences between CLR6430 and R2000, and the specific markers will be helpful for breeding new Ogura restore lines in future.

Introduction

Cytoplasmic male sterility (CMS) is a widespread inherited trait in plants, which is controlled by an incompatibility between the nucleus and mitochondrial genes and has been widely used for F1 seed production. Some CMS systems have been identified in B. napus, such as Polima CMS (pol CMS) [1], Ogura CMS (ogu CMS) [2], the common B. napus CMS (nap CMS) [3], and a novel type introgressed from Chinese woad (inap CMS) [4]. Ogu CMS was first discovered in Japanese radish (Raphanus sativus) from an unknown cultivar (Ogura 1968), and the sterility of ogu CMS was stable in various climate conditions [5], which used widely in hybrid breeding of important Brassica crop worldwide..

Creation of the corresponding restore lines in oilseed Brassicas could achieve three-line breeding system in rapeseed which is widely applied in the industry, however the whole process has been difficult as the restorer gene (Rf) only existed in some Europe and Japanese wild radish, but not in B. napus nor any B. rapa varieties. Therefore, the Rf gene had to be introduced from radish into oilseed rape through intergeneric hybridization. Homoeologous recombination between R and A or C genome were achieved through polyploidy cross [6], gamma irradiation of donor pollen [7], or asymmetric protoplast fusion [8]. However, along with the introduction of the Rfo gene into B. napus, extra segments of radish genome was introgressed into B. napus which brought undesirable traits for breeders, such as elevated glucosinolate level and poor seed set (the number of seed per silique) [9]. The early version of Brassica Ogu restorer lines developed by INRA identified a close linkage between glucosinolate content and the Rfo gene [10], suggesting more difficulties in breeding double low cultivars. Therefore, following research was dedicated for the improvement of the restorer line. Delourme [11] reported a low glucosinolate (9–18 μmol/g) Ogu-CMS restorer line in B. napus assisted by RAPD markers, however the Rfo loci was heterozygous and not heritable to siblings. Successful break-through of low glucosinolate Ogu-CMS restorer line was obtained through gamma radiation when crossing with B. napus of low glucosinolate content, and named as R2000 [7, 11]. Other independent breeding of B. napus Ogu restorer line using radiation or other methods were reported by Pioneer Hi-bred Company and Syngenta Biotechnology Company [12-14], with shortened radish fragment in new generations.

The Rfo gene, orf687, encoding a 687-amino-acid protein with multiple pentatricopeptide repeats, alters the expression of the sterile gene orf138 at post-transcriptional level [15, 16]. The gene has been localized physically and mapped in the distal region on linkage group N19 in Pioneer-derived Ogu-CMS restorer line, which corresponds to the C genome in B. napus [17]. Moreover, apart from the identified Rfo gene [15], other alleles were identified by Wang et al [18,19] and was 1.6 cM distant from Rfo locus in Ogu-CMS radish. Further investigations of these alleles revealed a heterozygous type (RsRf3-1/RsRf3-2) encoding PPR proteins were responsible for the fertility of male-sterile radish, and had higher expression and RNA polymerase II occupancy compared with their homozygous alleles (RsRf3-1/RsRf3-1 or RsRf3-2/RsRf3-2) [20]. However, those new identified alleles were studied only in radish. Therefore, associations between these alleles and the Rfo gene and their independent functions when transferring into B. napus remain unclear.

The introgression of the Rfo gene from radish into rapeseed also introduced chromosomes or large amount of radish genome fragments around the Rfo locus and possibly elsewhere in the genome. The redundant introgressions are more likely to lead to deleterious genetic characteristics such as poor agronomic performance, increased glucosinolate content, and distorted segregation. The type of cross and mapping population can influence the incidence of genomic regions exhibiting distorted segregation, not to mention the exogenous introgressed or inserted material. However, not many studies linked this aspect to the radish-derived Ogu CMS in B. napus, the genetic behaviors of Ogu CMS restorer line as pollen donor or accepter remains unclear and is worthy of investigation. Moreover, molecular marker assisted breeding has been applied throughout the breeding history of Ogu-CMS restorer line in Brassica family [11, 21–23]. Rfo specific markers in canola were developed by Hu et al [21], while Tian et al [22] and Yu et al. [23] applied to B. juncea and B. oleracea respectively, enabling previse selection for low glucosinolate within larger population.

Previously we reported a newly-developed Ogu-CMS restorer line (CLR650) from crossing between Raphanobrassica (AACCRR, 2n = 56) and B. napus using grafting to overcome the incompatible obstacle between these two parents [24]. Further analysis of the updated version of material (CLR6430) developed using the restorer CLR650 through backcross with double-low line and self-pollination was conducted in this study to investigate the chromosomal behaviors and fertility ability. Resequencing was also applied to CLR6430 to explore the detailed information during the introgression from radish fragment into B. napus, enabling more precise designs for marker-assisted breeding for the new Ogu-CMS restorer lines application.

Materials and methods

Plant material

Using Raphanobrassica (AACCRR, 2n = 56) as the donor of Ogu CMS restorer resource, we successfully obtained the hybrids of Brassica with Raphanobrassica through grafting to overcome the incompatible obstacle between these two parents. After 15 years with high intensive selection, a stable homozygous restorer line CLR650 of Ogu CMS in B. napus was bred which can restore the male fertility of progenies from self-pollination and testcross [24]. A new version of Ogu CMS restore lines CLR6430 derived from CLR650 through 2 generations of backcross with double low line 20B and then 4 generations of self-pollination.

Segregating populations preparation and fertility identification

Two Ogu CMS sterility lines (A-line) 20QA and SC3QA (rfrf) were taken as females and crossed with CLR6430 respectively and selfing for F2 and F3 to generate two segregating populations. These two lines were also utilized for back-cross (BC1-2) populations and selected for low glucosinolate content concurrently. Reciprocal crosses were conducted between CLR6430 and a general selfing line 20B (The maintainer line of 20QA) and SC3 (The maintainer line of SC3QA).

The fertility identification of all segregating populations was performed around 11 AM on sunny days during flowering stage of plants three times using 1% acetocarmine under a microscope (DS-Ril, Nikon, Japan). And a F2 population of 192 individuals derived from the cross of 20QA×CLR6430 was used for DNA marker testing.

Chromosome detection

Newly-germinated seed roots and ovaries from young flower buds were used to determine the chromosome numbers of CLR6430. The first 2–3 mm root tips and ovaries were treated with 2 mM 8-hydroxyquinoline for 3–4 h at room temperature and fixed in ethanol: acetic acid (3:1, v/v) before stored at -20°C. Well-separated chromosome slides were used for chromosome counting (DS-Ril, Nikon, Japan) and then stored for further genomic and fluorescence in situ hybridization (GISH) and fluorescence in situ hybridization of bacterial artificial chromosome (BAC-FISH).

GISH and BAC-FISH analysis

Plant DNA was extracted from the newly-grown young leaves using DNeasy Plant mini Kit (Qiagen, Hilden, Germany). The BAC clone of restorer gene used CopyControl™ pCC1BAC™ (Hind III Cloning-Ready) Vector, and the concentration of chloramphenicol resistance was 12.5μg/mL, with average 95kb inserted in the constructed library. The C genome of Brassica napus and BAC clone was labeled by random priming with biotin-11-dUTP (Sabc, China) and digoxigenin-11-dUTP (Roche, Basel, Switzerland). The A genome of B. napus was sheared by boiling for 15 min and used as a block.

The photographs of well-separated chromosome slides were taken under the fluorescence microscopy following the methods describing by Ge and Li [25].

Collection of re-sequencing sample, DNA extraction and sequencing

Seeds from CLR6430 line (46608, double confirmed with restorer gene) were sown in pots and grow to seedling stages (with 3–4 leaves) before fresh leaf samples were taken for whole genome sequencing (Shanghai OE Biotech. Ltd, China).

The DNA was extracted using DNeasy plant mini kit (Qiagen, Hilden, Germany). The quality and concentration of DNA were tested before digested into fragments.

The library was prepared using TruSeq DNA LT Sample Prep kit (Illumina, SanDiego, CA, USA) with pair-end method.

Sequencing assembly and mapping

Fragmented DNA sample (300–500 bp) with acquired concentration was sequenced using Illumina HiSeq platform. The Illumina reads generated in this study are available at the website (http://www.ncbi.nlm.nih.gov/sra/SRP159151) with the accession number 46608_4.

After separation of the raw sequence data according to the library-specific barcodes, read qualities of the sequences were initially checked using qualimap (http://qualimap.bioinfo.cipf.es/), and preprocessed by removing low-quality reads (Q20 < 70%), non-ATCG reads and short sequence reads (< 70 bp). After pre-processing, the reads were aligned against the B. napus reference genome v4.1 allowing default mismatches [26].

A BLAST search was performed against the Rfo gene sequences (GeneBank Accession AJ550021) and revealed that the Rfo gene had high sequence identity (over 90%) with certain regions of the linkage group R9 in R. sativus, leading further analysis conducted combined with both B. napus and R9 from R. sativus. Clean reads were then aligned into self-generated reference genome which combine whole genome of B. napus and R9 from radish using software BWA-MEM [27]. The coverage and depth of the reads aligned into R9 from radish were analyzed for the homologous regions that introgressed from R9 into B. napus.

Development of specific markers for CLR6430

Based on previous BLAST search results the scaffolds identified from aligned sequences in R9 from radish in reference genome with average coverage over 115 and homologous to R9 from radish were used for developing specific markers for CLR6430. Eighty specific simple sequence repeat (SSR) primer pairs were designed based on the Raphanus fragment introgresssed using online marker design website:http://200.137.197.254/~wellington/websat/. The presence of the Ogu CMS and fertility restoration—were verified in every cross generation by PCR. Genomic DNA was extracted from young leaves of field-grown plants, using the cetyltrimethylammonium bromide (CTAB) methods [28].

Each PCR was performed in 96-well PCR plates, with each reaction containing 10-20ng/μl of genomic DNA, 1X standard PCR buffer, 2.5mM MgCl2, 0.1mM dNTP, 1.0 unit Taq polymerase, 0.125μM of forward and reverse primers. PCR amplification used the following cycling parameters: 1 cycle of 5 min at 95°C; 10 cycles of 30s at 94°C,45s at 60°C (next cycle is reduced by 0.5°C), 30s at 72°C, then followed by 30 cycles of 30s at 94°C, 45s at 55°C, 30s at 72°C and ending with 10 min at 72°C). All PCR products were analyzed by electrophoresis in 3.0% agarose gel in 1×TAE buffer and were visualized by ethidium bromide on a digital gel documentation system.

Analysis of markers in the radish introgression

The specific markers were used to compare CLR6430 with the known rapeseed restorer R2000 [7]. And a radish cultivar “Baiyuchun” was used as the radish comparison. Parts of PCR amplification products were sequenced by Sanger sequencing, and the consensus sequences amplified from the CLR6430 and R2000 were aligned using DNAman ver3.0 (Lynnon BioSoft, Quebec, Canada).

Results

Fertility segregation identification

Ogu CMS A-lines 20QA and SC3QA were crossed with the restorer line CLR6430 (20QA×CLR6430 and SC3QA×CLR6430) and then selfed for F2 and F3. Fertility and sterility ratio of tested plants in both F2 and F3 population were closely to 1:2 (Table 1), segregated from the expected 3:1. Similarly, reciprocal crosses were conducted between CLR6430 and 20B and SC3, and fertility and sterility ratio in the backcross population also segregated from expectation, matched closely to 1:4 (Table 2) which distorted from the expected 1:1 ratio. Distorted segregation happened in each population possibly due to the introgressed fragment from radish, causing abnormal segregation of translocated chromosome of B. napus during meiosis. Meanwhile, there was no significant difference between the populations from reciprocal crosses [A(rfrf) × A(Rfrf)] and [A(Rfrf) × B(rfrf)], indicating no difference of the restorer gene (Rfo) passing through male or female donor. However, Rfo-specific markers matched precisely to their fertility status in both segregating population (F2 and F3) and back-crossing population (BC1-n), indicating the fertility results from segregating populations were reliable.

Table 1

Fertility and sterility results of the offspring crossing with CLR6430 in selfing segregating populations.

Population	Generation	F1 Female	Total	Fertility	Sterility	χ2(P) for 1:2
A (Rfrf) selfing	F2	20QA-1	102	38	64	0.71
		SC3QA-1	139	49	90	0.23
	F3	20QA-1	172	61	111	0.35
		20QA-2	202	72	130	0.49
		SC3QA-1	158	51	107	0.08
		SC3QA-2	175	53	122	0.73

Table 2

Fertility and sterility results of the offspring crossing with CLR6430 in backcrossing segregating populations.

	Crossing	Recurrent parent	Total	Fertility	Sterility	χ2 (P) for 1:4
A(rfrf) test crossing	A(rfrf)×A(Rfrf)	20QA-1	158	31	127	0.01
		20QA-2	207	41	166	0
		SC3QA-1	179	36	143	0
		SC3QA-2	120	25	95	0.05
	A(Rfrf)×B(rfrf)	20B-1	158	28	130	0.51
		20B-2	243	52	191	0.3
		SC3-1	189	37	152	0.02
		SC3-2	195	42	153	0.29

Chromosome number and radish genome introgression

Chromosome numbers were determined in more than 30 individuals of CLR6430. Majority of somatic cells (>82%) in roots had 2n = 38, ranging around 38–40 (Fig 1). The radish introgression was detected using GISH with radish genomic probe and B. napus genome as block (Fig 2a and 2b). Significant and stable red fluorescent signals were detected near centromere and satellite regions of several chromosomes, while no red signals were covered as a whole chromosome, showing CLR6430 was introgressed with radish genome without additional radish chromosome.

Fig 1

Chromosome determination of CLR6430 under 40×microscope.

More than 82% of detected chromosome numbers were 2n = 38 of 30 plants from two generation of CLR6430. Scale bar = 10 μm.

Fig 2

Fluorescent in situ hybridization (FISH) analysis of radish-derived Ogu CMS restorer of B. napus (CLR6430).

DAPI (blue) and merged signals (red signals from R.sativus probe) from somatic cells are shown in (a) and (b). (a) CLR6430 using 10×B. napus genome as block; (b) CLR6430 using 20× B. napus genome as block; (c) DAPI (blue) and merged (red signals from C genome of B. napus and green signals from restorer gene directed by arrows) from anther of CLR6430 is shown. Scale bar = 10 μm.

Restorer gene was detected by FISH using C genome and BAC as fish probe while A genome of B. napus was as block (Fig 2c). Green signals were detected consistently in A genome not C genome of B. napus, which is different from previous restorer lines (7, 21, 23).

Re-sequencing of CLR6430 and its genomic assembly

In total, we obtained 134.338 Gb of pair-end sequencing data with a high-quality base ratio of 98.2%, and 71.6% of the reads aligned to the reference with an average coverage of more than 50X (Table 3). While de novo assembling using SOAPdenovo2, all reads were assembled into 568,120 scaffolds and 641,453 contigs (sequence reads >500 bp were summarized).

Table 3

Basic sequencing results of CLR6430.

	R1-fastq	R2-fastq
Total reads number	447,797,399	447,797,399
Clean Reads	430,273,428	430,273,428
Clean reads ratio	96.09%	96.09%
Total base number	67169609850(67.169G)	67169609850(67.169G)
Base number in clean reads	64541014200(64.541G)	64541014200(64.541G)
High quality base number in clean reads	64031420594(64.031G)	62812421023(62.812G)
High quality base ratio in clean reads	99.21%	97.32%

Specific molecular marker development

The re-sequencing mapping and alignment results revealed homologous reads derived from R9 in radish assembled into R9 of “reference genome” and the average coverage of the region between 66.13 (Rsa1.0_00994.1) and 138.53cM (Rsa1.0_00176.1) was over 115, much higher than the other regions in R9 group, indicating a high possibility of introgressed fragment from radish into CLR6430. The sequences of this region were then used for developing specific molecular markers in the F2 segregating population (Fig 3). Considering the conservation and variability of SSR markers between the two species, sequences from introgressed fragment were used to develop SSR markers for marker-assisted breeding. Eighty specific SSR markers were developed initially and thirty-two were tested as positive in fertile plants while negative in sterile plants. They were further verified using F2 segregating population and obtained consistent results in correspondence with their fertility conditions in the field. Detailed information of specific SSR markers (Table 4) and sequence of amplified PCR products from Table 4 were presented in Additional Table 1.

Fig 3

PCR products amplified by specific SSR markers CLR9-16 in F2 segregating population.

“S” and “F” refer to the samples identified with sterility or fertility during flowering time.

Table 4

Specific primer pairs designed from the introgressed region from radish in CLR6430.

Marker Name	Forward(5’→3’)	Reverse(5’→3’)	Size of Product (bp)
CLR9-1	GAACTTATGGCACTCCGATCTC	CGAAGCAAGTAAGAAACACACG	323
CLR9-2	GGTCATTTTCTTCCTTGATAGC	ATATAACTAGGTGTTTTGCCCG	354
CLR9-3	ATATCGCACGGGTTCCTTAC	CATCCATCAGTTCAATCGGTTA	439
CLR9-4	TGTTAAAACCGAGGGAAAAGAG	TCTGCACTTGGGTCACTACAAT	364
CLR9-5	CGTAGGGCAGCTTTGATTTTAG	GCTTGTACGCTTCTTCCAGATT	367
CLR9-6	AAAGAAGTCTCGCCTGAACAAG	ATGAGAATGGCTAGTCCGGTTA	349
CLR9-7	AAGAGAAAACCAGAGCGACAAG	GCAGCGATAGGAAATTGGATAA	364
CLR9-8	GCAGCGATAGGAAATTGGATAA	AAGAGAAAACCAGAGCGACAAG	374
CLR9-9	CGAACAGAATTGAAACCGAAC	GTTGTACGTCTTCCACTTTCCC	392
CLR9-10	CAGAAGCAAGTCGAGAGAGACA	AGGAACCGACATTCAGAGAGAG	348
CLR9-11	TATAAAACCTGGGGATTGTTGC	AATTAACCTTGTCGGGTGAAGA	369
CLR9-12	AAATGCCTTCCTTGATAACTGG	CGAAGATTTCATTGCTGATACG	360
CLR9-13	TGGTGGTGTCTCAAAATGGTA	CATGGTACTCCTGAGCTTATTTG	385
CLR9-14	TGCTTTGTATTCATCTCTCCCC	CGACTCTTCAATGTGCATCTCT	367
CLR9-15	TGCTAGGGTTCCTCTGGATCT	TCTCCTTCAAAGCAATCTCTCC	366
CLR9-16	CTGAGAGGATCATGTTTTGTGC	GCAGAGACTTCTTCACCGTCTT	311
CLR9-17	CTTTATCTGCTTCTGCTGTTGC	TTTCTCCCTGATGACCTTTTGT	346
CLR9-18	AATAGCTTCCTCACCTGTCACC	GGTTTAGACGGCACCTAGTCAG	346
CLR9-19	TGCATACAAACCGAGAATCA	CGGTCTAACATATTGCACATTC	343
CLR9-20	GGACAAACAAGGATGGAGTTTC	CCAAATCTGAATGCGAGAGAAT	535

Comparison of the introgression between CLR6430 and R2000 with markers

The above-mentioned 32 markers were used to characterize the CLR6430 in comparison with R2000. The minimum size of the introgressed fragment in CLR6430 was estimated at 72.14 CM (between Rsa1.0_00994.1 and Rsa1.0_00071.1). Comparison to CLR6430, R2000 had five continuously lost markers (CLR9-20, CLR9-21, CLR9-26, CLR9-27, CLR9-30,) (Table 5), estimating the introgressed region about 48.48 CM (between Rsa1.0_00994.1 and Rsa1.0_00045.1). And the size of fragments amplified by primers pairs CLR9-1, CLR9-6, CLR9-7, CLR9-10 and CLR9-31from CLR6430 and R2000 were different. Besides, the amplified PCR sequences by the new developed SSR markers in this study revealed significant differences between CLR6430 and R2000, presenting various sequence insertion, deletion and replacements (Fig 4).

Table 5

Specific marker comparison for CLR6430, R2000 and radish in this study.

“+” and “-” were used to describe the results as positive or negative. “Baiyuchun” was the name of a radish cultivar.

Radish genome	Region (cM)	Marker Name	Scaffold Number	CLR6430	R2000	Baiyuchun	Note
R9	66.13	CLR9-32		-	-	+
R9	66.97	CLR9-31		+	+	+
R9	72.64	CLR9-13		+	+	+
R9	74.73	CLR9-11	Scaffold510	+	+	+
R9	76.06	CLR9-33		+	+	+
R9	76.06	CLR9-34		+	+	+
R9	84.38	CLR9-10		+	+	+
R9	93.38	CLR9-14	Scaffold4378	+	+	+	Rfo region
R9	93.38	CLR9-1	Scaffold662 Scaffold33209 Scaffold42248 Scaffold61106 Scaffold176555 Scaffold251659	+	+	+	Rfo region
R9	93.38	CLR9-2		+	+	+	Rfo region
R9	93.38	CLR9-3	Scaffold80976	+	+	+	Rfo region
R9	93.38	CLR9-4	Scaffold66484	+	+	+	Rfo region
R9	93.38	CLR9-5	Scaffold6789 Scaffold208888	+	+	+	Rfo region
R9	93.38	CLR9-22		+	+	+	Rfo region
R9	93.38	CLR9-23	Scaffold80	+	+	+	Rfo region
R9	93.38	CLR9-6	Scaffold80 Scaffold100822	+	+	+	Rfo region
R9	93.38	CLR9-7	Scaffold80 Scaffold214757	+	+	+	Rfo region
R9	93.38	CLR9-8	Scaffold80 Scaffold214757	+	+	+	Rfo region
R9	93.38	CLR9-9	Scaffold80	+	+	+	Rfo region
R9	94.92	CLR9-24		+	+	+
R9	94.92	CLR9-25		+	+	+
R9	103.77	CLR9-15	Scaffold10090 Scaffold111532	+	+	+
R9	115.45	CLR9-16	Scaffold7186 Scaffold53692	+	+	+
R9	115.45	CLR9-17	Scaffold62	+	+	+
R9	115.45	CLR9-18	Scaffold4699	+	+	+
R9	115.45	CLR9-19	Scaffold62	+	-	+
R9	118.34	CLR9-20		+	-	+
R9	119.83	CLR9-21		+	-	+
R9	120.43	CLR9-26	Scaffold13452	+	-	+
R9	121.78	CLR9-27		+	-	+
R9	130.79	CLR9-28		+	+	+
R9	132.17	CLR9-29	Scaffold83707	+	+	+
R9	138.23	CLR9-30		+	-	+

Fig 4

Sequence comparison between CLR6430 and R2000 in the region near Rfo gene, which was amplified by CLR9-7 marker.

Discussion

The radish-derived male sterility has the advantage of complete and stable sterility in B. napus and is favored by breeders in commercial production [29]. However, creation of an Ogu-CMS restorer line in B. napus remains difficult as no restorer genes were directly found in this species, nor in any Asian radish varieties. Previous research outlined the difficulties and effort in the way of producing an Ogu-CMS B. napus restorer line [11], either through cell fusion or consistent backcrossing [30]. In a previous study, Chen et al [24] used a Raphnobrassica (AACCRR) as donor and successfully obtained the hybrid with B. napus through grafting to overcome the incompatibility between these two parents. After 15 years of intensive selection, a homozygous (RfRf) restorer line CLR650 was finally obtained. Similar to previous early-version Ogu-CMS restorer line, CLR650 was associated with deleterious agronomic traits, such as high level of glucosinolate content and low seed production. Updated version CLR6430 was generated through multiple generations of back-crossing and selfing, and further corresponding analysis of fertility models, chromosome behaviors, and genomic re-sequencing-based specific markers development were characterized in this study to provide basic information for utilizing of Ogu-CMS restorer lines.

Generally, introgressed fragment from radish is the key part for understanding of the newly created Ogu-CMS in B. napus. In previous published lines, at least 50 cM of radish genome was integrated into restored rapeseed based on AFLP marker information [31]. They identified the region of Arabidopsis genome syntenic to the Rfo locus, then carried out fine mapping of the Rfo gene in a segregating radish population to find the likely ortholog of the Rfo gene. In recent years, along with the development of second-generation sequencing, radish genome has also been available [32-34] and useful for the development of specific markers for breeding purposes. In our study, CLR6430 was re-sequenced and aligned against a combined reference genome, which was the whole B. napus genome plus an additional chromosome from radish that contained the Rfo gene. The high coverage sequences assembled into R9 in the reference genome indicating the most likely homologous regions from radish introgressd into B. napus, which is the region between 66.13 cM (Rsa1.0_00994.1) and 138.53cM (Rsa1.0_00176.1). Therefore, there is about 72.4 cM of radish genome integrated into CLR6430. And the following design of SSR markers for CLR6430 was also based on the re-sequencing and alignment results, providing solid and more precise information for later improvement and utilization of CLR6430.

Secondly, creation of an ideal restorer line for Ogu-CMS B. napus remains difficult. BAC-FISH results (Fig 2) has demonstrated restorer gene from Radish located in A genome rather than N19 from C genome as previously reported (7, 21, 23), therefore, the introgression of radish genome into Brassica napus is different. After obtaining homozygous (RfRf) instead of heterozygous (Rfrf) in the loci of the restorer gene, we still have to break the linkages with some deleterious traits such as high glucosinolate content and low seed production. R2000, the widely accepted Ogu-CMS restorer line developed by INRA, has been utilized for three-line system production of hybrid rapeseed.

Meanwhile, the comparison between CLR6430 and R2000 in this study has shown significant differences, revealing the different origin. CLR6430 has improved performances in terms of glucosinolate content and seed production ability compared to its earlier version CLR650, while the introgressed fragment from radish remain long and require further improvement. In this case, developed markers for R2000 or other reported Ogu-CMS restorer were not applicable for CLR6430, hence self-designed markers based on resequencing results are meaningful for further selection and improvement for CLR6430.

Besides, segregation distortion was found in CLR6430 in selfing and backcrossing populations. Distorted segregation is the deviation of the observed genotypic ratios from the expected frequencies based on Mendelian’s laws of inheritance, which is considered as an evolutionary force and associated with genetic factors involved in reproduction and fitness [35]. Several mechanisms of segregation distortion have been reported in plants, such as chromosomal rearrangement and genomic interactions causing zygotic abortion, hybrid sterility, haploid induction and restriction of gene introgression [36]. In our case, distorted segregation happened stably in each population possibly due to the introgressed fragment from radish, causing abnormal segregation of translocated chromosome of B. napus during meiosis, which could affect the estimation of map distances and the order of markers when many distorted markers are presented. Other reason for this phenomenon could be the selection of both CLR650 and CLR6430 were based on high-pressure selection of Rfo gene and the introgressed fragment along it remains large.

The radish-derived male sterility has the advantage of complete and stable sterility in B. napus and was favored by breeders in commercial production [37]. As one of the most important rapeseed market, China has rarely utilized this Ogu-CMS system in hybrid seed production, mainly due to the lack of self-developed restorer line and patent restrictions applied from other restorer sources such as R2000 and SRF developed by INRA and Pioneer Hibred, respectively. Making good use of CLR6430 could be the breakthrough for future application of Ogu-CMS system in this market.

In summary, the DNA sequence surrounding the Rfo in CLR6430 is different from that of R2000, and resequencing-based Rfo-related markers presented a more efficient method for the improvement of CLR6430. However, the glucosinolate content remains higher than market level, and marker-assisted improvement still at early stage for seed settings and other agronomic traits. Moreover, the genetic mechanisms underlying the observed segregation distortion for Rfo in the inbreeding and backcross offspring requires further investigation. Further studies are required to locate and reduce the size of the introgression in CLR6430 for better breeding outcomes.

Sequence of amplified PCR products from self-designed SSR markers from Table 4.

(DOCX)

Click here for additional data file.

27 Apr 2020

PONE-D-20-03673

Genetic characterization of a new radish introgression line carrying the restorer gene for Ogura CMS in Brassica napus

PLOS ONE

Dear Dr. Guo,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Jun 11 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Yong Pyo Lim

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements:

1.    Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

●      The name of the colleague or the details of the professional service that edited your manuscript

●      A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

●      A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In their study, Guo et al. present an investigation into the Rfo introgression in CLR6430. Unlike other restorer line, they find Rfo on N19 (C9?) in a differently sized introgression.

I can't find any fault with the general outline of the study or the findings, only minor things (below).

It seems that the short reads generated in this study are openly available, however, the genome assembly generated is not. Will the authors deposit this assembly somewhere?

Some minor things:

Line 29, typo, 'introgresssed'

Line 170 - the link in the PDF is broken and points to 'http://wsmartins.net/websat/ with default', should be without the 'with default'

Line 218 - incomplete sentence? 'Restorer gene was detected by FISH using C genome and BAC fish probe while A genome of B. napus as block'

Line 233, Table 3 - typo, 'Cleaned eads'

Line 265, why is Baiyuchun mentioned only once here? Why is it not in the methods?

Line 287, typo - 'Raphnobrassica'

There are a few more smaller typos which should have been caught by rigorous spell checking.

Reviewer #2: This manuscript 'Genetic characterization of a new radish introgression line carrying the restorer gene

for Ogura CMS in Brassica napus' is based on well defined problem and conducted in a profound way. It is a significant improvement from the earlier available studies. This should be accepted for publication after incorporating the following corrections:

i. Introduction: Explain the importance of restores in oilseed brassicas

ii. In the materials and method, the population developed using the CMS lines and restores and maintainers with restorers were mentioned. However, it has not been made clear how these population were used for this study. The method used in Table 5 is not mentioned clearly in this section.

iii. Results: Explained appropriately, however, it is difficult to understand how the different populations were used in validation of the designed markers and segregation ratio. Explain these portion elaborately.

iv. Discussion: This section need improvement in terms of the works done and its significance. This part should explain all the experiments conducted supported by sufficient number of citations.

Comments in the manuscript is also attached for further refernce.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Dr. Shyam Sundar Dey

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: PONE-D-20-03673_reviewer.pdf

Click here for additional data file.

7 Jun 2020

Reviewer #1: In their study, Guo et al. present an investigation into the Rfo introgression in CLR6430. Unlike other restorer line, they find Rfo on N19 (C9?) in a differently sized introgression.

I can't find any fault with the general outline of the study or the findings, only minor things (below).

It seems that the short reads generated in this study are openly available; however, the genome assembly generated is not. Will the authors deposit this assembly somewhere?

Thank you for these positive comments and careful reminder. We have deposited the genome assembly to the NCBI database under the same BioProject number PRJNA488570.

Some minor things:

Line 29, typo, 'introgresssed'

Revised to “introgressed”

Line 170 - the link in the PDF is broken and points to 'http://wsmartins.net/websat/ with default', should be without the 'with default'

The website has been updated and now changed to ‘http://200.137.197.254/~wellington/websat/’,

Line 218 - incomplete sentence? 'Restorer gene was detected by FISH using C genome and BAC fish probe while A genome of B. napus as block'

Revised to ‘Restorer gene was detected by FISH using C genome and BAC clone as probes while A genome of B. napus as block’

Line 233, Table 3 - typo, 'Cleaned eads'

Revised to ‘clean reads’

Line 265, why is Baiyuchun mentioned only once here? Why is it not in the methods?

The relative information has added into the methods part.

Line 287, typo - 'Raphnobrassica'

Revised to ‘Raphanobrassica’.

There are a few more smaller typos which should have been caught by rigorous spell checking.

We have gone through the manuscript thoroughly to minimize the errors in grammar and spelling.

Reviewer #2: This manuscript 'Genetic characterization of a new radish introgression line carrying the restorer gene

for Ogura CMS in Brassica napus' is based on well defined problem and conducted in a profound way. It is a significant improvement from the earlier available studies. This should be accepted for publication after incorporating the following corrections:

i. Introduction: Explain the importance of restores in oilseed brassicas

One sentence explaining the importance of restores in oilseed Brassicas has been added into the Introduction part.

ii. In the materials and method, the population developed using the CMS lines and restores and maintainers with restorers were mentioned. However, it has not been made clear how these population were used for this study. The method used in Table 5 is not mentioned clearly in this section.

Thank you for the reminder, the information of the radish cultivar “Baiyunchun” has been added in the methods part for Table 5.

iii. Results: Explained appropriately, however, it is difficult to understand how the different populations were used in validation of the designed markers and segregation ratio. Explain these portion elaborately.

The process of validation of designed markers in tested and verified in the F2 segregating population was further explained in the context.

iv. Discussion: This section need improvement in terms of the works done and its significance. This part should explain all the experiments conducted supported by sufficient number of citations.

Thank you for the suggestion. We revised and rearranged several parts in this part while added a few more citations.

Comments in the manuscript is also attached for further refernce.

Submitted filename: Plos_one Response to the reviewers.docx

Click here for additional data file.

6 Jul 2020

Genetic characterization of a new radish introgression line carrying the restorer gene for Ogura CMS in Brassica napus

PONE-D-20-03673R1

Dear Dr. Guo,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Yong Pyo Lim

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: I'm happy with the way my recommendations were implemented. The data has been added to SRA and typos have been fixed. Thanks!

Reviewer #2: The manuscript entitled, ' Genetic characterization of a new radish introgression line carrying the restorer gene for Ogura CMS in Brassica napus , has been improved and revised as per the suggestions of the reviewers. Therefore, in the present format it can be accepted for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Dr. Shyam Sundar Dey

9 Jul 2020

PONE-D-20-03673R1

Genetic characterization of a new radish introgression line carrying the restorer gene for Ogura CMS in Brassica napus

Dear Dr. Guo:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Yong Pyo Lim

Academic Editor

PLOS ONE