| Literature DB >> 32659114 |
Jianfeng Xu1,2,3, Zhiyong Liu1,3, Yang Liu2, Guiqiang Wu2, Lingyong Zeng2, Jianguo Xu1.
Abstract
The purpose of our study was to investigate the inhibitory effect of carboplatin injection on human neuroblastoma human neuroblastoma cell (SK-N-SH) cells and to clarify its action mechanism. In this study, human neuroblastoma SK-N-SH cells were divided into two groups. The treatment group was intervened by carboplatin injection (25 μM), while the control group was intervened by drug solvent. After treating separately for 24 and 72 h, the cells were collected, and western blot (WB) and real-time PCR were used to detect the expression of the proliferation marker protein (Ki67); cells grown on cover slips were prepared and immunocytochemistry (ICC) and hematoxylin-eosin (HE) staining were adopted to observe the protein expression of Ki67 and the morphological changes of the cells; clone formation assay was used to detect the clonality of each cell group. The cytotoxicity of carboplatin on SK-N-SH cell was checked by AlamarBlue viability test. Both WB and PCR results showed that after cells were injected with carboplatin for 24 and 72 h, the expression levels of both Ki67 gene and protein were decreased, and they had a significant difference from those of the control group. Carboplatin injection inhibited the expression of Ki67, and the inhibitory effect was particularly significant as the action time prolonged. ICC results showed that the protein expression of Ki67 in the treatment group was lower than that in the control group, and there was a significant difference in expression between them. As shown by HE results, the number of cell necrosis and apoptosis in the treatment group was significantly higher than that in the control group, while the results of clone formation assay showed that in the treatment group, after being injected with carboplatin, the proliferation ability of cells was inhibited, so the number of cells was significantly reduced compared with that of the control group. Carboplatin at the tested concentration displayed no cytotoxicity on SK-N-SH cell. The conclusions are that carboplatin injection can inhibit human neuroblastoma SK-N-SH cells, and the longer it acts on SK-N-SH cells, the more obvious the inhibitory effect would be.Entities:
Keywords: Ki67; carboplatin injection; human neuroblastoma SK-N-SH
Mesh:
Substances:
Year: 2020 PMID: 32659114 PMCID: PMC7586261 DOI: 10.1177/0963689720920815
Source DB: PubMed Journal: Cell Transplant ISSN: 0963-6897 Impact factor: 4.064
Primer Sequence.
| Primer name | Forward primer (5′–3′) | Reserve primer (5′–3′) |
|---|---|---|
| Ki67 | GCAGGACTTCACTTGCTTCC | TCATTTGCGTTTGTTTCAC |
Fig. 1.The gene expression of Ki67 in different treated cells. There was a significant difference between control-24 and CBP-24 (**P < 0.01); CBP-72 has a highly significant difference from control-72 and CBP-24 (**P < 0.001). CBP: carboplatin.
Fig. 2.The effect of different treatments on the expression of Ki67 protein. The expression level of the control group and the treatment group at the same time point and the expression level of CBP-24 and CBP-27 both had a highly significant difference (***P < 0.001). CBP: carboplatin.
Fig. 3.Pathological results after the treatment of SK-N-SH cells with carboplatin injection. (A) The ICC results showed that there was a highly significant difference in the expression of Ki67 between the treatment group and the control group (***P < 0.001); (B) after being injected with carboplatin, the cell apoptosis and necrosis were significantly higher than those of the control group. CBP: carboplatin.
Fig. 4.The effect of carboplatin injection on the proliferation of SK-N-SH cells. (A) Pictures of cloning formation assay; (B) There was a significant difference between control-24 and CBP-24 and between CBP-24 and CBP-72 (*P < 0.05); there was a significant difference between CBP-72 and control-72 (**P < 0.01). CBP: carboplatin.
Fig. 5.AlamarBlue assay of Carboplatin on SK-N-SH cell.