Literature DB >> 32701053

On the Neoechinorhynchus agilis (Acanthocephala: Neoechinorhynchidae) complex, with a description of Neoechinorhynchus ponticus n. sp. from Chelon auratus in the Black Sea.

Omar M Amin1, Meysam Sharifdini2, Richard A Heckmann3, Nataliya Rubtsova1, Halima Jmii Chine4.   

Abstract

We recognize four species in the Neoechinorhynchus agilis complex. We studied specimens of Neoechinorhynchus (Hebesoma) personatus Tkach, Sarabeev & Shvetsova, 2014 from Mugil cephalus in the Mediterranean Sea off Tunisia and in the Black Sea, and also specimens of Neoechinorhynchus ponticus n. sp. from Chelon auratus Risso in the Black Sea. Specimens from M. cephalus at both locations were similar. All structures of N. ponticus n. sp. were considerably smaller than those of N. personatus. Two other species of the N. agilis complex are recognized: Neoechinorhynchus agilis (Rudolphi, 1819) sensu stricto from various hosts in the Atlantic and the Mediterranean, and Neoechinorhynchus yamagutii Tkach, Sarabeev & Shvetsova, 2014 from M. cephalus and Planiliza haematocheila in the Pacific, especially the Sea of Japan. Neoechinorhynchus dimorphospinus Amin & Sey, 1996 from marine fish in the Persian Gulf and the Pacific Ocean off Vietnam may be a candidate for membership in the N. agilis complex. X-ray scans of gallium cut and intact hooks of N. personatus and N. ponticus showed differences in the mineral content of hooks with higher sulfur levels in smaller hooks and in hooks from specimens in the Black Sea compared to specimens from the Mediterranean. The relatively high genetic differences between N. ponticus n. sp. and other species of Neoechinorhynchus using a partial 18S rDNA dataset support its independent status. Neoechinorhynchus ponticus n. sp. and N. personatus have a common ancestor with species of Neoechinorhynchus collected from saltwater fish. © O.M. Amin et al., published by EDP Sciences, 2020.

Entities:  

Keywords:  Acanthocephala; Black Sea; Chelon auratus; Mediterranean; Mugil cephalus; N. personatus; N. ponticus n. sp.; N. yamagutii; Neoechinorhynchus agilis; species complex

Mesh:

Substances:

Year:  2020        PMID: 32701053      PMCID: PMC7377084          DOI: 10.1051/parasite/2020044

Source DB:  PubMed          Journal:  Parasite        ISSN: 1252-607X            Impact factor:   3.000


Introduction

Rudolphi [30] originally described the external morphology and proboscis receptacle of Neoechinorhynchus agilis (Rudolphi, 1819) Van Cleave, 1916 from 9 individuals taken from Mugil cephalus in Spezia, Italy without providing any measurements. Hamann [13] described N. agilis in detail but thought it had 6 cement glands. Van Cleave [36] described a syncytium cement gland containing 8 giant nuclei. Van Cleave [36, 37] suspected that N. agilis was restricted to the Mediterranean, but this is now known not to be. For example, species presumed to be N. agilis before the establishment of the species complex concept studies by Tkach et al. [35], Sarabeev et al. [31] and ours (this paper) were reported from M. cephalus in Taiwan [32], in the Indian Ocean near Tamil Nadu [17], and in Guyana [26], as well as in Japan, Scotland, and North America. Other observers including Linton [19-21], Van Cleave [36, 37], Meyer [23], Yamaguti [40, 41], Petrochenko [24], Gaevskaya et al. [10], and Tepe and Oguz [34] reported N. agilis from at least 10 species of fish in the Black Sea and the Mediterranean, among other locations off the coasts of Scotland, North America, and Japan. This species complex appears to be widely distributed in mullets from the Atlantic and Pacific oceans ([31, 35], among others). Altogether, descriptions by the above cited authors gave an extreme range of variation in taxonomically important traits. Van Cleave [37] provided a detailed description of the variability in “N. agilis” based on the examination of Rudolphi’s specimens and other materials from the Berlin Museum (Table IV of Van Cleave [37]). None of the above authors reported on the relationship between the observed extreme variability and host species. Van Cleave [37] was unable to determine whether the “conflicting data represented individual variability within the species or resulted from inaccurate observations and erroneous identifications.” Tkach et al. [35] split N. agilis into three species that showed some overlap in measurements and that were collected from M. cephalus and other mugilids from various locations from the Mediterranean to Japan. These are Neoechinorhynchus (Hebesoma) personatus Tkach, Sarabeev & Shvetsova, 2014, Neoechinorhynchus agilis sensu stricto, and Neoechinorhynchus yamagutii Tkach, Sarabeev & Shvetsova, 2014. Gargouri et al. [12] and Tepe and Oguz [34] reported “N. agilis” from C. auratus in the Mediterranean off the Tunisian coast at the Bizerte Lagoon and off the Black Sea coast of Turkey, respectively. Observations were not available to correlate their morphometric data with host species. We also provide chemical and molecular data to explain and clarify our findings. With the use of dual beam scanning electron microscopy, it was feasible to run energy dispersive X-ray analysis (EDXA) on both intact and gallium (LMIS) cut hooks. This is usually a qualitative analysis, not quantitative, for the attachment structures [5, 14, 15]. This technique was applied to the study of the Neoechinorhynchus complex. This study provides molecular profiles of N. ponticus n. sp. and N. personatus based on 18S rDNA gene. Furthermore, its phylogenetic relationships with other members of the genus Neoechinorhynchus are analyzed and discussed.

Materials and methods

Collections

Five hundred and twenty two individuals of 5 mugilid species of fish in the Ichkeul Lagoon off Northern Tunisia (37°10′00″ N, 9°40′00″ E) were sampled between March 2014 and September 2017 by gill net fishing. Fish were examined for helminths under a stereomicroscope shortly after capture. The specimens of acanthocephalans collected were first placed in distilled water at 4 °C until the proboscis was everted. Tunisian specimens of N. personatus, among other acanthocephalan species, from M. cephalus from this collection were deposited in the Harold W. Manter Laboratory (HWML) parasitology collection no. 102004. In the Black Sea at Zalizny Port (46°7′ N, 32°17′ E), individuals of M. cephalus and of Chelon auratus were examined in June, 2015. Specimens of N. personatus from M. cephalus were deposited in the HWML collections no. 102006 and those of N. ponticus from C. auratus in the HWML collection no. 102005.

Methods for microscopical studies

Worms were punctured with a fine needle and subsequently stained in Mayer’s acid carmine, destained in 4% hydrochloric acid in 70% ethanol, dehydrated in ascending concentrations of ethanol (24 h each), and cleared in 100% xylene then in 50% Canada balsam and 50% xylene (24 h each). Whole worms were then mounted in Canada balsam. Measurements are in micrometers, unless otherwise noted; the range is followed by the mean values between parentheses. Width measurements represent maximum width. Trunk length does not include proboscis, neck, or bursa. Microscope images were created using 10X and 40X objective lenses of a BH2 light Olympus microscope (Olympus Optical Co., Osachi-shibamiya, Okaya, Nagano, Japan) attached to an AmScope 1000 video camera (United Scope LLC, dba AmScope, Irvine, CA, USA), linked to an ASUS labtop equipped with an HDMI high definition multimedia interface system (Taiwan–USA, Fremont, CA, USA). Images from the microscope were transferred from the labtop to a USB and stored for subsequent processing on a computer.

Scanning electron microscopy (SEM)

Samples of parasites that had been fixed and stored in 70% ethanol were processed following standard methods [18] which included critical point drying (CPD) in sample baskets and mounted on SEM sample mounts (stubs) using conductive double-sided carbon tape. Samples were coated with gold and palladium for 3 min using a Polaron #3500 sputter coater (Quorum (Q150 TES) www.quorumtech.com) establishing an approximate thickness of 20 nm. Samples were placed and observed in an FEI Helios Dual Beam Nanolab 600 (FEI, Hillsboro, OR, USA) Scanning Electron Microscope with digital images obtained in the Nanolab software system (FEI) and then transferred to a USB for future reference. Images were taken at various magnifications. Samples were received under low vacuum conditions using a 10 kV, spot size 2 0.7 Torr using a GSE detector.

X-ray microanalysis, energy dispersive X-ray analysis

Standard methods were used for preparation, similar to the SEM procedure. Specimens were examined and positioned with the above SEM instrument which was equipped with a Phoenix energy-dispersive X-ray analyzer (FEI). X-ray spot analysis and live scan analysis were performed at 16 kV with a spot size of 5 and results were recorded on charts and stored with digital imaging software attached to a computer. The TEAM* (Texture and Elemental Analytical Microscopy) software system (FEI) was used. The data included weight percent and atom percent of the detected elements following correction factors.

Ion sectioning of hooks

A dual-beam SEM with a gallium (Ga) ion source (GIS) was used for the liquid ion metal source (LIMS) part of the process. The hooks of the acanthocephalans were sectioned using a probe current between 0.2 nA and 2.1 nA, according to the rate at which the area is cut. The time of cutting was based on the nature and sensitivity of the tissue. Following the initial cut, the sample also goes through a milling process to obtain a smooth surface. The cut was then analyzed for chemical ions with an electron beam (Tungsten) to obtain an X-ray spectrum. The intensity of the GIS was variable due to the nature of the material being cut.

DNA extraction and PCR amplification

Total genomic DNA was extracted from 3 adult worms of N. ponticus n. sp. and 4 of N. personatus using a Qiagen DNeasy blood and tissue kit (Qiagen Inc., Valencia, CA, USA), according to the manufacturer’s instructions. Partial nuclear small subunit ribosomal DNA (18S rDNA) was amplified by PCR reactions in 30 μL volumes containing 2× red PCR premix (Ampliqon, Odense, Denmark), 20 pmol of each primer, and 3 μL of isolated DNA. Forward primer (5′ – AGATTAAGCCATGCATGCGTAAG – 3′) and reverse primer (5′ – ACCCACCGAATCAAGAAAGAG – 3′) were used for the amplification of the partial fragment of the nuclear 18S rDNA gene [7]. PCR conditions were: 95 °C for 5 min followed by 35 cycles of 95 °C for 30 s, 61 °C for 30 s, 72 °C for 60 s, and 72 °C for 7 min as a final extension. Finally, the PCR products were electrophoresed on a 1.5% agarose gel and visualized with a UV transilluminator (Vilber Lourmat, Collégien, France).

Sequencing and phylogenetic analysis

All PCR products were sequenced on an ABI 3730 automatic sequencer (Applied Biosystems, Foster City, CA, USA) in both directions using the same PCR primers. The obtained sequences were edited and analyzed using Chromas v.2.01 (Technelysium Pty Ltd., Brisbane, Queensland, Australia) and BioEdit software v.7.0.9. The sequences were compared with available data in GenBank using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/). The nucleotide sequences of the 18S rDNA gene from this study were submitted to the GenBank database (Accession Numbers: MT020789 – MT020791 for N. ponticus n. sp. isolates and MT020792 – MT020795 for N. personatus isolates). A phylogenetic tree was constructed using the maximum-likelihood algorithm and Tamura-3-parameter model in MEGA7 software (http://www.megasoftware.net/). A bootstrap value with 1000 replications was also implemented to evaluate the reliability of the tree topologies. Furthermore, genetic distances were calculated with the maximum composite likelihood model using MEGA7 software. The sequences used for the phylogenetic analysis are listed in Table 1.
Table 1

Acanthocephalan species represented in the phylogenetic analysis with their host species, GenBank accession numbers, and locations.

SpeciesHostGenBank acc. no. 18S rDNALocation
Neoechinorhynchus personatus Tkach, Sarabeev & Shvetsova, 2014Mugil cephalus MT020792MT020795 Tunisia
Neoechinorhynchus ponticus n. sp. Liza aurata MT020789MT020791 Ukraine
Neoechinorhynchus personatus Tkach, Sarabeev & Shvetsova, 2014Mugil cephalus MN149068, MN149069 and MN149071 Ukraine
Neoechinorhynchus agilis (Rudolphi, 1819)Chelon labrosus MN148893 and MN148895 Spain
Neoechinorhynchus sp.Siganus fuscescens HM545898 China
Neoechinorhynchus dimorphospinus (Amin & Sey, 1996)Liza subviridis MK510080 Thailand
Neoechinorhynchus yamagutii Tkach, Sarabeev and Shvetsova, 2014Mugil cephalus MN149220 Russia
Neoechinorhynchus buttnerae (Golvan, 1956)Not available MK249749 Brazil
Neoechinorhynchus crassus (Van Cleave, 1919)Capoeta aculeata KU363971 Iran
Neoechinorhynchus pseudemydis (Cable & Hopp, 1954)Capoeta aculeata KU363973 Iran
Neoechinorhynchus cylindratus (Van Cleave, 1913)Micropterus salmoides MF974925 USA
Neoechinorhynchus beringianus (Mikhailova & Atrashkevich, 2008)Pungitius pungitius KF156875 Russia
Neoechinorhynchus saginata (Van Cleave & Bangham, 1949)Not available AY830150 Not available
Neoechinorhynchus simansularis (Roytman, 1961)Salvelinus alpinus KF156877 Russia
Outgroup
Echinorhynchus gadiSalvelinus malma KF156880 Russia
Corynosoma enhydriEnhydra lutris AF001837 Na
Bolbosoma caenoformeSalvelinus malma KF156879 Russia
Acanthocephalan species represented in the phylogenetic analysis with their host species, GenBank accession numbers, and locations.

Results

Of 522 individuals of 5 mugilid species of fish examined in the Ichkeul Lagoon off the Mediterranean in Northern Tunisia between March, 2014 and September, 2017, 66 of 117 individuals of M. cephalus were found to be infected with 564 acanthocephalans among them (about 200) specimens of N. personatus in June, 2014. Other mugilid species examined included Chelon auratus, Chelon ramada Risso, Chelon saliens Risso, and Chelon labrosus Risso. Acanthocephalans were mostly found in the anterior intestine except in one case where 49 fully mature normal adult acanthocephalans were found in the body cavity of one individual M. cephalus in June, 2014. In the Black Sea at Zalizny Port, all 7 examined individuals of M. cephalus were infected with 82 specimens of N. personatus (range 1–27; mean 11.7) and all 4 individuals of C. auratus were infected with 36 specimens of N. ponticus n. sp. (range 3–18; mean 9.0).

Neoechinorhynchus (Hebesoma) personatus Tkach, Sarabeev, Shvetsova, 2014 (Figs. 1, 3, 5–7, 9, 11–30)

Type and Tunisian host: Mugil cephalus Linnaeus (Mugilidae). A comparison between specimens of Neoechinorhynchus personatus from Mugil cephalus in the Mediterranean Sea off Tunisia and from the Black Sea (Figs. 1, 3, 5–7, 9) and specimens of Neoechinorhynchus ponticus n. sp. from Chelon auratus from the Black Sea (Figs. 2, 4, 8, 10). 1. Adult male specimen of N. personatus from M. cephalus in Tunisia. Note the extension of the unequal lemnisci to the anterior testis and the number of the giant nuclei in the cement gland. 2. A smaller male specimens of N. ponticus from C. auratus, in the Black Sea, drawn to same scale. Note the shorter lemnisci and smaller reproductive system. 3. A female specimen of N. personatus with long unequal lemnisci, near terminal gonopore, and 6 dorsal and 2 ventral giant subcutaneous nuclei. 4. A smaller adult female specimen of N. ponticus n. sp. from C. auratus in the Black Sea, drawn to same scale as Fig. 3. Note small lemnisci. Eggs and ovarian balls not shown. 5. A ripe egg from a gravid female specimen of N. personatus from M. cephalus. 6. A female reproductive system of a specimen of N. personatus from M. cephalus which is comparable to that of N. ponticus from C. auratus. Note the prominent ligament strand connecting anterior end of uterus at uterine glands with posterior body wall near the vagina dorsally. 7. Proboscis of a male specimen of N. personatus from M. cephalus in Tunisia. Note the 2 giant nuclei in the prominent apical organ (arrow), and the anterior trunk ring. 8. The smaller proboscis of a male specimen of N. ponticus n. sp. from C. auratus, in the Black Sea drawn to same scale as Figure 7. An arrow points to the giant nuclei of the apical organ. 9. A high magnification of one row of hooks from the proboscis of a male specimen of N. personatus from M. cephalus.10. A high magnification of one row of the smaller hooks from the proboscis of a male specimen of N. ponticus from C. auratus. drawn to same scale as the hooks in Fig. 9. SEM of specimens of Neoechinorhynchus personatus from Mugil cephalus in the Mediterranean Sea off Tunisia. 11. Proboscis of a male specimen showing the large anterior hooks and the delineation of the neck. 12. An apical view of a proboscis showing the pore of the apical organ (arrow). 13. The magnified anterior and middle hooks of the proboscis shown in Fig. 11. 14. A partially Gallium cut anterior hook showing its thin cortical layer and dense core, and its articulation vs. the root of the same core density. 15. The longitudinal serrations on the posterior hook are evident. 16. A magnified view of an anterior hook depicting the pattern of the serrations. Type-locality: Azov-Black Sea region (Tkach, Sarabeev & Shvetsova, 2014). Other localities: Mediterranean Sea (Tkach, Sarabeev & Shvetsova, 2014). Present localities: Ichkeul Lagoon off the Mediterranean in Northern Tunisia (37°10′ N, 9°40′ E) and the Black Sea at Zalizny Port, Ukraine (46º7′ N, 32°17′ E). Site of infection: Intestine and peritoneal cavity. Voucher specimens: Harold W. Manter Lab collection nos. HWML 102004 (from M. cephalus off Tunisia), and HWML 102006 (from M. cephalus from the Black Sea). The following redescription is based on the microscopic examination of 26 specimens (9 males, 17 females) from M. cephalus in the Black Sea and 16 specimens (8 males, 8 females) off the Tunisian coast, and on 6 more specimens of each collection examined by SEM. Additional specimens were used for molecular analysis. The redescription addresses mostly qualitative features that apply to the two comparable populations of N. personatus studied in these two geographical locations, presenting a number of features not noted in the original description. The specimens from the Black Sea and the Mediterranean were collected in the same month, June, 2014 and 2015 (in the Black Sea). Morphological and morphometric data are presented in Table 2. Biochemical, EDXA and molecular analysis are addressed separately, below.
Table 2

Morphometric comparisons among species of Neoechinorhynchus from Mugil cephalus and Chelon auratus in the Mediterranean and the Black Sea in our collections.

Neoechinorhynchus sp.
N. personatus
N. personatus
N. ponticus n. sp.
Host
Mugil cephalus
Mugil cephalus
Chelon auratus
LocalityTunis, MediterraneanBlack SeaBlack Sea
Malesn = 8n = 9n = 9
Trunk (mm)9.55–10.07 (9.80) × 0.87–1.10 (1.0)*7.25–10.25 (9.00) × 0.53–0.92 (0.70)7.87–8.75 (8.44) × 0.67–1.00 (0.85)
Proboscis182–205 (190) × 205–225 (213)162–218 (200) × 200–242 (224)100–145 (127) × 135–175 (151)
Hook length
 Ant.107–147 (123)112–130 (123)77–87 (82)
 Mid.70–85 (75)65–85 (78)40–57 (45)
 Post.53–71 (60)57–72 (66)30–40 (34)
Receptacle728–1,019 (882) × 218–281 (253)780–936 (852) × 187–291 (221)603–728 (653) × 135–187 (157)
Lemnisci (mm)
 Short3.12–4.25 (3.70) × 0.13–0.19 (0.15)2.86–3.26 (3.06) × 0.10–1.3 (1.2) 1.73–2.75 (2.14) × 0.10–0.15 (0.14)
 Long3.12–4.67 (3.86) × 0.16–0.19 (0.17)3.57–4.05 (3.81) × 0.11–0.19 (0.15)2.03–2.81 (2.41) × 0.12–0.19 (0.14)
Anterior testis (mm)1.25–1.70 (1.44) × 0.35–0.50 (0.45)0.70–1.50 (1.11) × 0.32–0.45 (0.38) 0.25–1.00 (0.70) × 0.35–0.50 (0.44)
Posterior testis (mm) 1.25–1.75 (1.49) × 0.25–0.50 (0.43)1.00–1.45 (1.19) × 0.30–0.45 (0.35)0.50–0.87 (0.63) × 0.40–0.50 (0.44)
Cement gland (mm)1.67–2.67 (2.09) × 0.37–0.50 (0.45)1.00–1.77 (1.29) × 0.22–0.40 (0.31) 0.75–1.50 (0.96) × 0.45–0.52 (0.49)
Cement reservoir450–625 (560) × 225 – 350 (300)375–520 (465) × 250–312 (270) 375–500 (431) × 253–375 (310)
Saefftigen’s pouch (mm)ObscuredObscured0.77–1.25 (1.08) × 0.12–0.30 (0.21)
Bursa (mm)0.42–1.20 (0.72) × 0.40–0.52 (0.47)0.50–1.25 (0.94) × 0.20–0.42 (0.30)
Femalesn=8n=17n=10
Trunk (mm)11.00–14.75 (13.65) × 0.77–1.27 (1.05)8.00–21.25 (14.48) × 0.50–1.22 (0.91)8.37–10.75 (9.73) × 0.57–0.95 (0.82)
Proboscis162–200 (184) × 205–230 (217)187–239 (215) × 208–250 (231)112–142 (129) × 132–162 (152)
Hook length
 Ant.110–137 (124)105–142 (123)75–132 (90)
 Mid.62–80 (71)75–90 (81)40–77 (50)
 Post.60–67 (64)62–77 (68)32–67 (40)
Receptacle832–1,040 (910) × 218–333 (260)707–988 (856) × 198–364 (273)634–780 (718) × 156–208 (179)
Lemnisci (mm)
 Short3.70 × 0.154.80 × 0.172.00–2.75 (2.46) × 0.10–0.15 (0.13)
 Long3.90 × 0.174.86 × 0.172.50–3.75 (3.33) × 0.12–0.17 (0.14)
Eggs45–50 (48) × 10–12 (10)35–47 (40) × 10–15 (12)
Reproductive syst. (mm)1.25–1.56 (1.44)0.96–1.67 (1.29)0.73–1.25 (1.09)

Range (mean) in μm unless otherwise stated.

Morphometric comparisons among species of Neoechinorhynchus from Mugil cephalus and Chelon auratus in the Mediterranean and the Black Sea in our collections. Range (mean) in μm unless otherwise stated.

Redescription

General: With characters of the genus Neoechinorhynchus and the subgenus Hebesoma as designated by Amin [1] (Neoechinorhynchidae). Medium-sized worms. Shared structures larger in females than in males. Trunk cylindrical, somewhat enlarged anteriorly, gradually tapering at both ends (Figs. 1, 3). Body wall with electron dense micropores ducting into subcutaneous layer with multiple branching (Figs. 20, 26, 29, 30). Neck prominent with paired sensory pores and elevated pebble-like protrusions and paired sensory pores (Figs. 17–19, 26–28). Trunk with prominent reticular lacunar system usually manifesting as regular alternating bands, and with 6–7 (usually 6) dorsal and 1–2 (usually 2) ventral hypodermal giant nuclei. Muscular ring at anterior trunk variably distinguished but usually prominent (Fig. 7). Proboscis cylindrical, truncated, widest anteriorly, relatively but consistently wider than long, with prominent apical organ having 2 conspicuous nuclei at its distal end (Figs. 7, 11, 12). All hooks serrated longitudinally (Figs. 13–16, 23–25), rooted, most robust with longest roots anteriorly (Fig. 14), smallest posteriorly, equal in length in each circle. Hook roots prominent but markedly shorter than blades with anteriorly directed manubria. Manubria least prominent in largest anterior hooks (Fig. 9). Proboscis receptacle single-walled, slightly longer than 4 times as long as proboscis with cerebral ganglion at its base (Figs. 1, 3). Lemnisci long, digitiform, subequal, with 2 large oval giant nuclei each at widest part, reaching posterior end of anterior testis (Fig. 1).
Figures 1–10

A comparison between specimens of Neoechinorhynchus personatus from Mugil cephalus in the Mediterranean Sea off Tunisia and from the Black Sea (Figs. 1, 3, 5–7, 9) and specimens of Neoechinorhynchus ponticus n. sp. from Chelon auratus from the Black Sea (Figs. 2, 4, 8, 10). 1. Adult male specimen of N. personatus from M. cephalus in Tunisia. Note the extension of the unequal lemnisci to the anterior testis and the number of the giant nuclei in the cement gland. 2. A smaller male specimens of N. ponticus from C. auratus, in the Black Sea, drawn to same scale. Note the shorter lemnisci and smaller reproductive system. 3. A female specimen of N. personatus with long unequal lemnisci, near terminal gonopore, and 6 dorsal and 2 ventral giant subcutaneous nuclei. 4. A smaller adult female specimen of N. ponticus n. sp. from C. auratus in the Black Sea, drawn to same scale as Fig. 3. Note small lemnisci. Eggs and ovarian balls not shown. 5. A ripe egg from a gravid female specimen of N. personatus from M. cephalus. 6. A female reproductive system of a specimen of N. personatus from M. cephalus which is comparable to that of N. ponticus from C. auratus. Note the prominent ligament strand connecting anterior end of uterus at uterine glands with posterior body wall near the vagina dorsally. 7. Proboscis of a male specimen of N. personatus from M. cephalus in Tunisia. Note the 2 giant nuclei in the prominent apical organ (arrow), and the anterior trunk ring. 8. The smaller proboscis of a male specimen of N. ponticus n. sp. from C. auratus, in the Black Sea drawn to same scale as Figure 7. An arrow points to the giant nuclei of the apical organ. 9. A high magnification of one row of hooks from the proboscis of a male specimen of N. personatus from M. cephalus.10. A high magnification of one row of the smaller hooks from the proboscis of a male specimen of N. ponticus from C. auratus. drawn to same scale as the hooks in Fig. 9.

Figures 17–22

SEM of specimens of Neoechinorhynchus personatus from Mugil cephalus in the Mediterranean Sea off Tunisia. 17. The separation line (arrows) between the pebbled neck surface (left) and the anterior trunk with micropores of a specimen. 18. A sensory pore in the neck of a specimen showing the pebbled surface of the neck and the non-pebbled depression around the pore. 19. A magnified view of the neck surface depressions. 20. Micropores (arrow) in the anterior trunk of a specimen. 21. The bursa of a male specimen showing no visible ornamentation or pores. 22. Eggs.

Figures 23–30

TEM sections of specimens of Neoechinorhynchus personatus from Mugil cephalus in the Mediterranean Sea off Tunisia. 23. Cross section of a hook. Note the serrated (corrugated) outer layer and the solid inner core with an internal tube. 24. Higher magnification of pert of the hook in Fig. 23 showing the outer serrated layer. 25. Outermost layer of the hook showing detail toothed serrations. 26. Transition between the neck (top) and trunk (bottom with micropore tubules) of a worm. 27. Outer tegument layer of the neck with a knobby (pebbled) surface. No visible micropore channels here. 28. A high magnification of the neck tegument in Fig. 27. Note distinct outer layer and myofibrils beneath the tegument. 29. Part of the trunk tegument of a worm showing micropore channels. 30. A higher magnification of a section of the tegument in Fig. 29 showing detail of the micropore channels.

Figures 11–16

SEM of specimens of Neoechinorhynchus personatus from Mugil cephalus in the Mediterranean Sea off Tunisia. 11. Proboscis of a male specimen showing the large anterior hooks and the delineation of the neck. 12. An apical view of a proboscis showing the pore of the apical organ (arrow). 13. The magnified anterior and middle hooks of the proboscis shown in Fig. 11. 14. A partially Gallium cut anterior hook showing its thin cortical layer and dense core, and its articulation vs. the root of the same core density. 15. The longitudinal serrations on the posterior hook are evident. 16. A magnified view of an anterior hook depicting the pattern of the serrations.

SEM of specimens of Neoechinorhynchus personatus from Mugil cephalus in the Mediterranean Sea off Tunisia. 17. The separation line (arrows) between the pebbled neck surface (left) and the anterior trunk with micropores of a specimen. 18. A sensory pore in the neck of a specimen showing the pebbled surface of the neck and the non-pebbled depression around the pore. 19. A magnified view of the neck surface depressions. 20. Micropores (arrow) in the anterior trunk of a specimen. 21. The bursa of a male specimen showing no visible ornamentation or pores. 22. Eggs. TEM sections of specimens of Neoechinorhynchus personatus from Mugil cephalus in the Mediterranean Sea off Tunisia. 23. Cross section of a hook. Note the serrated (corrugated) outer layer and the solid inner core with an internal tube. 24. Higher magnification of pert of the hook in Fig. 23 showing the outer serrated layer. 25. Outermost layer of the hook showing detail toothed serrations. 26. Transition between the neck (top) and trunk (bottom with micropore tubules) of a worm. 27. Outer tegument layer of the neck with a knobby (pebbled) surface. No visible micropore channels here. 28. A high magnification of the neck tegument in Fig. 27. Note distinct outer layer and myofibrils beneath the tegument. 29. Part of the trunk tegument of a worm showing micropore channels. 30. A higher magnification of a section of the tegument in Fig. 29 showing detail of the micropore channels. SEM of specimens of Neoechinorhynchus ponticus n. sp. from Chelon auratus from the Black Sea. 31. The proboscis and neck of a male specimen showing the comparatively smaller hooks than in N. personatus and one of the neck sensory pores (arrow). 32. An apical view of a proboscis showing the pore of the apical organ (arrow). 33. The longitudinally serrated anterior proboscis hook of a specimen. 34. Detail of the serration pattern on the hook shown in Figure 33. 35. Detail of the pebbled surface of the neck of a specimen. 36. Detail of the female gonopore. Male (see Table 2 for measurements): Reproductive system in posterior two thirds of trunk. Testes large, equal, oblong, contiguous, slightly anterior to mid-trunk, with male reproductive structures extending into bursa. Cement gland longer than either testes, usually with 8–18 giant nuclei; mature adults with fewer nuclei. Cement reservoir just posterior to cement gland, less than half size of cement gland. Common sperm duct prominent. Saefftigen’s pouch prominent, overlapping common sperm duct and often obscured by it (Fig. 1). Bursa rounded, usually longer than wide, with no apparent sensory structures (Fig. 21). Gonopore terminal. Female (see Table 2 for measurements). Reproductive system about 10% length of trunk (Fig. 3). Vagina not especially muscular. Uterus and uterine bell of moderate length with prominent ligament strand connecting anterior end of uterus at uterine glands with posterior body wall near the vagina dorsally (Fig. 6). Gonopore near terminal on ventral side. Eggs fusiform, elongate, with bluntly pointed ends and with polar prolongation of fertilization membrane (Figs. 5, 22).

Remarks

Morphologically, our specimens of N. personatus from Tunisia and the Black see were almost identical to those described by Tkach et al. [35]. The extent of the length of the lemnisci reaching the anterior testis, the shape and organization of the proboscis, hooks, and reproductive systems, and the number of giant sub-cuticular and cement gland nuclei were practically identical to those in the original description and to their Figures 12–18 (page 298). Our specimens, however, had slightly larger trunk, testes, cement glands and eggs, and slightly smaller hooks. References to the anterior trunk muscle ring, the ligament strand connecting the anterior end of uterus at the uterine glands with the posterior body wall, the micropores, and the neck’s sensory pores and pebble-like texture of its epidermis were missing from the original description. Characters used by Tkach et al. [35] to distinguish N. personatus from species of Neoechinorhynchus other than those in the N. agilis complex apply to the present discussion. The eggs in our specimens were slightly larger (35–50 × 10–15) compared to theirs (30–34 × 9–11). Egg size difference may be related to degree of development; their Figure 14 (mislabeled) shows 2 apparently underdeveloped eggs.

EDXA results for N. personatus

Results for energy dispersive X-ray analysis are shown in Tables 3–6 and Figures 37, 38. The anterior and posterior hooks of our specimen of N. personatus from M. cephalus in both locations in the Mediterranean and the Black Sea had comparable biochemical profiles. All of the listed elements (P, S, Ca) varied for the two locations. Hooks from the Black Sea, however, exhibited higher levels of sulfur and lower levels of calcium (Table 3). The hardening elements (Ca, P) are more plentiful in the large anterior hooks. Table 3 also shows a difference in mineral content for the large and small hooks with small hooks showing higher sulfur and lower calcium levels (Figs. 37, 38 and Tables 3, 4). All elements were highest at the tip of hooks compared to the middle and bottom cuts (Table 5), and calcium was especially high at the base of hooks (Table 6). The hardening elements (Ca, P) are more plentiful in the large anterior hooks.
Table 3

Results of the X-ray microanalysis for elements present in the base of hooks of Neoechinorhynchus personatus from Mugil cephalus in two different geographical locations, the Mediterranean Sea off Tunisia and the Black Sea.

Mediterranean Sea off Tunisia Large anterior hook
Small posterior hook
Wt%*At%* Wt%At%
Phosphorus (P) 10.80 ** 7.65 4.84 ** 2.91
Sulfur (S) 3.10 2.12 6.94 4.03
Calcium (Ca)
17.20
9.42
7.35
3.42
Black SeaLarge anterior hook
Small posterior hook
Wt%At%Wt%At%
Phosphorus (P)8.546.22.692.12
Sulfur (S)8.545.9912.789.74
Calcium (Ca)12.897.233.061.86

Weight percent (Wt%) and Atom percent (AT%) are based on a total of 100 percent. Note: C, H, O, N are common elements in all protoplasm. Pd (palladium) and Au (gold) are used to count the specimen before viewing, Ga (gallium) is used to make fine cuts (dual beam) of specimens.

See Figures 37 and 38 for EDXA spectra of bolded WT% of anterior and posterior hooks of N. personatus from the Mediterranean. Note that the levels of sulfur are about twice as high and the levels of calcium and phosphorous, relatively lower in all measurements (%) from specimens in the Black Sea than in those from the Mediterranean off Tunisia.

Table 6

Chemical composition of the base of large hooks for Neoechinorhynchus personatus and N. ponticus cut on a longitudinal axis with a Gallium beam (LMIS) from a dual beam SEM.

Elements* N. personatus
N. ponticus
Hook baseHook base
Magnesium (Mg)1.492.11
Phosphorus (P)19.1221.37
Sulfur (S)1.331.43
Calcium (Ca)54.7545.00

Common protoplasmic elements (C, N, O) and processing elements (Au, Pd, Ga) are omitted. Listed in WT%.

Figure 37

Energy dispersive X-Ray spectrum of the large anterior hook of a Neoechinorhynchus personatus specimen from Mugil cephalus in the Mediterranean showing high levels of phosphorus and calcium and low levels of sulfur. The X-ray data are the elemental analysis of the whole hook (see bolded figures in Table 3). Insert: SEM of a deep Gallium cut at the base of a hook.

Figure 38

Energy dispersive X-ray spectrum of the small posterior hook of a Neoechinorhynchus personatus specimen from Mugil cephalus in the Mediterranean showing markedly lower levels of phosphorus and calcium, and considerably lower levels of sulfur than anterior hooks (Fig. 37). The X-ray data are the elemental analysis of the whole hook (see bolded figures in Table 3). Insert: SEM of a deep Gallium cut at the base of a hook.

Table 4

Results of the X-ray microanalysis for elements present in the intact hooks of two species of Neoechinorhynchus, N. personatus from Mugil cephalus in the Mediterranean off Tunisia and N. ponticus from Chelon auratus in the Black Sea.

Large anterior hook
Small posterior hook
WT%* WT%
N. personatus
Phosphorus (P)10.804.84
Sulfur (S)3.106.94
Calcium (Ca)17.207.35
N. ponticus
Phosphorus (P)8.542.69
Sulfur (S)8.5412.78
Calcium (Ca)12.893.06

Weight percent (WT%) is based on a total of 100. C, O, N are common elements of the protoplasm. Pd (palladium), Au (gold) and Ga (gallium) are omitted from the chart.

Table 5

Chemical composition of a small hook of Neoechinorhynchus personatus cut* at the three levels with a Gallium beam (LMIS) from a dual beam SEM.

Elements** Tip cut
Mid cut
Base cut
EdgeCenterEdgeCenterEdgeCenter
Magnesium (Mg)0.341.941.991.823.341.89
Phosphorus (P)9.3819.0415.1319.1012.1318.64
Sulfur (S)5.521.452.421.412.991.41
Calcium (Ca)19.6538.6126.8539.7522.1738.12

Cross section cut.

Common protoplasmic elements (C, N, O) and processing elements (Au, Pd, Ga) are omitted. Listed in WT%.

Energy dispersive X-Ray spectrum of the large anterior hook of a Neoechinorhynchus personatus specimen from Mugil cephalus in the Mediterranean showing high levels of phosphorus and calcium and low levels of sulfur. The X-ray data are the elemental analysis of the whole hook (see bolded figures in Table 3). Insert: SEM of a deep Gallium cut at the base of a hook. Energy dispersive X-ray spectrum of the small posterior hook of a Neoechinorhynchus personatus specimen from Mugil cephalus in the Mediterranean showing markedly lower levels of phosphorus and calcium, and considerably lower levels of sulfur than anterior hooks (Fig. 37). The X-ray data are the elemental analysis of the whole hook (see bolded figures in Table 3). Insert: SEM of a deep Gallium cut at the base of a hook. Results of the X-ray microanalysis for elements present in the base of hooks of Neoechinorhynchus personatus from Mugil cephalus in two different geographical locations, the Mediterranean Sea off Tunisia and the Black Sea. Weight percent (Wt%) and Atom percent (AT%) are based on a total of 100 percent. Note: C, H, O, N are common elements in all protoplasm. Pd (palladium) and Au (gold) are used to count the specimen before viewing, Ga (gallium) is used to make fine cuts (dual beam) of specimens. See Figures 37 and 38 for EDXA spectra of bolded WT% of anterior and posterior hooks of N. personatus from the Mediterranean. Note that the levels of sulfur are about twice as high and the levels of calcium and phosphorous, relatively lower in all measurements (%) from specimens in the Black Sea than in those from the Mediterranean off Tunisia. Results of the X-ray microanalysis for elements present in the intact hooks of two species of Neoechinorhynchus, N. personatus from Mugil cephalus in the Mediterranean off Tunisia and N. ponticus from Chelon auratus in the Black Sea. Weight percent (WT%) is based on a total of 100. C, O, N are common elements of the protoplasm. Pd (palladium), Au (gold) and Ga (gallium) are omitted from the chart. Chemical composition of a small hook of Neoechinorhynchus personatus cut* at the three levels with a Gallium beam (LMIS) from a dual beam SEM. Cross section cut. Common protoplasmic elements (C, N, O) and processing elements (Au, Pd, Ga) are omitted. Listed in WT%. Chemical composition of the base of large hooks for Neoechinorhynchus personatus and N. ponticus cut on a longitudinal axis with a Gallium beam (LMIS) from a dual beam SEM. Common protoplasmic elements (C, N, O) and processing elements (Au, Pd, Ga) are omitted. Listed in WT%.

Neoechinorhynchus ponticus n. sp. (Figs. 2, 4, 8, 10, 31–36)

urn:lsid:zoobank.org:act:F8CCB681-DDA9-4FD4-A240-54D57342646B Type-host: Chelon auratus Risso (Mugilidae). Type-locality: The Black Sea at Zalizny Port (46°7′ N, 32°17′ E). Site of infection: Intestine. Type-specimens: Harold W. Manter Lab collection no. HWML 102005 (holotype male and paratypes on same slide). Etymology: The new species is named for the historical Greek name of the Black Sea. The following description is based on the microscopic examination of 19 specimens of acanthocephalans (9 males, 10 females) from Chelon auratus in the Black Sea and on 6 more specimens examined by SEM. The supply of hosts limited the number of specimens available for this study. The description addresses mostly qualitative features that apply to specimens from this one host species in the Black Sea. Morphological and morphometric data are presented in Table 2. Biochemical, EDXA and molecular analysis are addressed separately, below.

Description

General: With characters of the genus Neoechinorhynchus as designated by Amin [1] (Neoechinorhynchidae). Medium-sized sexually mature adults. Shared structures larger in females than in males. Trunk somewhat enlarged anteriorly, gradually tapering at both ends (Figs. 2, 4). Body wall with electron dense micropores ducting into subcutaneous layer with multiple branching. Neck prominent with paired sensory pores (Fig. 31) and elevated pebble-like protrusions (Fig. 35). Body wall with prominent reticular lacunar system characteristically manifesting as heavily stained and lightly stained bands alternating at regular intervals, and with 5–7 (usually 6) dorsal and 1–3 (usually 2) giant hypodermal nuclei (Figs. 2, 4). Muscular ring at anterior trunk variable but often prominent (Fig. 8). Proboscis cylindrical, truncated and widest in anterior half, relatively but consistently wider than long, with prominent apical organ having 2 conspicuous nuclei at its distal end. Apical organ (Fig. 32) may reach or surpass level of posterior hooks, with 2 prominent giant nuclei (Fig. 8). All hooks with longitudinal serrations (Figs. 33, 34), rooted, most robust anteriorly, smallest posteriorly. Hook roots prominent but markedly shorter than blades, with anteriorly directed manubria. Manubria least prominent in largest anterior hooks (Fig. 10). Proboscis receptacle single-walled, slightly longer than 4 times as long as proboscis with cerebral ganglion at its base. Lemnisci of moderate size, digitiform, subequal, with 2 large oval giant nuclei each at widest part, falling far short of anterior testis and somewhat shorter in females (Figs. 2, 4).
Figures 31–36

SEM of specimens of Neoechinorhynchus ponticus n. sp. from Chelon auratus from the Black Sea. 31. The proboscis and neck of a male specimen showing the comparatively smaller hooks than in N. personatus and one of the neck sensory pores (arrow). 32. An apical view of a proboscis showing the pore of the apical organ (arrow). 33. The longitudinally serrated anterior proboscis hook of a specimen. 34. Detail of the serration pattern on the hook shown in Figure 33. 35. Detail of the pebbled surface of the neck of a specimen. 36. Detail of the female gonopore.

Male (see Table 2 for measurements): Reproductive system in posterior half of trunk. Testes equal, equatorial to post equatorial, oblong, contiguous with male reproductive structures extending into bursa. Cement gland larger than either testes, usually with about 8 giant nuclei in adults but with up to 18 nuclei in juveniles. Cement reservoir just posterior to cement gland and less than half its size. Common sperm duct prominent. Saefftigen’s pouch prominent, about as long as cement gland, overlapping common sperm duct and often obscured by it (Fig. 2). Bursa usually longer than wide. Female (see Table 2 for measurements). Reproductive system about 10% length of trunk, with prominent strand connecting anterior end of uterus at uterine glands with posterior body wall near vagina dorsally. Vagina not especially muscular. Uterus and uterine bell of moderate length, with terminal to near terminal gonopore (Fig. 36). Eggs not observed; only ovarian balls present.

EDXA results for N. ponticus n. sp.

Tables 4, 6 and 7 and Figure 39 represent mineral (element) composition of the hooks of N. ponticus. Overall results are somewhat similar to those of N. personatus based on an average of the quantitative amounts, except that specimens of N. ponticus from the Black Sea exhibit higher levels of sulfur and lower levels of calcium (Tables 4, 6). The anterior large hooks have a marked difference in calcium (Ca) and sulfur (S) in comparison to the posterior small hooks (calcium 47.61 wt% versus 4.48 wt%; sulfur 2.99 wt% versus 36.42 wt%, respectively) (Table 7). These are figures from the base of hooks. Intact hooks showed the same pattern (Table 4). The base of the large anterior hooks appears to exhibit the highest level of calcium, as with N. personatus (Fig. 6).
Table 7

Weight percent (WT%) for three major elements* in cross section cuts of the anterior hook and the posterior hook of Neoechinorhynchus ponticus n. sp.

Anterior hook
Posterior hook
Base (A)
Entry (B)
Tip (C)
Base (A)
Entry (B)
Tip (C)
WT%WT%WT%WT%WT%WT%
Phosphorus (P)18.18 4.15 13.12 ** 17.4713.361.77
Calcium (Ca)47.6165.20 26.39 4.4839.6536.42
Sulfur (S)2.991.0 6.22 36.423.604.48

Pd (palladium) and Au (gold) were used to count the specimens. Ga (gallium) was used for the cross cut of the hooks; other elements (C, O, N) are common in organic matter.

See Figure 39 for EDXA spectrum of bolded WT% of tip of anterior hook of N. ponticus from the Black Sea. Inset: anterior hooks. Note that sulfur is much higher (36.42%) at the base of the posterior hook, calcium is highest (65.20%) at the entry of the anterior hook, and phosphorous is slightly higher (18.18%) at the base of the anterior hook.

Figure 39

Energy dispersive X-ray spectrum of the tip of the anterior hook of a Neoechinorhynchus ponticus specimen from Chelon auratus in the Black Sea showing moderate levels of phosphorous, high levels of calcium, and moderate levels of sulfur. The X-ray data are the elemental analysis of the tip of the anterior hook (see bolded figures in Table 7). Insert: SEM of anterior hooks.

Energy dispersive X-ray spectrum of the tip of the anterior hook of a Neoechinorhynchus ponticus specimen from Chelon auratus in the Black Sea showing moderate levels of phosphorous, high levels of calcium, and moderate levels of sulfur. The X-ray data are the elemental analysis of the tip of the anterior hook (see bolded figures in Table 7). Insert: SEM of anterior hooks. Weight percent (WT%) for three major elements* in cross section cuts of the anterior hook and the posterior hook of Neoechinorhynchus ponticus n. sp. Pd (palladium) and Au (gold) were used to count the specimens. Ga (gallium) was used for the cross cut of the hooks; other elements (C, O, N) are common in organic matter. See Figure 39 for EDXA spectrum of bolded WT% of tip of anterior hook of N. ponticus from the Black Sea. Inset: anterior hooks. Note that sulfur is much higher (36.42%) at the base of the posterior hook, calcium is highest (65.20%) at the entry of the anterior hook, and phosphorous is slightly higher (18.18%) at the base of the anterior hook. Tkach et al. [35] and Sarabeev et al. [31] satisfactorily differentiated 3 species in the N. agilis complex: N. agilis sensu stricto, N. personatus, and N. yamagutii from each other and from related species of Neoechinorhynchus Stiles and Hassall, 1905 outside of the N. agilis complex. The morphological features of our specimens from M. cephalus off the Tunisian Mediterranean and in the Ukrainian Black Sea are consistent with those of N. personatus, and so are the molecular profiles. Specimens of N. ponticus n. sp. from C. auratus in the Black Sea are clearly morphologically distinguished from those of N. personatus by the markedly smaller size of their trunk, proboscis, hooks, receptacle, lemnisci, testes and other male reproductive system structures (Table 2). In addition, the shorter lemnisci in N. ponticus occupy a considerably smaller trunk space distant from the anterior testis (Fig. 2) compared to usually overlapping with it in N. personatus (Fig. 1). In N. agilis, the lemnisci are also distant from the testes, as in N. ponticus, but the roots of its anterior and middle hooks are much shorter in N. agilis with diminished manubria. In N. ponticus n. sp., the proboscis and proboscis receptacle are markedly longer while the hooks and testes are considerably smaller than in N. agilis; see Table 2 of Tkach et al. [35] and Table 2 (this paper). Specimens of N. ponticus lack the terminal papillae posterior to the gonopore characteristic of N. agilis. The description of N. yamagutii by Tkach et al. [35] was heavily based on the description of N. agilis by Yamaguti [40] from M. cephalus in the Inland Sea and the Pacific coast of Mie Prefecture. Specimens of N. yamagutii, like those of N. personatus, have long unequal lemnisci reaching and overlapping the anterior testis (our Fig. 1 and Fig. 24 of Tkach et al. [35]) but they are larger worms with a considerably longer trunk (females reaching 25 mm) than N. ponticus and, unlike N. ponticus (Fig. 4), with decidedly subterminal female gonopore (Fig. 20 of Tkach et al. [35]). In N. yamagutii, the middle hooks are about half as long as the anterior hooks and barely longer than the posterior hooks. In N. ponticus n. sp., the transition in hook size from anterior is more gradual (our Table 2, and Table 4 of Tkach et al. [35]). In N. ponticus, the receptacle is larger but the testes and cement glands are considerably smaller than in N. yamagutii. In the description of N. yamagutii by Tkach et al. [35] references to Saefftigen’s pouch (1.00 long in Yamaguti [40]), or to the bursa (1.4 mm long in Yamaguti [40]) were missing.

Molecular analysis

All N. ponticus n. sp. and N. personatus specimens successfully showed amplification of about 1300 bp for the partial 18S rDNA gene. The 18S rDNA dataset (1047 nt) included 25 sequences for different species of the genus Neoechinorhynchus, 3 N. ponticus n. sp. and 4 N. personatus sequences obtained in this study. Multiple alignment indicated that intra-species homology within N. ponticus n. sp. was 100%. Furthermore, pairwise distance illustrated the presence of an intra-species distance rate of 0–0.19% within N. personatus specimens obtained in the current study, and 0.18–0.67% compared to those with the sequences available in GenBank. Inter-generic differences based on partial 18S rDNA sequence between N. ponticus n. sp. with N. personatus, N. agilis, N. yamagutii, N. dimorphospinus, N. buttnerae, N. crassus, N. pseudemydis, N. cylindratus, N. beringianus, N. saginata and N. simansularis as other members of the genus Neoechinorhynchus were 3.24–4.49%, 3.26–3.69%, 3.84%, 3.49%, 5.06%, 5.45%, 14.91%, 4.55%, 4.02%, 5.12% and 4.02%, respectively. The sequence divergence based on the partial sequence of 18S rDNA between N. personatus with N. ponticus n. sp., N. agilis, N. yamagutii, N. dimorphospinus, N. buttnerae, N. crassus, N. pseudemydis, N. cylindratus, N. beringianus, N. saginata and N. simansularis was 3.24–3.76%, 2.18–2.78%, 6.22–6.60%, 7.11–7.34%, 10.21–10.46%, 10.45–10.72%, 14.42–14.70%, 9.60–9.86%, 10.32–10.60%, 10.13–10.39% and 10.32–10.60%, respectively. The phylogenetic analysis illustrated two main clades. Clade I included species of Neoechinorhynchus associated with saltwater fishes, whereas clade II consisted of species from freshwater fishes. As shown in clade I, our sequences of N. personatus (MT020792 – MT020795) grouped with N. personatus isolates (MN149068, MN149069 and MN149071) from Ukraine with high statistical support. In addition, N. agilis (MN148893 and MN148895) clustered as a sister group of N. personatus isolates with high support. In addition, an unidentified species of Neoechinorhynchus (HM545898), N. dimorphospinus (MK510080) and N. yamagutii (MN149220) clustered as a sister group of the mentioned cluster with strong support. Our sequences of N. ponticus n. sp. (MT020789 – MT020791) are located at the basal position to the members of the N. agilis complex clade with 98% bootstrap support. Indeed, N. buttnerae (MK249749), N. crassus (KU363971), N. pseudemydis (KU363973), N. cylindratus (MF974925), N. beringianus (KF156875), N. saginata (AY830150) and N. simansularis (KF156877) clustered in clade II (Fig. 40).
Figure 40

Phylogenetic tree of isolates of the two species of Neoechinorhynchus obtained in this study (▲) and other members of genus Neoechinorhynchus as retrieved from GenBank based on the partial 18S rDNA gene. The tree was constructed based on the maximum likelihood test and the Tamura 3-parameter model in MEGA6. Echinorhynchus gadi, Corynosoma enhydri and Bolbosoma caenoforme sequences were used as the out group. Bootstrap values lower than 70 were omitted.

Phylogenetic tree of isolates of the two species of Neoechinorhynchus obtained in this study (▲) and other members of genus Neoechinorhynchus as retrieved from GenBank based on the partial 18S rDNA gene. The tree was constructed based on the maximum likelihood test and the Tamura 3-parameter model in MEGA6. Echinorhynchus gadi, Corynosoma enhydri and Bolbosoma caenoforme sequences were used as the out group. Bootstrap values lower than 70 were omitted.

Electron dense micropores

Micropores were observed to be comparable in both species, N. personatus and N. ponticus in various trunk regions and were documented for specimens of N. personatus (Figs. 17, 20, 26, 29, 30). Unusual knobby epidermal surface of the neck (Figs. 17, 19, 26–28, 35) was also observed in both species.

Discussion

Morphometrics

None of the earlier descriptions of this variable acanthocephalan, N. agilis, accounted alone for its extreme morphometric variability. Host species and geography were not considered in the accounts given by Hamann [13], Linton [19-21], Van Cleave [36, 37], Meyer [23], Yamaguti [40, 41], Petrochenko [24], Gaevskaya et al. [10], Tepe & Oguz [34], and Tkach et al. [35], among others who described “N. agilis” from at least 10 species of hosts. Altogether, descriptions by the above cited authors gave an extreme range of variation in taxonomically important traits including trunk length of 7.00–45.00 mm, anterior, middle and posterior hook length of 70–150, 39–87, 20–71 respectively, proboscis receptacle 178–700 × 89–240, and testes 394–1820 × 97–570. Van Cleave [37] provided the most detailed description of the variability in N. agilis based on the examination of Rudolphi’s specimens from the Berlin Museum and the reports of the Dujardin, Stossich, Hamann, Condorelli, Porta, Monticelli, and Parona collections from Toulouse, Trieste, Rome, and Genoa (Table IV of Van Cleave [37]). Van Cleave [37] “found characterizations so diverse that it was difficult to determine whether the conflicting data represented individual variability within the species or resulted from inaccurate observations and erroneous identifications.”

The species complex

None of the above accounts considered the possibility of dealing with a species complex. Tkach et al. [35] split N. agilis into three species (the nominal N. agilis and two new species) that overlapped in measurements of such important taxonomic traits as hook size and were collected from M. cephalus and other mugilids from various locations from the Mediterranean to Japan. Tkach et al. [35] collected one species, N. personatus, from M. cephalus, C. auratus and Planiliza haematocheila in the Mediterranean and in the Black Sea. Our specimens from M. cephalus in both locations proved to be N. personatus but those from C. auratus in the Black Sea turned out to be a different species, N. ponticus n. sp. The case for correlating taxonomic decisions with morphometric data, individual host species and geography was not clearly made by Tkach et al. [35]. These authors listed their N. agilis only from thick lipped grey mullet, Chelon labrosus Risso, leaving the type host “undefined” because of difficulties of ascertaining the host species from which Rudolphi’s [30] nine specimens were taken in Spezia, Italy (Type locality) as well as from the Bay of Biscay (Atlantic), and the Gulf of Santa Pola, Júcar Estuary (Mediterranean). It is worth noting that specimens of N. agilis identified by Linton [19] in the Atlantic off Wood’s Hole, Massachusetts, USA from the common eel, Anguilla rostrata Lesueur (Anguillidae), and the dusky shark, Carcharhinus obscurus Lesueur (Carcharhinidae), and in Fulton Market, New York from the white perch, Roccus americanus Gmelin (Moronidae) were correctly identified. Linton [19] did not provide a description, measurements or measurement bars of his whole male specimen (Fig. 70) that showed compatible proportions and disposition of the internal organs, including short lemnisci distant from the anterior testis characteristic of that species. This 130-year-old record alone expands the range of host and geographical distribution of N. agilis. In our study, morphological differences noted in specimens from M. cephalus and C. auratus in the same location in the Black Sea (Table 2) correlate well with the designation of two different species of acanthocephalans supported by molecular data, N. personatus and N. ponticus n. sp., respectively. Measurements of key taxonomic characteristics of males and females of “N. agilis”, e.g. trunk, proboscis, hooks, testes, and eggs, from C. auratus on the Black Sea coasts of Turkey by Tepe and Oğuz ([34]; their Table 2) are very similar to those of N. ponticus n. sp. from the same host and body of water. We, therefore, assign the specimens reported by Tepe and Oğuz [34] to N. ponticus n. sp.

Intraspecific morphological variations

Morphometric variations in specimens of N. personatus from the same host species, M. cephalus, in the Mediterranean and from the Black Sea (Table 2), would point to intraspecific geographical variations. Van Cleave [37] made a vague reference to “geographical varieties” that was not supported by hard data. The observed variations are comparable to the more dramatic case of Mediorhynchus papillosus Van Cleave, 1916 (Gigantorhynchidae) featured by Amin and Dailey [2]. These authors studied key taxonomic characteristics in various geographical populations of M. papillosus which has a wide range of distribution in at least 73 species of birds outside of North and South America in Asia from Taiwan to the east into China, many of the former Soviet Republics, and to Eastern Europe to the west. Amin and Dailey [2] demonstrated a distinct geographically-based variability, especially in the size of proboscis and its armature, neck, receptacle, and testes, that appeared related to geographical restrictions, intermediate and definitive host specificity and distribution, and host feeding behavior. We recognize that many fish hosts of species of Neoechinorhynchus are migratory and that their feeding grounds and specimen collecting localities may not always be the same. However, this situation is also comparable to that of migratory bird hosts of M. papillosus. Micropores are present throughout the epidermal surface of the trunk of species of Neoechinorhynchus, like those reported in other species of the Acanthocephala, are associated with internal crypts, and vary in diameter and distribution in different trunk regions corresponding with differential absorption of nutrients. We have documented this phenomenon in 16 species of acanthocephalans [16] and a few more since. The functional aspects of micropores in a few other acanthocephalan species including Rhadinorhynchus ornatus Van Cleave, 1918, Polymorphus minutus (Goeze, 1782) Lühe, 1911, Moniliformis moniliformis (Bremser, 1811) Travassos (1915), Macracanthorhynchus hirudinaceus (Pallas, 1781) Travassos (1916, 1917), and Sclerocollum rubrimaris Schmidt and Paperna, 1978 were reviewed earlier by Amin et al. [3]. We demonstrated the tunneling from the cuticular surface into the internal crypts by TEM (Figs. 26, 29, 30). Wright and Lumsden [39] and Byram and Fisher [8] reported that the peripheral canals of the micropores are continuous with canalicular crypts. These crypts appear to “constitute a huge increase in external surface area … implicated in nutrient uptake.” Whitfield [38] estimated a 44-fold increase at a surface density of 15 invaginations per 1 μm² of Moniliformis moniliformis (Bremser, 1811) Travassos, 1915 tegumental surface. The micropores and the peripheral canal connections to the canaliculi of the inner layer of the tegument of Corynosoma strumosum (Rudolphi, 1802) Lühe, 1904 from the Caspian seal Pusa caspica (Gmelin) in the Caspian Sea were demonstrated by transmission electron micrographs in Amin et al. [4] and in the present material from N. personatus from M. cephalus in Tunisia (Figs. 26, 29, 30). We cannot explain the nature or functionality of the pebble-shaped texture of the neck in specimens of these two acanthocephalan species from either M. cephalus or C. auratus. We can, however, use this unique feature as a diagnostic tool for these two species. We do not know if the necks of other species of the N. agilis complex are similar. We do know that other species of Neoechinorhynchus that we have studied did not possess this feature.

Energy dispersive X-ray analysis

Our studies of acanthocephalan worms have usually involved X-ray scans (EDXA) of gallium cut hooks and other worm structures [14, 15, 33]. Both large and small hooks were evaluated for chemical ions, with sulfur (S), calcium (Ca) and phosphorus (P) being the prominent elements. Sulfur as expected, was high especially at the outer edge of large hooks of specimens from the Black Sea. Calcium and phosphorus are major ions at the base and middle of the hooks (Table 3). There was a difference in chemical content for large and small hooks. Large hooks play a major role in host tissue attachment, which may account for the difference. The anterior and posterior hooks of our N. personatus from M. cephalus in the Mediterranean and Black Sea had comparable biochemical profiles, especially for phosphorous. Variable levels of sulfur and calcium in hooks between the Mediterranean and the Black Sea specimens (Table 3) may be attributable to different levels of accumulation of metals in the two bodies of water. It should be noted, however, that extreme differences may occur in different parts of the same hook of acanthocephalan species found in the same host at a single location, or between anterior vs. posterior hooks on the same proboscis. The levels of sulfur were markedly higher in N. ponticus from the Black Sea compared to N. personatus from the Mediterranean which may also be attributable to the rich resources of sulfur in the Black Sea [9]. For instance, in Cavisoma magnum (Southwell, 1927) Van Cleave, 1931 from Mugil cephalus in the Arabian Sea, unusually high levels of sulfur in hook tips (43.51 wt%) and edges (27.46 wt%) were found. The center and base of hooks of the same worms had negligible sulfur levels and contained mostly phosphorus and calcium, the two other essential elements for hook structure [5]. Like fingerprints, the EDXA appear to be species-specific and has significant diagnostic value in acanthocephalan systematics [6]. For example, Moniliformis cryptosaudi Amin, Heckmann, Sharifdini, and Albayati, 2019 was erected based primarily on its EDXA pattern [6]. Our methodology for the detection of the chemical profile of hooks in the Acanthocephala has also been used in other parasitic groups including the Monogenea [27, 29] and Cestoda [28]. We also provide chemical and molecular data to explain and clarify our findings. In the last few decades, a PCR-sequencing technique was applied for assessment of taxonomic identification, diversity and phylogenetic relationships among acanthocephalan species [11]. Inter-generic differences are noted between N. ponticus n. sp. and N. personatus with other members of the genus Neoechinorhynchus based on partial 18S rDNA being 3.24–14.91% and 2.18–14.70%, respectively. The relatively high genetic differences between N. ponticus n. sp. and other species of the Neoechinorhynchus supports the morphological observation indicating it is an independent species. Sarabeev et al. [31] showed that N. agilis, N. personatus and N. yamagutii are three independent species using the same phylogenetic analysis of partial sequences of the 18S rRNA gene. Our data, consistent with results of other studies [22, 31], indicated genetic divergences among these three species were relatively high, at the range between 2.18% and 6.60%. The phylogenetic analysis of the partial 18S rDNA gene illustrated that our sequence of N. personatus clustered with N. personatus isolates from Ukraine. Genetic differences between N. agilis and N. personatus were found to be low. Moreover, the tree also showed they are two closely related species. Our sequences of N. ponticus n. sp. were placed separately from other species of Neoechinorhynchus in clade I with strong support. The position of N. ponticus n. sp. along with other species of Neoechinorhynchus from saltwater fishes including N. dimorphospinus, N. yamagutii, N. agilis and N. personatus in the tree, indicated that all these species share a common ancestor. This would make N. dimorphospinus a candidate for membership in the N. agilis complex (see Fig. 40) especially that specimens of N. dimorphospinus are morphologically comparable to the 4 species of the N. agilis complex. It is also grouped with them in one major clade with 93% similarity with the Tunisian N. personatus. However, N. dimorphospinus is distinguishable morphologically by having the 2 lateral proboscis hooks in the anterior ring being considerably longer than the other 4 hooks in the same ring. It has been found in 6 species in 4 families of marine fish in the Persian Gulf and in the Pacific Ocean off Vietnam. In species of Neoechinorhynchus, high level of variation in the cox1 gene would provide better resolution of the relationships within closely related taxa [25]. Due to the lack of sufficient sequences of cox1 sequences of N. agilis complex in GenBank for comparison, we did not perform molecular analysis of these specimens with this gene. Pinacho-Pinacho et al. showed that the cox1 gene is an informative molecular marker compared to the ITS and 28S rDNA genes for detection of cryptic species complexes in Neoechinorhynchus in Middle America [25]. However, their analysis is for the species inhabiting fresh and brackish water fish across Middle America, a different zone from our study areas. Providing additional genetic markers as well as obtaining more specimens of these species from different geographical locations and hosts would be useful to better understand their phylogenetic relationships.
  13 in total

1.  Revision of Neoechinorhynchus Stiles & Hassall, 1905 (Acanthocephala: Neoechinorhynchidae) with keys to 88 species in two subgenera.

Authors:  Omar M Amin
Journal:  Syst Parasitol       Date:  2002-09       Impact factor: 1.431

2.  The occurrence of acanthocephalans in teleost fish from the Bizerte lagoon, Tunisia.

Authors:  L Gargouri; R Antar; F Zarrouk; F Maamouri
Journal:  J Helminthol       Date:  2015-03-02       Impact factor: 2.170

3.  Phylogenetic relationships of Palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences.

Authors:  Martín García-Varela; Steven A Nadler
Journal:  J Parasitol       Date:  2005-12       Impact factor: 1.276

4.  The absorptive surface of Moniliformis dubius (Acanthocephala). I. Fine structure.

Authors:  J E Byram; F M Fisher
Journal:  Tissue Cell       Date:  1973       Impact factor: 2.466

5.  Redescription of Rhadinorhynchus ornatus (Acanthocephala: Rhadinorhynchidae) from skipjack tuna, Katsuwonus pelamis, collected in the Pacific Ocean off South America, with special reference to new morphological features.

Authors:  Omar M Amin; Richard A Heckmann; Nahla A E Radwan; Johan S Mantuano Anchundia; Marcos A Zambrano Alcivar
Journal:  J Parasitol       Date:  2009-06       Impact factor: 1.276

6.  Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

Authors:  Boris Malyarchuk; Miroslava Derenko; Ekaterina Mikhailova; Galina Denisova
Journal:  Parasitol Int       Date:  2013-09-21       Impact factor: 2.230

7.  New perspectives on Nephridiacanthus major (Acanthocephala: Oligacanthorhynchidae) collected from hedgehogs in Iran.

Authors:  O M Amin; M Sharifdini; R A Heckmann; M Zarean
Journal:  J Helminthol       Date:  2020-03-02       Impact factor: 2.170

8.  Cavisoma magnum (Cavisomidae), a unique Pacific acanthocephalan redescribed from an unusual host, Mugil cephalus (Mugilidae), in the Arabian Gulf, with notes on histopathology and metal analysis.

Authors:  Omar M Amin; Richard A Heckmann; Majid A Bannai
Journal:  Parasite       Date:  2018-02-09       Impact factor: 3.000

9.  Morphological Studies of Developmental Stages of Oculotrema hippopotami (Monogenea: Polystomatidae) Infecting the Eye of Hippopotamus amphibius (Mammalia: Hippopotamidae) Using SEM and EDXA with Notes on Histopathology.

Authors:  Nataliya Yu Rubtsova; Richard A Heckmann; Willem J Smit; Wilmien J Luus-Powell; Ali Halajian; Francois Roux
Journal:  Korean J Parasitol       Date:  2018-10-31       Impact factor: 1.341

10.  Structure and Morphometrics of Ancyrocephalus Paradoxus (Monogenea: Ancyrocephalidae) from Sander Lucioperca (Percidae) in Czechia.

Authors:  N Yu Rubtsova; R A Heckmann
Journal:  Helminthologia       Date:  2019-03-06       Impact factor: 1.184

View more
  5 in total

1.  The morphological and molecular description of Neoechinorhynchus (Neoechinorhynchus) poonchensis sp. n. from Schizothorax richardsonii (Gray) in Poonch, Jammu and Kashmir, India.

Authors:  Omar Mohamed Amin; Mumtaz Ahmed; Anshu Chaudhary; Richard Anderson Heckmann; Hridaya Shanker Singh
Journal:  Folia Parasitol (Praha)       Date:  2022-01-05       Impact factor: 2.122

2.  Morphological and molecular characterization of Neoechinorhynchus (N.) cephali n. sp. (Acanthocephala: Neoechinorhynchidae) Stiles and Hassall 1905 infecting the flathead grey mullet Mugil cephalus (Linnaeus, 1758) from the southwest coast of India.

Authors:  Pinky Kaur; N K Sanil
Journal:  Parasitol Res       Date:  2021-08-19       Impact factor: 2.289

3.  Morphological and Molecular Description of Immature Southwellina hispida (Van Cleave, 1925) Witenberg, 1932 (Acanthocephala: Polymorphidae) from the Body Cavity of the Paratenic Host Gillichthys mirabilis Cooper (Gobiidae) in California, with Analyses of the Chemical Composition of Hooks and Spines.

Authors:  Omar M Amin; Anshu Chaudhary; Hirdaya S Singh
Journal:  Acta Parasitol       Date:  2022-04-27       Impact factor: 1.534

4.  A comparative assessment of the morphology of Profilicollis altmani (Acanthocephala, Polymorphidae) from crustaceans and shore birds in Peru, with special notes on hook elemental analysis (EDXA), SEM imaging, histopathology, and molecular profile.

Authors:  Omar M Amin; Sara M Rodríguez; Nataliya Rubtsova; Richard A Heckmann; César Peña; Teresa Castro; Felipe Rivera; Guillermo D'Elía
Journal:  Parasite       Date:  2022-02-22       Impact factor: 3.000

5.  Redescription and Molecular Characterization of Pachysentis canicola Meyer, 1931 (Acanthocephala: Oligacanthorhynchidae) from the Maned Wolf, Chrysocyon brachyurus (Illiger, 1815) in Texas.

Authors:  Omar M Amin; Anshu Chaudhary; Richard A Heckmann; Julie Swenson; Hridaya S Singh
Journal:  Acta Parasitol       Date:  2021-08-03       Impact factor: 1.440

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.