| Literature DB >> 32650546 |
Hubert Szczerba1, Karolina Dudziak2, Mariusz Krawczyk3, Zdzisław Targoński1.
Abstract
Enterobacter sp. LU1, a wild-type bacterium originating from goat rumen,Entities:
Keywords: Enterobacter; complete genome sequence; glycerol; succinic acid production
Mesh:
Substances:
Year: 2020 PMID: 32650546 PMCID: PMC7402333 DOI: 10.3390/ijms21144835
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Figure 1Phylogenomic classification of Enterobacter sp. LU1 strain based on: (A) Genome Basic Local Alignment Search Tool (BLAST) distance phylogenies (GBDP) using Type Strain Genome Server (TYGS) platform [23]. Tree was inferred with FastME 2.1.6.1 [29] from GBDP distances calculated from genome sequences. Branch lengths are scaled in terms of GBDP distance formula d5. Numbers above branches are GBDP pseudo-bootstrap support values > 60% from 100 replications, with an average branch support of 94.4%. Tree was rooted at midpoint [30]. (B) OrthoANI values using Orthologous Average Nucleotide Identity Tool (OAT) software (https://www.ezbiocloud.net/tools/orthoani) [27]. Heatmap presents OrthoANI values of Enterobacter sp. LU1 and seven closely related Enterobacter species belonging to Enterobacter cloacae complex (ECC).
General information on genome sequencing project of Enterobacter sp. LU1.
| Properties | |
|---|---|
| Strain | |
| Sample source | Goat rumen |
| Sequencing type | Hybrid (short/long read sequencing) |
| Sequencing platforms | Illumina MiSeq/ONT MinION |
| Library type | 1 library with 400 bp insert/1D long read library |
| Fold average coverage | 98 ×/150 × |
| Assembly method | Unicycler v. 0.4.7 |
| Assembly level | Complete genome |
| Annotation method | Best-placed reference protein set; GeneMarkS-2+ |
| Annotation pipeline | NCBI Prokaryotic Genome Annotation Pipeline |
| BioProject | PRJNA562627 |
| BioSample | SAMN1264612 |
| Accession number | CP043438 |
Figure 2Circular map of Enterobacter sp. LU1 genome. From the outer to the inner circle, representation is as follows: 1: position in megabases (black); 2: forward strand coding sequences (CDSs) (red); 3: forward strand clusters of orthologous groups (COGs) (legend); 4: reverse strand CDSs (blue); 5: reverse strand COGs (legend); 6: pseudogenes (dark orange); 7: ribosomal RNAs (rRNAs) (lime) and transfer RNAs (tRNAs) (purple); 8: horizontal gene transfer (HGT) regions (dark red); 9: phage sequences (gray); 10: GC content (green and orange correspond to higher and lower than average content, respectively); 11: GC skew (green and orange correspond to higher and lower than average skew, respectively). Whole-genome sequence visualization was performed using CGView software [33].
General features of Enterobacter sp. LU1 genome compared to K. aerogenes LU2 (formerly E. aerogenes) genome and 15 complete Enterobacteriaceae genomes a.
| Genome Features | ||||
|---|---|---|---|---|
| Genome size (bp) | 4,636,526 | 5,0626,51 | 5,133,067 | 4,641,652–5,452,368 |
| G+C (%) | 55.6 | 55 | 53.3 | 50.6–57.5 |
| No. of contigs | 1 | 1 | 2.5 | 1–10 |
| No. of plasmids | 0 | 0 | 1.5 | 0–9 |
| Total genes | 4425 | 4986 | 5045 | 4532–5523 |
| Total CDSs | 4311 | 4868 | – | – |
| Protein-coding genes | 4283 | 4741 | 4804 | 4242–5300 |
| Gene density (gene/kb) | 0.954 | 0.985 | 0.983 | 0.951–1.082 |
| 5S rRNAs | 9 | 8 | 24 | 19–25 |
| 16S rRNAs | 8 | 7 | ||
| 23S rRNAs | 8 | 7 | ||
| tRNAs | 84 | 86 | 84 | 76–88 |
| ncRNAs | 5 | 10 | – | – |
| Pseudogenes | 49 | 127 | 115 | 1–205 |
| CRISPR arrays | 2 | 0 | – | – |
| Prophages | 3 | 1 | – | – |
“–” no data available. a Enterobacter cloacae PIMB10EC27, E. cloacae subsp. cloacae ATCC13047, Enterobacter hormaechei C45, E. hormaechei subsp. steigerwaltii DSM 16691, Klebsiella aerogenes G7, CAV1320 strains, Raoultella ornithinolytica A14, S12, B6 strains, Citrobacter freundii CAV1321, FDAARGOS73, CFNIH1 strains, Escherichia coli NRG857c, K12, AIA39 strains. b Data based on genome summary pages of NCBI GenBank database.
Figure 3Classification of COG functional annotation of Enterobacter sp. LU1. Colored bars indicate percentage of genes assigned to each COG category.
Figure 4Classification of Gene Ontology (GO) functional annotation of Enterobacter sp. LU1. Colored bars indicate numbers of genes assigned to COG categories.
Figure 5Distribution of genes encoding enzymes within enzyme class (EC) based on Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways analysis. Colored bars indicate amounts of genes assigned to EC classes.
Intact prophage regions identified in genome of Enterobacter sp. LU1.
| Region | Region Length (kb) | Completeness | Total Proteins | Region Position | GC (%) |
|---|---|---|---|---|---|
| 1 | 70.3 | Intact | 67 | 1,116,715–1,187,045 | 52.96 |
| 2 | 20.9 | Intact | 29 | 2,196,837–2,217,799 | 52.75 |
| 3 | 49.8 | Intact | 50 | 3,424,122–3,473,981 | 50.02 |
Distribution of clustered regularly interspaced short palindromic repeats (CRISPR) regions in genome of Enterobacter sp. LU1.
| Region | Start | End | Spacers | Repeat Consensus/Cas Genes | Evidence Level |
|---|---|---|---|---|---|
| 1 | 1,143,757 | 1,143,850 | 1 | TGTCCAGCCGATGTCCAGCCAGTGTCCA | 1 |
| 2 | 1,566,815 | 1,567,745 | 15 | GTTCACTGCCGTGCAGGCAGCTTAGAAA | 4 |
| 3 | 1,571,432 | 1,572,180 | 12 | GTGCACTGCCGTACAGGCAGCTTAGAAA | 4 |