Literature DB >> 32657018

Pseudomonas glycinae sp. nov. isolated from the soybean rhizosphere.

Jiayuan Jia¹, Xiaoqiang Wang^1,2, Peng Deng¹, Lin Ma^1,3, Sonya M Baird¹, Xiangdong Li⁴, Shi-En Lu¹.

Abstract

Strains MS586T and MS82, which are aerobic, Gram-negative, rod-shaped, and polar-flagellated bacteria, were isolated from the soybean rhizosphere in Mississippi. Taxonomic positions of MS586T and MS82 were determined using a polyphasic approach. 16S rRNA gene sequence analyses of the two strains showed high pairwise sequence similarities (>98%) to some Pseudomonas species. Analysis of the concatenated 16S rRNA, rpoB, rpoD, and gyrB gene sequences indicated that the strains belonging to the Pseudomonas koreensis subgroup (SG) shared the highest similarity with Pseudomonas kribbensis strain 46-2T . Analyses of average nucleotide identity (ANI), genome-to-genome distance, delineated MS586T and MS82 from other species within the genus Pseudomonas. The predominant quinone system of the strain was ubiquinone 9 (Q-9), and the DNA G+C content was 60.48 mol%. The major fatty acids were C16:0 , C17:0 cyclo, and the summed features 3 and 8 consisting of C16:1 ω7c/C16:1 ω6c and C18:1 ω7c/C18:1 ω6c, respectively. The major polar lipids were phosphatidylglycerol, phosphatidylethanolamine, and diphosphatidylglycerol. Based on these data, it is proposed that strains MS586T and MS82 represent a novel species within the genus Pseudomonas. The proposed name for the new species is Pseudomonas glycinae, and the type strain is MS586T (accession NRRL B-65441 = accession LMG 30275).

Entities: Chemical Disease Gene Mutation Species

Keywords: zzm321990Pseudomonas glycinaezzm321990; average nucleotide identity; rhizosphere; soybean

Mesh：

Substances：

Year: 2020 PMID： 32657018 PMCID： PMC7520993 DOI： 10.1002/mbo3.1101

Source DB: PubMed Journal: Microbiologyopen ISSN： 2045-8827 Impact factor: 3.139

INTRODUCTION

The genus Pseudomonas was first described by Migula (1894). Strains of this genus have been found in natural habitats including plants, soil, animals, and water (Palleroni, 1994). Members of the genus Pseudomonas are known to be Gram‐negative, rod‐shaped, cream‐colored, and polar‐flagellated. Pseudomonas spp. have great metabolic and nutritional versatility. Some strains of Pseudomonas spp. play potential roles as bioremediation agents to alleviate various hazardous organic substrates, such as sodium dodecyl sulfate (Furmanczyk, Kaminski, Lipinski, Dziembowski, & Sobczak, 2018). Some strains of Pseudomonas spp. promote plant growth directly by facilitating resource acquisition or indirectly by decreasing the inhibitory effects of various pathogenic agents on plant growth and development; however, some other strains of Pseudomonas can act as pathogens inciting plant diseases (Moore et al., 1996; Oueslati et al., 2019; Ye et al., 2019). Over 200 species of Pseudomonas are included in the Bacterial Names with Standing in Nomenclature (http://www.bacterio.net). Numerous methods, including physiological, molecular, and phenotypic distinctions (Sneath, Stevens, & Sackin, 1981); 16S rDNA gene sequencing; and multilocus sequence analysis (MLSA) (Pascual, Macián, Arahal, Garay, & Pujalte, 2010), have been used to identify the taxonomic status of Pseudomonas species. With the accumulation of genomic data, the analysis of complete genomes is very useful in Pseudomonas taxonomy (Hesse et al., 2018; Peix, Ramirez‐Bahena, & Velazquez, 2018). Average nucleotide identity (ANI) values calculated from genome assemblies have been widely used for the taxonomy of bacteria (Konstantinidis & Tiedje, 2005). ANI evaluates a large number of nucleic acid sequences, including some that evolve quickly and others that evolve slowly, in its calculation and reduces the influence of horizontal gene transfer events or variable evolutionary rates. It has been suggested that species descriptions of bacteria and archaea should include a high‐quality genome sequence of at least the type strain as an obligatory requirement (Rosselló‐Móra & Amann, 2015). The current metagenome databases have shown evidence for approximately 8000 sequence‐discrete natural populations, which is roughly equivalent to species at the 95% ANI level (Rosselló‐Móra & Whitman, 2018). Genome‐to‐genome distance (GGDC 2.0) is another highly effective method for inferring whole‐genome distances. GGDC effectively mimics DNA‐DNA hybridization for genome‐based species delineation and subspecies delineation (Meier‐Kolthoff, Auch, Klenk, & Göker, 2013). Therefore, ANI and GGDC are highly effective ways to evaluate the genetic relatedness between genomes. Strains MS586T and MS82 were isolated from the rhizosphere soybean plants growing in fields where most plants were infected by the charcoal rot pathogen Macrophomina phaseolina. Plate bioassay indicated both strains MS586T and MS82 exhibited striking antimicrobial activity (Ma et al., 2017). This research is focused on the characterization of the taxonomic position of the two strains.

MATERIALS AND METHODS

Bacterial strains and growth conditions

MS586T and MS82 were isolated from a soybean rhizosphere sample by standard dilution plating on nutrient broth yeast extract (NBY) agar medium (Vidaver, 1967) at 28°C. Antimicrobial activity against multiple plant pathogens was detected with an antifungal plate assay as previously described (Gu, Wang, Chaney, Smith, & Lu, 2009). Following purification, the bacterium was preserved in 20% glycerol at −80°C. Pseudomonas spp. type strains and reference strains were provided by the Leibniz Institute DSMZ—German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). All strains used in this study are summarized in Table A1.

TABLE A1

List of strains used in this study

Species	Strain	Source collection
Pseudomonas glycinae	MS586	This study
Pseudomonas glycinae	MS82	Ma et al. (2017)
Pseudomonas moraviensis	1B4	DSMZ
Pseudomonas jessenii	CIP105274	DSMZ
Pseudomonas reinekei	MT1	DSMZ
Pseudomonas vancouverensis	DhA‐51	DSMZ
Pseudomonas baetica	a390	DSMZ

DSMZ: German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany.

Cell morphology and physiological tests

Colony morphology of the strains MS586T and MS82 was determined after growth on NBY agar plates. Gram staining was performed as described previously (Murray, Doetsch, & Robinow, 1994); cell morphology and flagellation types were observed with a transmission electron microscope (TEM) using routine negative glutaraldehyde staining; and the production of fluorescent pigments was tested on King B medium (King, Ward, & Raney, 1954). Optical density (OD600) metrics recorded for NBY liquid cultures were used to evaluate optimal growth and pH, at temperatures from 4°C to 40°C, with an interval of 4°C for 24 hr, and at pH 4.0–10.0. Physiological and biochemical tests were conducted as described previously (Peix, Berge, Rivas, Abril, & Velázquez, 2005). Cellular fatty acids were identified using the Sherlock 6.1 system (Microbial IDentification Inc.) and the library RTSBA6 (Sasser, 1990). Biochemical features and enzyme activities were determined using API 20 NE and API 50 CH strips with API 50 CHB/E medium (bioMerieux), as well as Biology GENIII Microplates (Biolog) as directed in the manufacturer's instructions; results were recorded after incubation for 48 hr at 28°C.

Phylogenetic analysis

Bacterial genomic DNA was extracted using the cetyltrimethylammonium bromide (CTAB) protocol (Doyle, 1987) and used as a template to amplify the nearly full‐length 16S rRNA gene. PCR was performed with the 16S rRNA universal primers 27F (5′‐AGAGTTTGATCMTGGCTCAG‐3′) and 1492R (5′‐TACGGHTACCTTGTTACGACTT‐3′) (Chelius & Triplett, 2000; Lane, 1991). Amplification and partial sequencing of rpoB (Tayeb, Ageron, Grimont, & Grimont, 2005), rpoD (Mulet, Bennasar, Lalucat, & García‐Valdés, 2009), and gyrB (Yamamoto et al., 2000) housekeeping genes were performed following previously described methods (Mulet et al., 2009) using primers LAPS (5′‐TGGCCGAGAACCAGTTCCGCGT‐3′)/LAPS27 (5′‐CGGCTTCGTCCAGCTTGTTCAG‐3′) for ropB, PsEG30F (5′‐ATYGAAATCGCCAARCG‐3′)/PsEG790R (5′‐CGGTTGATKTCCTTGA‐3′) for rpoD, and APrU (5′‐TGTAAACGACGGCCAGTGCNGGRTCYTTYTCYTGRCA‐3′)/UP1E (5′‐CAGGAAACAGCTATGACCAYGSNGGNGGNAARTTYRA‐3) for gyrB. All PCR was performed with a PTC‐200 Peltier Thermal Cycler (MJ Research), and products were purified using a Wizard SV Gel and PCR Clean‐Up System (Promega). Sanger sequencing reactions were performed using the Eurofins MWG Operon. Phylogenetic analysis of the multilocus sequence analysis (MLSA) was performed in MEGA 7 software using the maximum‐likelihood algorithm (Kumar, Stecher, & Tamura, 2016). The sequence fragments of the four genes (16s rRNA, rpoB, rpoD, and gyrB) were concatenated in the following order: 16s rRNA, rpoB, rpoD, and gyrB. Sequences of type strains used in the MLSA were downloaded from NCBI (accession numbers in Table A2). The maximum‐likelihood method was used to construct the phylogenetic tree with 1000 bootstrap replicates.

TABLE A2

Accession numbers of the sequences of different Pseudomonas spp. strains used in the MLSA phylogenetic analysis

Species	Gene name	Accession number	Strain designation	Species	Gene name	Accession number	Strain designation
P. glycinae	16S rRNA	MG692779	MS586^T	P. glycinae	16S rRNA	CP028826	MS82
	rpoB	CP014205	MS586^T		rpoB	CP028826	MS82
	rpoD	CP014205	MS586^T		rpoD	CP028826	MS82
	gyrB	CP014205	MS586^T		gyrB	CP028826	MS82
P. fluorescens	16S rRNA	CP000094	Pf0‐1	P. aeruginosa	16S rRNA	CP012001	DSM 50071^T
	rpoB	CP000094	Pf0‐1		rpoB	CP012001	DSM 50071^T
	rpoD	CP000094	Pf0‐1		rpoD	CP012001	DSM 50071^T
	gyrB	CP000094	Pf0‐1		gyrB	CP012001	DSM 50071^T
P. anguilliseptica	16S rRNA	FNSC00000000	DSM 12111^T	P. arsenicoxydans	16S rRNA	LT629705	CECT 7543^T
	rpoB	FNSC00000000	DSM 12111^T		rpoB	LT629705	CECT 7543^T
	rpoD	FNSC00000000	DSM 12111^T		rpoD	LT629705	CECT 7543^T
	gyrB	FNSC00000000	DSM 12111^T		gyrB	LT629705	CECT 7543^T
P. avellanae	16S rRNA	AKBS00000000	BPIC 631^T	P. baetica	16S rRNA	PKLC00000000	a390^T
	rpoB	AKBS00000000	BPIC 631^T		rpoB	PKLC00000000	a390^T
	rpoD	AKBS00000000	BPIC 631^T		rpoD	PKLC00000000	a390^T
	gyrB	AKBS00000000	BPIC 631^T		gyrB	PKLC00000000	a390^T
P. balearica	16S rRNA	CP007511	DSM 6083^T	P. bauzanensis	16S rRNA	FOGN00000000	DSM 22558^T
	rpoB	CP007511	DSM 6083^T		rpoB	FOGN00000000	DSM 22558^T
	rpoD	CP007511	DSM 6083^T		rpoD	FOGN00000000	DSM 22558^T
	gyrB	CP007511	DSM 6083^T		gyrB	FOGN00000000	DSM 22558^T
P. brassicacearum	16S rRNA	LT629713	LMG 21623^T	P. brenneri	16S rRNA	VFIL00000000	DSM 15294^T
	rpoB	LT629713	LMG 21623^T		rpoB	VFIL00000000	DSM 15294^T
	rpoD	LT629713	LMG 21623^T		rpoD	VFIL00000000	DSM 15294^T
	gyrB	LT629713	LMG 21623^T		gyrB	VFIL00000000	DSM 15294^T
P. capeferrum	16S rRNA	JMIT00000000	WCS358^T	P. corrugata	16S rRNA	LHVK00000000	DSM 7228^T
	rpoB	JMIT00000000	WCS358^T		rpoB	LHVK00000000	DSM 7228^T
	rpoD	JMIT00000000	WCS358^T		rpoD	LHVK00000000	DSM 7228^T
	gyrB	JMIT00000000	WCS358^T		gyrB	LHVK00000000	DSM 7228^T
P. fluorescens	16S rRNA	LT907842	ATCC 13525^T	P. frederiksbergensis	16S rRNA	FNTF00000000	LMG 19851^T
	rpoB	LT907842	ATCC 13525^T		rpoB	FNTF00000000	LMG 19851^T
	rpoD	LT907842	ATCC 13525^T		rpoD	FNTF00000000	LMG 19851^T
	gyrB	LT907842	ATCC 13525^T		gyrB	FNTF00000000	LMG 19851^T
P. fulva	16S rRNA	BBIQ00000000	NBRC 16637^T	P. gessardii	16S rRNA	VFEW00000000	DSM 17152^T
	rpoB	BBIQ00000000	NBRC 16637^T		rpoB	VFEW00000000	DSM 17152^T
	rpoD	BBIQ00000000	NBRC 16637^T		rpoD	VFEW00000000	DSM 17152^T
	gyrB	BBIQ00000000	NBRC 16637^T		gyrB	VFEW00000000	DSM 17152^T
P. graminis	16S rRNA	FOHW00000000	DSM 11363^T	P. granadensis	16S rRNA	LT629778	LMG 27940^T
	rpoB	FOHW00000000	DSM 11363^T		rpoB	LT629778	LMG 27940^T
	rpoD	FOHW00000000	DSM 11363^T		rpoD	LT629778	LMG 27940^T
	gyrB	FOHW00000000	DSM 11363^T		gyrB	LT629778	LMG 27940^T
P. helmanticensis	16S rRNA	HG940537	OHA11^T	P. jessenii	16S rRNA	NIWT01000000	DSM 17150^T
	rpoB	HG940518	OHA11^T		rpoB	NIWT01000000	DSM 17150^T
	rpoD	HG940517	OHA11^T		rpoD	NIWT01000000	DSM 17150^T
	gyrB	HG940516	OHA11^T		gyrB	NIWT01000000	DSM 17150^T
P. koreensis	16S rRNA	LT629687	LMG 21318^T	P. kribbensis	16S rRNA	CP029608	46‐2^T
	rpoB	LT629687	LMG 21318^T		rpoB	CP029608	46‐2^T
	rpoD	LT629687	LMG 21318^T		rpoD	CP029608	46‐2^T
	gyrB	LT629687	LMG 21318^T		gyrB	CP029608	46‐2^T
P. laurylsulfatiphila	16S rRNA	NIRS00000000	AP3_16^T	P. laurylsulfativorans	16S rRNA	MUJK00000000	AP3_22^T
	rpoB	NIRS00000000	AP3_16^T		rpoB	MUJK00000000	AP3_22^T
	rpoD	NIRS00000000	AP3_16^T		rpoD	MUJK00000000	AP3_22^T
	gyrB	NIRS00000000	AP3_16^T		gyrB	MUJK00000000	AP3_22^T
P. libanensis	16S rRNA	JYLH00000000	DSM 17149^T	P. lini	16S rRNA	JYLB00000000	DSM 16768^T
	rpoB	JYLH00000000	DSM 17149^T		rpoB	JYLB00000000	DSM 16768^T
	rpoD	JYLH00000000	DSM 17149^T		rpoD	JYLB00000000	DSM 16768^T
	gyrB	JYLH00000000	DSM 17149^T		gyrB	JYLB00000000	DSM 16768^T
P. linyingensis	16S rRNA	FNZE00000000	LMG 25967^T	P. litoralis	16S rRNA	LT629748	2SM5^T
	rpoB	FNZE00000000	LMG 25967^T		rpoB	LT629748	2SM5^T
	rpoD	FNZE00000000	LMG 25967^T		rpoD	LT629748	2SM5^T
	gyrB	FNZE00000000	LMG 25967^T		gyrB	LT629748	2SM5^T
P. lundensis	16S rRNA	JYKY00000000	DSM 6252^T	P. lutea	16S rRNA	JRMB00000000	DSM 17257^T
	rpoB	JYKY00000000	DSM 6252^T		rpoB	JRMB00000000	DSM 17257^T
	rpoD	JYKY00000000	DSM 6252^T		rpoD	JRMB00000000	DSM 17257^T
	gyrB	JYKY00000000	DSM 6252^T		gyrB	JRMB00000000	DSM 17257^T
P. mandelii	16S rRNA	LT629796	LMG 21607^T	P. migulae	16S rRNA	FNTY00000000	LMG 21608^T
	rpoB	LT629796	LMG 21607^T		rpoB	FNTY00000000	LMG 21608^T
	rpoD	LT629796	LMG 21607^T		rpoD	FNTY00000000	LMG 21608^T
	gyrB	LT629796	LMG 21607^T		gyrB	FNTY00000000	LMG 21608^T
P. mohnii	16S rRNA	FNRV01000000	DSM 18327^T	P. moorei	16S rRNA	VZPP00000000	CCUG 53114^T
	rpoB	FNRV01000000	DSM 18327^T		rpoB	VZPP00000000	CCUG 53114^T
	rpoD	FNRV01000000	DSM 18327^T		rpoD	VZPP00000000	CCUG 53114^T
	gyrB	FNRV01000000	DSM 18327^T		gyrB	VZPP00000000	CCUG 53114^T
P. moraviensis	16S rRNA	LT629788	LMG 24280^T	P. oleovorans	16S rRNA	UGUV00000000	NCTC10692^T
	rpoB	LT629788	LMG 24280^T		rpoB	UGUV00000000	NCTC10692^T
	rpoD	LT629788	LMG 24280^T		rpoD	UGUV00000000	NCTC10692^T
	gyrB	LT629788	LMG 24280^T		gyrB	UGUV00000000	NCTC10692^T
P. oryzihabitans	16S rRNA	BBIT00000000	NBRC 102199^T	P. otitidis	16S rRNA	FOJP00000000	DSM 17224^T
	rpoB	BBIT00000000	NBRC 102199^T		rpoB	FOJP00000000	DSM 17224^T
	rpoD	BBIT00000000	NBRC 102199^T		rpoD	FOJP00000000	DSM 17224^T
	gyrB	BBIT00000000	NBRC 102199^T		gyrB	FOJP00000000	DSM 17224^T
P. panipatensis	16S rRNA	FNDS00000000	CCM 7469^T	P. peli	16S rRNA	FMTL00000000	DSM 17833^T
	rpoB	FNDS00000000	CCM 7469^T		rpoB	FMTL00000000	DSM 17833^T
	rpoD	FNDS00000000	CCM 7469^T		rpoD	FMTL00000000	DSM 17833^T
	gyrB	FNDS00000000	CCM 7469^T		gyrB	FMTL00000000	DSM 17833^T
P. pertucinogena	16S rRNA	AB021380	IFO 14163^T	P. prosekii	16S rRNA	LT629762	LMG 26867^T
	rpoB	AJ717441	LMG 1874^T		rpoB	LT629762	LMG 26867^T
	rpoD	FN554502	LMG 1874^T		rpoD	LT629762	LMG 26867^T
	gyrB	DQ350613	JCM 11950^T		gyrB	LT629762	LMG 26867^T
P. psychrotolerans	16S rRNA	FMWB00000000	DSM 15758^T	P. punonensis	16S rRNA	FRBQ00000000	CECT 8089^T
	rpoB	FMWB00000000	DSM 15758^T		rpoB	FRBQ00000000	CECT 8089^T
	rpoD	FMWB00000000	DSM 15758^T		rpoD	FRBQ00000000	CECT 8089^T
	gyrB	FMWB00000000	DSM 15758^T		gyrB	FRBQ00000000	CECT 8089^T
P. putida	16S rRNA	AP013070	NBRC 14164^T	P. reinekei	16S rRNA	MSTQ00000000	MT1^T
	rpoB	AP013070	NBRC 14164^T		rpoB	MSTQ00000000	MT1^T
	rpoD	AP013070	NBRC 14164^T		rpoD	MSTQ00000000	MT1^T
	gyrB	AP013070	NBRC 14164^T		gyrB	MSTQ00000000	MT1^T
P. resinovorans	16S rRNA	AUIE00000000	DSM 21078^T	P. sagittaria	16S rRNA	FOXM00000000	JCM 18195^T
	rpoB	AUIE00000000	DSM 21078^T		rpoB	FOXM00000000	JCM 18195^T
	rpoD	AUIE00000000	DSM 21078^T		rpoD	FOXM00000000	JCM 18195^T
	gyrB	AUIE00000000	DSM 21078^T		gyrB	FOXM00000000	JCM 18195^T
P. straminea	16S rRNA	FOMO01000000	JCM 2783^T	P. stutzeri	16S rRNA	CP002881	CGMCC 1.1803^T
	rpoB	FOMO01000000	JCM 2783^T		rpoB	CP002881	CGMCC 1.1803^T
	rpoD	FOMO01000000	JCM 2783^T		rpoD	CP002881	CGMCC 1.1803^T
	gyrB	FOMO01000000	JCM 2783^T		gyrB	CP002881	CGMCC 1.1803^T
P. synxantha	16S rRNA	LR590482	NCTC10696^T	P. syringae	16S rRNA	JALK00000000	DSM 10604^T
	rpoB	LR590482	NCTC10696^T		rpoB	JALK00000000	DSM 10604^T
	rpoD	LR590482	NCTC10696^T		rpoD	JALK00000000	DSM 10604^T
	gyrB	LR590482	NCTC10696^T		gyrB	JALK00000000	DSM 10604^T
P. taeanensis	16S rRNA	AWSQ00000000	MS‐3^T	P. taetrolens	16S rRNA	LS483370	NCTC 10697^T
	rpoB	AWSQ00000000	MS‐3^T		rpoB	LS483370	NCTC 10697^T
	rpoD	AWSQ00000000	MS‐3^T		rpoD	LS483370	NCTC 10697^T
	gyrB	AWSQ00000000	MS‐3^T		gyrB	LS483370	NCTC 10697^T
P. tolaasii	16S rRNA	PHHD00000000	NCPPB 2192^T	P. toyotomiensis	16S rRNA	NIQV00000000	DSM 26169^T
	rpoB	PHHD00000000	NCPPB 2192^T		rpoB	NIQV00000000	DSM 26169^T
	rpoD	PHHD00000000	NCPPB 2192^T		rpoD	NIQV00000000	DSM 26169^T
	gyrB	PHHD00000000	NCPPB 2192^T		gyrB	NIQV00000000	DSM 26169^T
P. tremae	16S rRNA	LJRO00000000	ICMP9151^T	P. umsongensis	16S rRNA	NIWU00000000	DSM 16611^T
	rpoB	LJRO00000000	ICMP9151^T		rpoB	NIWU00000000	DSM 16611^T
	rpoD	LJRO00000000	ICMP9151^T		rpoD	NIWU00000000	DSM 16611^T
	gyrB	LJRO00000000	ICMP9151^T		gyrB	NIWU00000000	DSM 16611^T
P. vancouverensis	16S rRNA	RRZK00000000	Dha‐51^T	Acinetobacter baumannii	16S rRNA	MJHA00000000	ATCC 19606^T
	rpoB	RRZK00000000	Dha‐51^T		rpoB	MJHA00000000	ATCC 19606^T
	rpoD	RRZK00000000	Dha‐51^T		rpoD	MJHA00000000	ATCC 19606^T
	gyrB	RRZK00000000	Dha‐51^T		gyrB	MJHA00000000	ATCC 19606^T

DNA fingerprinting

DNA fingerprinting has been evaluated and proposed as a reliable method for distinguishing different strains in the same taxon, which are not clonal varieties. Thus, the primer sequence corresponding to BOX elements (BoxA1R: 5′‐CTACGGCAAGGCGACGCTGACG‐3′) was used for DNA fingerprinting (Koeuth, Versalovic, & Lupski, 1995). PCR amplification was conducted as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles (94°C for 1 min, 52°C or 53°C for 1 min, and 72°C for 2 min), and finally 72°C for 8 min. The DNA fragments were analyzed in a 2% agarose gel.

Genome sequencing and analysis

Genomic DNA of strain MS586T was extracted using the Wizard Genomic DNA Purification Kit (Promega Corporation). The extracted genomic DNA was used for library construction with an average insert size of 400 bp, and three mate‐pair libraries with an average insert size of 2000 bp, 5000 bp, and 8000 bp were prepared and sequenced on the Illumina MiSeq instrument according to the manufacturer's instructions (Illumina). The standard library and 2000‐bp mate‐pair library were selected for de novo assembly using a method described by Durfee et al. (2008) using DNASTAR Lasergene software (DNASTAR, Inc.). The genome was annotated using the NCBI Prokaryotic Genome Annotation Pipeline (Angiuoli et al., 2008). The complete genome sequence was deposited in GenBank under accession number CP014205, and the genome project was deposited in the Genomes OnLine Database under GP0128017. Similarity analyses (ANI and GGDC) of the sequenced genome of strain MS586T to other 40 genomes of the closely related Pseudomonas species were determined as briefed below. ANI based on pairwise comparison was calculated using the software JSpecies with the ANIb algorithm (Richter & Rosselló‐Móra, 2009). GGDC was calculated using the web service http://ggdc.dsmz.de and using the recommended BLAST+method (Meier‐Kolthoff et al., 2013). The GGDC results shown are based on the recommended formula 2 (sum of all identities found in HSPs divided by the overall HSP length), which is independent of the genome length and is thus robust against the use of incomplete draft genomes. The Type (Strain) Genome Server (https://www.dsmz.de/services/online‐tools/tygs) with the recommended settings was used to clarify species delineation (Meier‐Kolthoff & Göker, 2019). The phylogenomic tree based on whole‐genome sequences was reconstructed by Genome Blast Distance Phylogeny (GBDP). Accession numbers of sequences used in the whole‐genome phylogenetic analysis are summarized in Table A3. The clustering of the type‐based species using a 70% dDDH radius around each type strain was conducted as previously described (Meier‐Kolthoff & Göker, 2019).

TABLE A3

Accession numbers of the sequences of different Pseudomonas spp. strains used in the whole‐genome phylogenetic analysis

Species	Accession number	Strain designation
P. glycinae	GCA_001594225	MS586^T
P. glycinae	GCA_003055645	MS82
P. fluorescens	GCA_000012445	Pf0‐1
P. arsenicoxydans	GCA_900103875	CECT 7543^T
P. baetica	GCA_002813455	LMG 25716^T
P. batumici	GCA_000820515	UCM B‐321^T
P. chlororaphis	GCA_001269625	LMG 5004^T
P. frederiksbergensis	GCA_900105495	LMG 19851^T
P. granadensis	GCA_900105485	LMG 27940^T
P. jessenii	GCA_002236115	DSM 17150^T
P. koreensis	GCA_900101415	LMG 21318^T
P. kribbensis	GCA_003352185	46‐2^T
P. laurylsulfatiphila	GCA_002934665	AP3_16^T
P. laurylsulfativorans	GCA_002906155	AP3_22^T
P. lini	GCA_001042905	DSM 16768^T
P. moorei	GCA_900102045	DSM 12647^T
P. moraviensis	GCA_900105805	LMG 24280^T
P. prosekii	GCA_900105155	LMG 26867^T
P. reinekei	GCA_001945365	MT1^T
P. vancouverensis	GCA_900105825	LMG 202221^T

Chemotaxonomic analysis

As important chemical characteristics for bacterial identification, the cellular fatty acid profile of the strain MS586T was analyzed. Cellular fatty acids were harvested after 2 days of growth at 28°C on TSA. Fatty acids extracted from the bacteria were methylated and analyzed following the protocol of the Sherlock 6.1 Microbial Identification (MIDI) system (Microbial IDentification Inc.) using the library RTSBA6 (Sasser, 1990). Analyses of respiratory quinones and polar lipids were carried out by the Identification Service of the DSMZ (Braunschweig, Germany).

RESULTS AND DISCUSSION

Phenotype analysis

Both strains MS586T and MS82 were observed to be Gram‐negative, rod‐shaped (0.6–0.8 × 2.0–3.0 μm), and motile utilizing polar flagella (Figure A1). Colonies of the two strains were 3–5 mm in diameter and light yellow after 2 days of incubation on NBY at 28°C. No growth was detected at 40°C or with 7% NaCl. The optimum growth occurred at 28–30°C. The bacteria tolerated pH values ranging from 4 to 10. The two strains could produce fluorescent pigments when cultured for 24–48 hr at 28°C on King B medium, whereas Pseudomonas kribbensis 46‐2T, which is the closest species of strains MS586T and MS82, could not produce fluorescent (Table 1). Strain MS586T showed negative for assimilation of dextrin, formic acid, and d‐serine. In contrast, all these reactions were not negative for P. kribbensis 46‐2T, P. granadensis F‐278,770T, P. moraviensis 1B4T, and Pseudomonas koreensis Ps 9‐14T. Gelatin was hydrolyzed by strain MS586T, but it was negative by P. kribbensis 46‐2T. The physiological, morphological, and phenotypic characteristics in the API 20 NE, API 50 CH, and Biology GEN III tests, which allowed differentiation of strains MS586T from other closely related Pseudomonas species, are listed in Table 1.

FIGURE A1

The cellular morphology of strain MS586T was observed by transmission electron microscopy

TABLE 1

Differentiating characteristics of strain MS586T from other related species of Pseudomonas

Characteristics	1	2^a	3^b	4^c	5^c	6^d	7^e	8^e	9^e	10^e
Flagellation	Polar, multiple	Polar, multiple	Polar, two	Polar, two	Polar, multiple	ND	ND	Polar, single	ND	ND
Fluorescence	+	−	−	+	+	+	+	+	−	−
Growth at:
4°C	+	+	+	+	+	+	ND	+	ND	ND
Tolerance of NaCl at
5%	+	−	+	+	−	+	−	−	−	−
Nitrate reduction	−	−	−	−	−	−	+	+	−	−
Arginine dihydrolase	+	+	+	+	+	+	−	+	−	+
Hydrolysis of gelatin	+	−	+	−	−	+	−	−	−	−
Citrate utilization	+	+	+	+	+	+	+	+	−	+
Urease	−	−	−	−	ND	−	−	−	−	−
Assimilation of
l‐Arabinose	+	+	+	+	+	+	−	+	+	+
N‐Acetyl‐d‐glucosamine	+	+	+	+	+	+	+	+	−	−
Phenylacetic acid	−	−	−	−	−	−	+	+	+	+
d‐Mannose	+	+	+	+	+	+	−	+	−	−
Dextrin	−	+	w	+	+	−	+	+	+	−
Tween‐40	−	+	+	+	+	+	−	+	+	−
d‐Cellobiose	−	+	−	+	+	−	+	+	−	−
d‐Trehalose	−	−	+	+	−	−	w	−	−	−
l‐Arabinose	+	+	+	+	+	+	−	+	+	+
d‐Fructose	+	+	+	+	+	+	ND	+	−	−
d‐Mannitol	+	+	+	+	+	+	+	+	−	+
d‐Arabitol	−	+	+	+	+	+	−	−	+	−
l‐Alanine	+	+	+	+	+	+	+	+	w	ND
l‐Serine	+	+	−	+	+	+	+	+	w	+
α‐Ketobutyric acid	−	−	w	+	+	−	−	+	+	−
α‐Ketoglutaric acid	+	+	+	+	−	+	+	+	−	+
Glucuronamide	−	+	+	+	+	−	−	−	−	−
l‐Histidine	−	+	−	+	+	−	+	+	−	+
d‐Serine	−	+	w	+	+	−	−	+	−	−
d‐Galactose	+	+	+	+	+	+	−	+	+	+
d‐Galacturonic acid	−	ND	−	−	ND	−	−	−	+	+
d‐Glucuronic acid	−	−	−	−	−	−	−	−	−	+
Glucuronamide	−	+	+	ND	+	−	−	−	−	ND
p‐Hydroxy phenylacetic acid	−	−	−	−	−	−	−	+	−	−
Quinic acid	+	+	+	+	+	+	−	+	+	+
d‐Saccharic acid	+	+	+	+	+	+	−	+	+	+
Glycyl‐l‐proline	−	ND	+	+	+	−	+	+	+	+
l‐Pyroglutamic acid	+	+	+	+	ND	+	−	+	+	+
Inosine	−	+	+	+	+	+	+	−	+	−
Propionic acid	+	+	+	+	+	+	+	+	w	−
Formic acid	−	+	−	+	−	−	−	+	+	−
Acetic acid	+	+	w	+	−	+	+	+	+	−
Methyl pyruvate	−	+	+	+	+	+	+	+	+	+
GC content (%)	60.5	60.5	59.9	60.3	59.1	58.7	67.2	62.2	59.1	59.4

Strains. 1, MS586T; 2, P. kribbensis 46‐2T; 3, P. granadensis F‐278,770T; 4, P. moraviensis 1B4T; 5, P. koreensis Ps9‐14T; 6, P. baetica a390T; 7, P. vancouverensis DhA‐51T; 8, P. jessenii DSM 17150T; 9, P. reinekei MT1T; 10, P. moorei RW10T. Data for strain MS586T were obtained in this study. Data for other type strains were obtained from references. a, (Chang et al., 2016); b, (Pascual, García‐López, Bills, & Genilloud, 2015); c, (Tvrzova et al., 2006); and d, (Lopez et al., 2012); e, (Camara et al., 2007).

Abbreviations: −, negative; +, positive; ND, not determined; W, weak.

Differentiating characteristics of strain MS586T from other related species of Pseudomonas Strains. 1, MS586T; 2, P. kribbensis 46‐2T; 3, P. granadensis F‐278,770T; 4, P. moraviensis 1B4T; 5, P. koreensis Ps9‐14T; 6, P. baetica a390T; 7, P. vancouverensis DhA‐51T; 8, P. jessenii DSM 17150T; 9, P. reinekei MT1T; 10, P. moorei RW10T. Data for strain MS586T were obtained in this study. Data for other type strains were obtained from references. a, (Chang et al., 2016); b, (Pascual, García‐López, Bills, & Genilloud, 2015); c, (Tvrzova et al., 2006); and d, (Lopez et al., 2012); e, (Camara et al., 2007). Abbreviations: −, negative; +, positive; ND, not determined; W, weak. Sequence analysis revealed that the 16S rRNA genes of MS586T and MS82 shared significant identities (>98%) to some Pseudomonas species of the P. koreensis subgroup in the Pseudomonas fluorescens group. The closely related strains include P. kribbensis 46‐2T (99.94%), P. granadensis F‐278,770T (99.55%), P. koreensis Ps 9‐14T (99.52%), P. reinekei MT1T (99.46%), P. moraviensis 1B4T (99.41%), P. vancouverensis DhA‐51T (99.33%), P. baetica a390T (99.20%), P. jessenii DSM 17150T (98.94%), and P. fluorescens Pf0‐1 (99.87%). However, analysis of the 16S rRNA gene sequence alone is insufficient to define the relative taxonomic positions of Pseudomonas species (Rosselló‐Móra & Whitman, 2018). Therefore, MLSA was conducted based on previously described methods using four gene sequences for the studies: 16S rRNA (1326 bp), rpoB (905 bp), rpoD (802 bp), and gyrB (663 bp). According to Hesse et al. (2018), the genus Pseudomonas has been phylogenetically divided into 13 groups (G) and 10 subgroups (SG). The closely related species of P. fluorescens subgroup and representative species of each group were selected to reconstruct the phylogenetic tree. The maximum‐likelihood tree illustrates the phylogenetic position of strain MS586T and 61 related members of the genus Pseudomonas based on four concatenated gene sequences (3696 bp); Acinetobacter baumannii strain ATCC 19606T was used as an outgroup. As shown in Figure 1, strains MS586T and MS82 were clustered with P. fluorescens Pf0‐1 with 100% bootstrap values. Strains MS586T and MS82 belong to the P. koreensis subgroup in the P. fluorescens group. It has been noted that, as reported by Gomila, Peña, Mulet, Lalucat, and García‐Valdés (2015), 30% of the genus Pseudomonas sequenced genomes of non‐type strains were not correctly assigned at the species level in the accepted taxonomy of the genus and 20% of the strains were not identified at the species level. Therefore, further extensive research is needed to update the Pseudomonas taxonomy.

FIGURE 1

Maximum‐likelihood tree illustrating the phylogenetic position of strain MS586T and related members of the genus Pseudomonas using four concatenated gene sequences (3696 bp): 16S rRNA (1326 bp), rpoB (905 bp), rpoD (802 bp), and gyrB (663 bp). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. A. baumannii strain ATCC 19606T was used as the outgroup. Only bootstrap values above 50% are indicated. The colored bar designates groups of Pseudomonas spp. Accession numbers of sequences used in this study are summarized in Table A2 DNA fingerprinting by BOX‐PCR revealed that strains MS586T and MS82 were different representatives of the proposed novel species. As shown in Figure A2, two strains have the two common bands (490 bp and 900 bp) in the BOX‐PCR profiles; however, each of them produced unique bands (125 bp, 300 bp, 750 bp, and 1350 bp for MS586T; 700 bp, 750 bp, 1100 bp, and 1350 bp for MS82), which suggests the two strains are not identical isolates.

FIGURE A2

Fingerprinting analysis of strain MS586T and strain MS82 based on analysis of BOX‐PCR: 1, strain MS586T; 2, strain MS82; Mk: 1‐kb DNA ladder (GoldBio) was used with markers

General taxonomic genome features of strain MS586T

The main characteristics of the whole‐genome sequence of strain MS586T are depicted in Table 2. No plasmid was detected. The DNA G+C content of strain MS586T was 60.48 mol%. This value is in the range (48–68 mol%) of those reported within the genus Pseudomonas (Hesse et al., 2018).

TABLE 2

Chromosome statistics for strain MS586T

Feature	Total
Size	6,396,728 bp
Genes	5893
CDs	5805
Pseudogenes	131
rRNAs	17
tRNAs	67
ncRNA	4
G+C content	60.48%

Chromosome statistics for strain MS586T All genome‐relatedness values of strain MS586T were calculated by the algorithms ANIb and GGDC. The MS586T genome was compared with the complete genome assemblies downloaded from NCBI for the strains shown in Table 3. ANI 95%–96% is equivalent to a DNA‐DNA hybridization of 70% (Kim, Oh, Park, & Chun, 2014). The species demarcations ANI ≥ 95% or GGDC ≥ 70% were used as a benchmark (Richter & Rosselló‐Móra, 2009). ANI values and GGDC values ranged from 75.28% to 98.24% and 21.00% to 84.10%, respectively, with the highest value between MS82 and MS586T. As shown in Table 3, strain MS586T shared less than 91% ANI and 35% GGDC with any of the other type strain of bacteria, but it had ANI value of 98.24% and GGDC value of 84.10% with strain MS82, which are higher than the species boundary cutoff values. Additionally, the two strains share 95.59% ANI and 65.30% GGDC with P. fluorescens Pf0‐1, which is the closest relative outside to the novel species. As reported by Lopes et al. (Lopes et al., 2018), three strains isolated from tropical soils, which share ≥95% ANI values with strain MS586T, are the potential strains for the novel species. As shown in Figure 2, the whole‐genome‐based phylogenetic tree obtained with TYGS automated pipeline shows that both MS586T and MS82 were grouped into the same species cluster and confirmed that P. kribbensis 46‐2T is the closely related type strain. P. fluorescens Pf0‐1 was clustered to independent branch, which indicates its distinct phylogenetic position and potential as a separate species. Collectively, the ANI, GGDC, and whole‐genome phylogenetic tree data support that strains MS586T and MS82 represent a unique species.

TABLE 3

ANI (%) and GGDC (%) between strain MS586T and closely related sequenced strains of the genus Pseudomonas

Pseudomonas species	Genome accession number at https://www.ebi.ac.uk/ena	ANI (%)	GGDC%
P. agarici LMG 2112^T	GCA_900109755	79.87%	24.30%
P. arsenicoxydans CECT 7543^T	GCA_900103875	84.36%	28.60%
P. azotoformans LMG 21611^T	GCA_900103345	80.75%	25.10%
P. baetica LMG 25716^T	GCA_002813455	86.58%	33.30%
P. entomophila L48^T	GCA_000026105	77.45%	22.40%
P. fluorescens ATCC 13525^T	GCA_900215245	80.84%	24.40%
P. frederiksbergensis LMG19851^T	GCA_900105495	84.64%	29.10%
P. fuscovaginae LMG 2158^T	GCA_900108595	80.04%	24.60%
P. gessardii DSM 17152^T	GCA_001983165	80.81%	25.00%
P. graminis DSM 11363^T	GCA_900111735	77.72%	22.70%
P. granadensis LMG 27940^T	GCA_900105485	85.88%	31.60%
P. jessenii DSM 17150^T	GCA_002236115	84.40%	29.70%
P. knackmussii B13^T	GCA_000689415	75.51%	21.00%
P. koreensis LMG 21318^T	GCA_900101415	87.32%	32.63%
P. kribbensis KCTC 32541^T	GCA_003352185	90.22%	42.20%
P. laurylsulfatiphila AP3_16^T	GCA_002934665	84.74%	29.70%
P. laurylsulfativorans AP3_22^T	GCA_002906155	84.61%	29.50%
P. libanensis DSM 17149^T	GCA_001439685	80.41%	24.50%
P. lini DSM 16768^T	GCA_900104735	84.44%	29.20%
P. lutea LMG 21974^T	GCA_900110795	70.69%	19.50%
P. mandelii LMG 2210^T	GCA_900106065	84.41%	28.90%
P. migulae LMG 21608^T	GCA_900106025	84.51%	29.40%
P. mohnii DSM 18327^T	GCA_900105115	84.24%	29.20%
P. monteilii DSM 14164^T	GCA_000621245	77.07%	21.80%
P. moorei DSM 12647^T	GCA_900102045	84.76%	29.30%
P. moraviensis LMG 24280^T	GCA_900105805	85.75%	31.70%
P. mucidolens LMG 2223^T	GCA_900106045	80.17%	24.50%
P. parafulva DSM 17004^T	GCA_000425765	76.47%	21.50%
P. plecoglossicida DSM 15088^T	GCA_000730665	77.84%	22.50%
P. prosekii LMG26867^T	GCA_900105155	84.28%	28.40%
P. punonensis LMG 26839^T	GCA_900142655	75.28%	21.50%
P. putida NCTC 10936^T	GCA_900455645	77.34%	22.30%
P. reinekei MT1^T	GCA_001945365	84.16%	29.00%
P. rhizosphaerae DSM 16299^T	GCA_000761155	77.99%	22.90%
P. synxantha NCTC 10696^T	GCA_901482615	80.31%	24.70%
P. umsongensis DSM 16611^T	GCA_002236105	83.79%	29.00%
P. vancouverensis DhA‐51^T	GCA_004348895	83.95%	28.80%
P. yamanorum LMG 27247^T	GCA_900105735	80.67%	25.10%
P. fluorescens Pf0‐1	GCA_000012445	95.59%	65.30%
MS82	GCA_003055645	98.24%	84.10%

FIGURE 2

Whole‐genome sequence tree generated with TYGS for strain MS586T and its closely related species of the genus Pseudomonas. Tree inferred with FastME from GBDP distances was calculated from genome sequences. Branch lengths are scaled in terms of GBDP distance formula d5; numbers above branches are GBDP pseudo‐bootstrap support values from 100 replications. The colored squares designate species cluster. Accession numbers of sequences used in this study are summarized in Table A3

ANI (%) and GGDC (%) between strain MS586T and closely related sequenced strains of the genus Pseudomonas Whole‐genome sequence tree generated with TYGS for strain MS586T and its closely related species of the genus Pseudomonas. Tree inferred with FastME from GBDP distances was calculated from genome sequences. Branch lengths are scaled in terms of GBDP distance formula d5; numbers above branches are GBDP pseudo‐bootstrap support values from 100 replications. The colored squares designate species cluster. Accession numbers of sequences used in this study are summarized in Table A3 Furthermore, strains MS586T and MS82 were noteworthy, which were isolated from the rhizosphere of soybean plants associated with fungal pathogen infections. Strain MS586T has shown remarkable antifungal activities against a broad range of plant fungal pathogens (Jia and Lu, unpublished). Similarly, our study has demonstrated that strain MS82 possesses antifungal activities against the mushroom fungal pathogen Mycogone perniciosa, but not the mushroom fungus (Ma et al., 2019). Furthermore, it has been reported that PafR gene confers resistance to the mushroom pathogenic fungus (Ma et al., 2017). As expected, the PafR gene was also found in strains MS586T. Therefore, it is not surprising that multiple nonribosomal peptide synthetase gene clusters, which are frequently associated with the production of antimicrobial compounds (Mootz & Marahiel, 1997), have been predicted from the genomes of the bacterial strains. Cellular fatty acids were identified using the Sherlock 6.1 system (Microbial IDentification Inc.) and the library RTSBA6 (Sasser, 1990). The majority of fatty acids for strain MS586T were C16:0 (22.9%), summed feature 3 (C16:1ω7c/C16:1ω6c) (23.57%), summed feature 8 (C18:1ω7c/C18:1ω6c) (13.37%), and C17:0 cyclo (10.28%). The similarity of the fatty acid profiles supports the affiliation of strain MS586T with the genus Pseudomonas. The three fatty acids typical of the genus Pseudomonas (C10:0 3‐OH, C12:0, and C12:0 3‐OH) were also identified in strain MS586T (Palleroni, 2005). Besides, the lowest amounts of fatty acid C16:0 (22.9%) were observed in strain MS586T than in the strains of closely related species (29.4–36.5%). Strain MS586T also contains the highest amounts of C10:0 3‐OH (6.6%) when compared to the reference strains (2.2%–5.4%). The detailed fatty acid profiles of strain MS586T and the type strains of closely related species are provided in Table 4. Two‐dimensional TLC analysis revealed that the polar lipids of strain MS586T were phosphatidylethanolamine (PE), diphosphatidylglycerol (DPG), phosphatidylglycerol (PG), three unidentified phospholipids (PL), and one unidentified lipid (L) (Figure A3). Strain MS586T contains higher amounts of PL and L as compared with those of the closest relative of P. kribbensis 46‐2T. As expected, the major polar lipid components of strain MS586T were PE, DPG, and PG, which agrees with data published previously for the genus Pseudomonas (Moore et al., 2006). Also, the major respiratory quinone of strain MS586T was Q‐9, which is consistent with other species in the genus Pseudomonas (Moore et al., 2006).

TABLE 4

Cellular fatty acid profiles of strain MS586T and strains of closely related species

Fatty acid	1	2^a	3^b	4^c	5^c	6^d	7^e	8^e	9^e	10^e
C_10:0 3‐OH	6.6	5.4	3.2	2.6	2.2	3.4	4.8	2.8	3.3	2.9
C_12:0 2‐OH	5.5	6.8	4.7	4.9	5	5.5	3.8	5.5	4.3	3.5
C_12:0 3‐OH	6.7	7.5	2.5	4.1	4	3.2	5.7	3.2	4.8	3.7
C_10:0	0.8	ND	ND	ND	ND	0.1	0.3	0.1	ND	ND
C_12:0	2.9	ND	1.5	2.1	1.6	1.7	3.8	4.7	3.6	2.8
C_14:0	0.6	1.2	ND	0.4	0.7	0.5	0.6	0.3	0.7	0.7
C_16:0	22.9	33.4	32	29	33	29.4	29.4	29.4	36.5	36
C_17:0 cyclo	10.3	15.1	6.9	2.4	2	3.2	9.4	0.9	22.3	21
C_18:0	0.3	1.6	ND	0.5	0.7	0.3	0.2	0.7	0.8	0.9
C_19:0 ω8c	1.2	ND	ND	0.2	ND	ND	ND	ND	0.7	1.2
Summed feature 3	23.6	16.8	36	36	37	39.5	30.8	38.1	28	23
Summed feature 8	13.4	8.9	12	17	13	12.2	8.5	17.2	8.6	10

Strains. 1, MS586T; 2, P. kribbensis 46‐2T; 3, P. granadensis F‐278,770T; 4, P. moraviensis 1B4T; 5, P. koreensis Ps9‐14T; 6, P. baetica a390T; 7, P. vancouverensis DhA‐51T; 8, P. jessenii DSM 17150T; 9, P. reinekei MT1T; and 10, P. moorei RW10T. Data for strain MS586T were obtained in this study. Data for other type strains were obtained from references. a, (Chang et al., 2016); b, (Pascual et al., 2015); c, (Tvrzova et al., 2006); d, (Lopez et al., 2012); and e, (Camara et al., 2007). Values are percentages of total fatty acids.

Summed features represent groups of two or three fatty acids that cannot be separated by GC with the MIDI system. Summed feature 3 consists of C16:1ω7c/C16:1ω6c; summed feature 8 consists of C18:1ω7c/C18:1ω6c.

Abbreviation: ND, not detected/not reported.

FIGURE A3

Two‐dimensional TLC of polar lipids of strain MS586T. DPG, diphosphatidylglycerol; L, lipid; PE, phosphatidylethanolamine; PG, phosphatidylglycerol; PL, phospholipid

Cellular fatty acid profiles of strain MS586T and strains of closely related species Strains. 1, MS586T; 2, P. kribbensis 46‐2T; 3, P. granadensis F‐278,770T; 4, P. moraviensis 1B4T; 5, P. koreensis Ps9‐14T; 6, P. baetica a390T; 7, P. vancouverensis DhA‐51T; 8, P. jessenii DSM 17150T; 9, P. reinekei MT1T; and 10, P. moorei RW10T. Data for strain MS586T were obtained in this study. Data for other type strains were obtained from references. a, (Chang et al., 2016); b, (Pascual et al., 2015); c, (Tvrzova et al., 2006); d, (Lopez et al., 2012); and e, (Camara et al., 2007). Values are percentages of total fatty acids. Summed features represent groups of two or three fatty acids that cannot be separated by GC with the MIDI system. Summed feature 3 consists of C16:1ω7c/C16:1ω6c; summed feature 8 consists of C18:1ω7c/C18:1ω6c. Abbreviation: ND, not detected/not reported.

CONCLUSIONS

Analyses of molecular, phenotypic, physiological, and biochemical characteristics are needed to discriminate between members of the genus Pseudomonas and other rRNA groups of aerobic “pseudomonads” (Palleroni, 2005). These analyses of strains MS586T and MS82 revealed its distinct characteristics of 16S rRNA and housekeeping gene sequences, ANI values, GGDC values, and phenotypic and chemotaxonomic assays as compared with those of other species and strains of the genus Pseudomonas. Collectively, these results demonstrate that strain MS586T and strain MS82 represent a novel species of the genus Pseudomonas. The name Pseudomonas glycinae sp. nov. is proposed with strain MS586T as the type strain. Strain MS586T is a motile Gram‐negative, rod‐shaped, strictly aerobic, catalase‐ and oxidase‐positive, fluorescent strain. These findings support the placement of strain MS586T in the genus Pseudomonas (Hildebrand, Palleroni, Hendson, Toth, & Johnson, 1994).

Description of Pseudomonas glycinae sp. nov.

Pseudomonas glycinae (gly.ci'nae. N.L. gen. n. glycinae of Glycine max, soybean) is an aerobic, Gram‐negative, rod‐shaped bacterium, with motility through polar flagella. When cultured on NBY agar plates, it produces fluorescence and forms fresh light‐yellow colonies. The colony is raised from the side view, the shape is circular, and it is usually 3.0–5.0 mm in diameter within 2 days of growth at 28°C. Cells are 0.6–0.8 × 2.0–3.0 μm. Growth occurs between 4°C and 36°C (optimum growth temperature is 28–30°C). Growth occurs between pH 4 and 10 (optimum pH 6–7). The organism tolerates up to 6% (w/v) NaCl. The results obtained with Biology GENIII Microplates indicate the following substrates can be utilized: α‐d‐glucose, d‐mannose, d‐fructose, d‐fucose, d‐galactose, d‐mannitol, l‐alanine, l‐arginine, l‐aspartic acid, l‐glutamic acid, l‐pyroglutamic acid, l‐serine, d‐gluconic acid, mucic acid, quinic acid, d‐saccharic acid, l‐lactic acid, citric acid, α‐ketoglutaric acid, l‐malic acid, γ‐aminobutyric acid, β‐hydroxy‐d,l‐butyric acid, propionic acid, acetic acid, and N‐acetyl‐d‐glucosamine, but negative for dextrin, d‐maltose, d‐trehalose, d‐cellobiose, gentiobiose, sucrose, stachyose, d‐raffinose, α‐d‐lactose, d‐melibiose, β‐methyl‐d‐glucoside, d‐salicin, N‐acetyl‐β‐d‐mannosamine, N‐acetyl‐d‐galactosamine, N‐acetyl neuraminic acid, 3‐methyl glucose, l‐rhamnose, inosine, d‐sorbitol, d‐arabitol, myo‐inositol, d‐glucose‐6‐PO4, d‐fructose‐6‐PO4, d‐aspartic acid, d‐serine, gelatin, glycyl‐l‐proline, l‐histidine, pectin, d‐galacturonic acid, l‐galactonic acid lactone, d‐glucuronic acid, glucuronamide, p‐hydroxy‐phenylacetic acid, methyl pyruvate, d‐lactic acid methyl ester, d‐malic acid, Tween‐40, α‐hydroxybutyric acid, α‐ketobutyric acid, acetoacetic acid, and formic acid. According to API 20 NE tests, the organism is positive for the hydrolysis of gelatin, arginine dihydrolase, and assimilation of glucose, arabinose, mannose, mannitol, N‐acetyl‐glucosamine, potassium gluconate, capric acid, malic acid, and trisodium citrate, but negative for the reduction of nitrate to nitrogen and nitrogen, indole production, glucose fermentation, urease, hydrolysis of esculin and β‐galactosidase, and assimilation of maltose, adipic acid, and phenylacetic acid. According to API 50 CH tests, the organism is positive for acid production from l‐arabinose, d‐ribose, d‐xylose, d‐mannose, d‐mannitol, and d‐fucose, but negative for erythritol, d‐arabinose, l‐xylose, d‐adonitol, methyl‐β‐d‐xylopyranoside, d‐galactose, d‐fructose, d‐sorbose, l‐rhamnose, dulcitol, inositol, d‐sorbitol, methyl‐α‐d‐mannopyranoside, methyl‐α‐d‐glucopyranoside, amygdalin, arbutin, esculin, salicin, d‐cellobiose, d‐maltose, d‐melibiose, sucrose, d‐trehalose, inulin, d‐melezitose, d‐raffinose, starch, glycogen, xylitol, gentiobiose, d‐turanose, d‐lyxose, d‐tagatose, l‐fucose, d‐arabitol, l‐arabitol, potassium 2‐ketogluconate, and potassium 5‐ketogluconate. The predominant quinone system is Q‐9. Polar lipids are diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, three unidentified phospholipids, and one unidentified lipid. The type strain is MS586T (LMG 30275T, NRRL B‐65441T), isolated from the rhizosphere of soybean grown in Mississippi. The DNA G+C content of the type strain is 60.48 mol%.

CONFLICT OF INTEREST

None declared.

AUTHOR CONTRIBUTIONS

Jiayuan Jia: Formal analysis (equal); visualization (equal); writing – original draft (equal). Xiaoqiang Wang: Formal analysis (equal); investigation (equal); writing – original draft (equal). Peng Deng: Formal analysis (equal). Lin Ma: Formal analysis (equal); resources (equal). Sonya M. Baird: Methodology (equal). Xiangdong Li: Formal analysis (equal); funding acquisition (equal). Shi‐En Lu: Conceptualization (equal); formal analysis (equal); funding acquisition (equal); project administration (equal); writing – original draft (equal); writing – review & editing (equal).

ETHICS STATEMENT

None required.

37 in total

1. Two simple media for the demonstration of pyocyanin and fluorescin.

Authors: E O KING; M K WARD; D E RANEY
Journal: J Lab Clin Med Date: 1954-08

2. Synthetic and complex media for the rapid detection of fluorescence of phytopathogenic pseudomonads: effect of the carbon source.

Authors: A K Vidaver
Journal: Appl Microbiol Date: 1967-11

3. Multilocus sequence analysis of the central clade of the genus Vibrio by using the 16S rRNA, recA, pyrH, rpoD, gyrB, rctB and toxR genes.

Authors: Javier Pascual; M Carmen Macián; David R Arahal; Esperanza Garay; María J Pujalte
Journal: Int J Syst Evol Microbiol Date: 2009-07-31 Impact factor: 2.747

4. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.

Authors: Samuel V Angiuoli; Aaron Gussman; William Klimke; Guy Cochrane; Dawn Field; George Garrity; Chinnappa D Kodira; Nikos Kyrpides; Ramana Madupu; Victor Markowitz; Tatiana Tatusova; Nick Thomson; Owen White
Journal: OMICS Date: 2008-06

5. Pseudomonas baetica sp. nov., a fish pathogen isolated from wedge sole, Dicologlossa cuneata (Moreau).

Authors: Jose R López; Ana L Diéguez; Alejandra Doce; Elena De la Roca; Roberto De la Herran; Jose I Navas; Alicia E Toranzo; Jesus L Romalde
Journal: Int J Syst Evol Microbiol Date: 2011-06-03 Impact factor: 2.747

6. Pseudomonas moraviensis sp. nov. and Pseudomonas vranovensis sp. nov., soil bacteria isolated on nitroaromatic compounds, and emended description of Pseudomonas asplenii.

Authors: Ludmila Tvrzová; Peter Schumann; Cathrin Spröer; Ivo Sedláček; Zdena Páčová; Ondrej Šedo; Zbyněk Zdráhal; Maike Steffen; Elke Lang
Journal: Int J Syst Evol Microbiol Date: 2006-11 Impact factor: 2.747

7. An rpoD-based PCR procedure for the identification of Pseudomonas species and for their detection in environmental samples.

Authors: Magdalena Mulet; Antonio Bennasar; Jorge Lalucat; Elena García-Valdés
Journal: Mol Cell Probes Date: 2009-03-04 Impact factor: 2.365

8. Shifting the genomic gold standard for the prokaryotic species definition.

Authors: Michael Richter; Ramon Rosselló-Móra
Journal: Proc Natl Acad Sci U S A Date: 2009-10-23 Impact factor: 11.205

9. Phylogenomics and systematics in Pseudomonas.

Authors: Margarita Gomila; Arantxa Peña; Magdalena Mulet; Jorge Lalucat; Elena García-Valdés
Journal: Front Microbiol Date: 2015-03-18 Impact factor: 5.640

10. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy.

Authors: Jan P Meier-Kolthoff; Markus Göker
Journal: Nat Commun Date: 2019-05-16 Impact factor: 14.919

5 in total

1. Pseudomonas allokribbensis sp. nov. and Pseudomonas gozinkensis sp. nov., Two New Species Isolated from a Volcanic Island, Izu Oshima, Japan.

Authors: Yuh Morimoto; Yu Jie Lu; Hui Zuo; Zulipiya Aibibula; Mari Tohya; Teruo Kirikae; Keiichi Hiramatsu; Hiroyuki Daida; Tadashi Baba
Journal: Curr Microbiol Date: 2021-03-04 Impact factor: 2.188

2. Role of Nodulation-Enhancing Rhizobacteria in the Promotion of Medicago sativa Development in Nutrient-Poor Soils.

Authors: Noris J Flores-Duarte; Enrique Mateos-Naranjo; Susana Redondo-Gómez; Eloísa Pajuelo; Ignacio D Rodriguez-Llorente; Salvadora Navarro-Torre
Journal: Plants (Basel) Date: 2022-04-26

3. Isolation of Pseudomonas aromaticivorans sp. nov from a hydrocarbon-contaminated groundwater capable of degrading benzene-, toluene-, m- and p-xylene under microaerobic conditions.

Authors: Sinchan Banerjee; Anna Bedics; Erika Tóth; Balázs Kriszt; André R Soares; Károly Bóka; András Táncsics
Journal: Front Microbiol Date: 2022-09-20 Impact factor: 6.064

4. Pseudomonas glycinae sp. nov. isolated from the soybean rhizosphere.

Authors: Jiayuan Jia; Xiaoqiang Wang; Peng Deng; Lin Ma; Sonya M Baird; Xiangdong Li; Shi-En Lu
Journal: Microbiologyopen Date: 2020-07-12 Impact factor: 3.139

Review 5. Pseudomonas Lipopeptide-Mediated Biocontrol: Chemotaxonomy and Biological Activity.

Authors: Feyisara Eyiwumi Oni; Qassim Esmaeel; Joseph Tobias Onyeka; Rasheed Adeleke; Cedric Jacquard; Christophe Clement; Harald Gross; Essaid Ait Barka; Monica Höfte
Journal: Molecules Date: 2022-01-07 Impact factor: 4.411

5 in total