Reclassification of Pterulaceae Corner (Basidiomycota: Agaricales) introducing the ant-associated genus Myrmecopterula gen. nov., Phaeopterula Henn. and the corticioid Radulomycetaceae fam. nov.

Pterulaceae was formally proposed to group six coralloid and dimitic genera: Actiniceps (=Dimorphocystis), Allantula, Deflexula, Parapterulicium, Pterula, and Pterulicium. Recent molecular studies have shown that some of the characters currently used in Pterulaceae do not distinguish the genera. Actiniceps and Parapterulicium have been removed, and a few other resupinate genera were added to the family. However, none of these studies intended to investigate the relationship between Pterulaceae genera. In this study, we generated 278 sequences from both newly collected and fungarium samples. Phylogenetic analyses supported with morphological data allowed a reclassification of Pterulaceae where we propose the introduction of Myrmecopterula gen. nov. and Radulomycetaceae fam. nov., the reintroduction of Phaeopterula, the synonymisation of Deflexula in Pterulicium, and 53 new combinations. Pterula is rendered polyphyletic requiring a reclassification; thus, it is split into Pterula, Myrmecopterula gen. nov., Pterulicium and Phaeopterula. Deflexula is recovered as paraphyletic alongside several Pterula species and Pterulicium, and is sunk into the latter genus. Phaeopterula is reintroduced to accommodate species with darker basidiomes. The neotropical Myrmecopterula gen. nov. forms a distinct clade adjacent to Pterula, and most members of this clade are associated with active or inactive attine ant nests. The resupinate genera Coronicium and Merulicium are recovered in a strongly supported clade close to Pterulicium. The other resupinate genera previously included in Pterulaceae, and which form basidiomes lacking cystidia and with monomitic hyphal structure (Radulomyces, Radulotubus and Aphanobasidium), are reclassified into Radulomycetaceae fam. nov. Allantula is still an enigmatic piece in this puzzle known only from the type specimen that requires molecular investigation. A key for the genera of Pterulaceae and Radulomycetaceae fam. nov. is also provided here.

INTRODUCTION

The history of Pterulaceae begins with the hesitant proposal of the genus Pterula (hereinafter abbreviated as Pt.) in the early 19th century by Fries (1821, 1825, 1830). The typification of this genus was addressed by Lloyd (1919) and this was followed by discussion between Doty (1948), Donk (1949), and Rogers (1949, 1950). Ultimately Corner (1952c) provided a thorough discussion of the timeline of Fries’ decisions, which was later confirmed with further clarification by (Donk 1954; Donk 1963).

The number of species in Pterula grew during the late 19th and early 20th centuries, with Léveille, Patouillard, Hennings, Saccardo, Lloyd, Spegazzini, and Berkeley being the most active in the naming of taxonomic novelties of Pterula in this period (Corner 1950, 1970). Lloyd (1919) devoted an entire chapter to discuss the taxonomy of the genus. However, the major contribution to the genus was made by E. J. H. Corner who added at least 45 new taxa (Corner 1950, 1952b, 1966, 1967, 1970). Corner (1950) created the Pteruloid series in Clavariaceae to group, besides Pterula, other genera with coralloid basidiome and dimitic hyphal system. The Pteruloid series was raised by Donk (1964) to Pteruloideae, a subfamily of Clavariaceae. Pterulaceae was formally proposed by Corner (1970) including the genera from the original Pteruloideae: Allantula, Deflexula, Dimorphocystis (= Actiniceps), Parapterulicium, Pterula and Pterulicium (hereinafter abbreviated as Pm.) (Corner 1950, 1952a, 1952b, 1970) (Fig. 1).

Fig. 1

Diversity of coralloid genera of Pterulaceae. a-f: [A: Apterostigma sp. nest with M. velohortorum (RC12; CALD170307–02)* with M. sp. SAPV1 (F82; CALD170307–02)* growing on top of the garden veil; b: M. sp. (F99, HSTM-Fungos 9930); c: M. sp. (F138, FLOR 63724); d: Apterostigma sp. nest with M. nudihortorum (TRS111004–04)*; e: M. moniliformis (CJL585)*; f: M. sp. (F71, HSTM-Fungos 9943)]. g-h: [G: Pt. cf. loretensis (RLC273, K(M) 205,553)*; h: Pt. cf. verticillata (K(M) 27,119)]. i-l: [I: Pm. secundirameum (RB 575794); j: Pm. aff. fluminensis (FLOR 56379); k: Pm. lilaceobrunneum (M117, FLOR 56455). l: Pm. sprucei (F68, HSTM-Fungos 9940)]. M-O: [m: Ph. sp. (F7, HSTM-Fungos 9944); n: Ph. stipata (M15, FLOR 56375); o: Ph. juruensis (F33, FLOR 63719)]. Close inspection of B and C reveal the basidiomes to be growing from a granular substrate resembling substrate of ants’ fungus garden. Photos d, e and g kindly provided by Ted Schultz, Susanne Sourell and Michael Wherley respectively. Bars = 1 cm. * Samples not deposited

Following Corner’s reclassifications, the major changes in Pterulaceae have resulted from molecular phylogenetic analyses. Actiniceps was shown within Agaricales to be distantly related to Pterulaceae and Parapterulicium was removed to Russulales (Dentinger and McLaughlin 2006; Leal-Dutra et al. 2018). Four resupinate genera were transferred to Pterulaceae: Aphanobasidium, Coronicium, Merulicium, and Radulomyces (Larsson 2007; Larsson et al. 2004) and, finally, the new poroid genus Radulotubus was proposed in the family (Zhao et al. 2016) (Fig. 2).

Fig. 2

Corticioid genera of (a-c) and (d-f). A: Coronicium alboglaucum*. b-c: Merulicium fusisporum*. d: Radulomyces confluens (ABS 53). e: Radulotubus resupinatus (Dai 15,315 – BJFC). f: Aphanobasidium cf. pseudotsugae (ABS 54). Photos kindly provided by L. Zíbarová (a and f), S. Blaser (b and c), D.J. Harries (d) and C.L. Zhao (e). Bars = 1 cm. * Samples not deposited

The ecological roles of Pterulaceae are not well understood, most being classified from superficial observations as saprotrophs, growing on wood or leaf litter, with wood decay potentially being the ancestral state. Whilst many species are found inhabiting soil or litter, two species are reported to associate with living plants, namely Pterula cf. tenuissima, endophytic in asymptomatic leaves of Magnolia grandiflora, and Pterulicium xylogenum, causal agent of culm rot disease of bamboo (Munkacsi et al. 2004; Villesen et al. 2004; Harsh et al. 2005) and possibly also a pathogen of sugarcane (Corner, 1952b).

Pterulaceae has attracted more attention recently following the discovery of two distinct symbionts of fungus-farming ants in the genus Apterostigma being included in several phylogenetic and ecological studies (Matheny et al. 2006; Hibbett 2007; Dentinger et al. 2009; Binder et al. 2010; Leal-Dutra 2015). Despite the absence (hitherto) of any sexual morph, phylogenetic analyses placed both species, Pterula nudihortorum and Pt. velohortorum [as G2 and G4 in Dentinger (2014)], in a strongly supported clade within Pterulaceae (Munkacsi et al. 2004; Villesen et al. 2004).

Whilst these earlier phylogenetic studies did not focus on resolving evolutionary relationships of the genera, they did demonstrate that the coralloid genera of Pterulaceae are clearly polyphyletic. Amongst the morphological characters previously used to separate the genera, but now known to be phylogenetically unreliable, is the orientation of basidiome growth that differentiates Pterula from Deflexula and the presence of a corticioid patch at the base of the basidiome in Pterulicium (Corner 1950, 1952a, 1970). Therefore, the reclassification of Pterulaceae is required to restore the monophyly of the genera.

We aimed to clarify the phylogenetic relationships of the various genera within Pterulaceae through collection of new samples during fieldwork campaigns in Brazil and additionally sampling of fungarium specimens. This has yielded sequence data from many specimens not included in previous phylogenetic analyses, permitting a comprehensive reappraisal of the phylogeny of Pterulaceae. Here we present a proposal for a new classification based on the phylogeny inferred from three nuclear loci (nrITS, nrLSU and RPB2), including representatives of all genera currently accepted in Pterulaceae except Allantula. Despite several attempts for recollecting Allantula in its type locality, the monotypic genus is still only known from the type specimen collected by Corner (1952a).

METHODS

Collections and morphological observations

Several field campaigns between 2011 and 2017 have obtained new specimens from > 15 locations in nine states across Brazil (Amazonas, Espírito Santo, Minas Gerais, Pará, Paraíba, Paraná, Rio de Janeiro, Rio Grande do Sul and Santa Catarina). The samples were dried in a low-heat food dehydrator and deposited at Aberystwyth University (ABS), Instituto Nacional de Pesquisas da Amazônia (INPA), Jardim Botânico do Rio de Janeiro (RB), Royal Botanic Gardens - Kew (K), Universidade Federal do Oeste do Pará (HSTM) and Universidade Federal de Santa Catarina (FLOR). Morphological identification and taxonomy of Pterulaceae are treated sensu Corner. Microscopic observations followed the methods described in Leal-Dutra (2015) and Leal-Dutra et al. (2018).

DNA extraction, amplification, cloning and sequencing

DNA was extracted from dried basidiomes or freeze-dried cultures by first grinding with liquid nitrogen and then lysis in CTAB buffer (100 mM Tris-HCl pH 8.0, 1.4 M NaCl, 20 mM EDTA, 2% CTAB), clean-up with chloroform:isoamyl alcohol (24:1), precipitation with isopropanol (0.6 vol.) and a final wash with 70% ethanol. Partial sequences of the nrITS, nrLSU and RPB2 were amplified by PCR using the primer pairs listed on Table 1 and following the cycling conditions in the original publications. PCR products were purified using 2 U of Exonuclease I (Thermo Fisher Scientific) and 0.2 U FastAP Thermosensitive Alkaline Phosphatase (Thermo Fisher Scientific) per 1 μl of PCR product, incubated at 37 °C for 15 min, followed by heat inactivation at 85 °C for 15 min. The samples were then sent for Sanger sequencing at the IBERS Translational Genomics Facility (Aberystwyth University) or Jodrell Laboratory (Royal Botanic Gardens, Kew). The same PCR primers were used for sequencing; additional primers were used to sequence the nrLSU and RPB2 (Table 1).

Table 1

Primers used in this study for PCR and sequencing

Primer	Region	Application	Sequence	Reference
ITS8F	nrITS	PCR and sequencing	AGTCGTAACAAGGTTTCCGTAGGTG	(Dentinger et al. 2010)
ITS6R	nrITS	PCR and sequencing	TTCCCGCTTCACTCGCAGT	(Dentinger et al. 2010)
LR0R	nrLSU	PCR and sequencing	ACCCGCTGAACTTAAGC	(Vilgalys and Hester 1990)
LR7	nrLSU	PCR and sequencing	TACTACCACCAAGATCT	(Vilgalys and Hester 1990)
LR5	nrLSU	Sequencing	TCCTGAGGGAAACTTCG	(Vilgalys and Hester 1990)
fRPB2-5F	RPB2	PCR and sequencing	GAYGAYMGWGATCAYTTYGG	(Liu et al. 1999)
bRPB2–7.1R	RPB2	PCR and sequencing	CCCATRGCYTGYTTMCCCATDGC	(Matheny 2005)
bRPB2-6F	RPB2	Sequencing	TGGGGYATGGTNTGYCCYGC	(Matheny 2005)

Chromatograms were manually checked and sequences assembled and edited using GENEIOUS 10.0.2 (Kearse et al. 2012). Samples presenting indels were cloned using pGEM-T Easy Vector Systems (Promega) into Subcloning Efficiency DH5α Competent Cells (Invitrogen). Up to five clones from each sample were amplified and sequenced as above. For each sample clone sequences were aligned to generate one or more consensus sequences and polymorphisms were replaced by respective IUPAC code for ambiguous nucleotide; in cases where indels were found, two different sequences were saved (Leal-Dutra et al. 2018).

Moreover, 27 sequences of nrITS (4), nrLSU (10) and RPB2 (13) were mined from 13 previously assembled and unpublished genomes using NCBI BLAST+ package v2.7.1 (Camacho et al. 2009). Two sequences of each Pterulaceae genus were used as query and the best hit based on the combination of e-value and bit score was selected; the same hit should usually appear for all query sequences. In one case (sample KM190547), more than one optimal hit was found; the subject sequences were compared for occurrence of indels and treated as virtual clones (VC). These sequences are included in the dataset (Table 2). The sequences generated in this study have been submitted to GenBank (Table 2).

Table 2

Details of new sequences generated in this study used in the tree of Fig. 3. (See also Additional file 1)

Taxon (former genus in brackets)	DNA sample ID	Fungarium voucher	Country	Region	ITS	LSU	RPB2
Coronicium alboglaucum	K15	K(M) 170129	UK	England	MK953245	–	–
Coronicium gemmiferum	K13	K(M) 133847	UK	England	MK953246	–	–
Coronicium gemmiferum	K14	K(M) 68853	UK	England	MK953247	MK953403	–
Merulicium fusisporum	K16	K(M) 45181	UK	England	MK953248	–	–
Myrmecopterula (Pterula) moniliformis	F92 Consensus 1	INPA 280127	Brazil	Amazonas	MK953251	MK953405	MK944362
Myrmecopterula (Pterula) moniliformis	M39	FLOR 56397	Brazil	Paraíba	MK953253	MK953406	–
Myrmecopterula (Pterula) moniliformis	MCA	not deposited	–	–	MK953239	MK953392	MK944363
Myrmecopterula (Pterula) nudihortorum	F144 Consensus 1	not deposited	Brazil	Amazonas	MK953257	MK953393	MK944364
Myrmecopterula (Pterula) nudihortorum	KM190547_VC1	K(M) 190547	Panama	–	MK953240	MK953394	MK944365
Myrmecopterula (Pterula) sp.	F103	HSTM-Fungos 9931	Brazil	Pará	MK953260	MK953407	MK944325
Myrmecopterula (Pterula) sp.	F138	FLOR 63724	Brazil	Paraná	MK953262	MK953409	–
Myrmecopterula (Pterula) sp.	F40	FLOR 63725	Brazil	Paraná	MK953264	MK953410	MK944327
Myrmecopterula (Pterula) sp.	F82 Consensus 1	not deposited	Brazil	Amazonas	MK953269	MK953412	MK944366
Myrmecopterula (Pterula) sp.	F94	HSTM-Fungos 9928	Brazil	Pará	MK953274	MK953414	MK944329
Myrmecopterula (Pterula) sp.	F99	HSTM-Fungos 9930	Brazil	Pará	MK953276	MK953415	MK944330
Myrmecopterula (Pterula) sp.	M111	FLOR 56451	Brazil	Santa Catarina	MK953277	–	–
Myrmecopterula (Pterula) sp.	M40 Consensus 1	FLOR 56398; K(M) 205347	Brazil	Paraíba	MK953280	MK953416	MK944367
Myrmecopterula (Pterula) sp.	M69	FLOR 56418	Brazil	Rio Grande do Sul	MK953281	MK953395	MK944368
Myrmecopterula (Pterula) velohortorum	F114	not deposited	Brazil	Espírito Santo	MK953282	MK953396	MK944369
Myrmecopterula (Pterula) velohortorum	F117	not deposited	Brazil	Santa Catarina	MK953283	–	–
Myrmecopterula (Pterula) velohortorum	F135	not deposited	Brazil	Pará	MK953285	–	–
Myrmecopterula (Pterula) velohortorum	F136	not deposited	Brazil	Pará	MK953286	–	–
Myrmecopterula (Pterula) velohortorum	F137	not deposited	Brazil	Pará	MK953287	–	–
Myrmecopterula (Pterula) velohortorum	F140 Clone 1	not deposited	Brazil	Amazonas	MK953288	–	–
Myrmecopterula (Pterula) velohortorum	F152	not deposited	Brazil	Santa Catarina	MK953290	–	–
Myrmecopterula (Pterula) velohortorum	KM190546	K(M) 190546	Panama	–	MK953242	MK953397	MK944370
Myrmecopterula (Pterula) velohortorum	RC12 Consensus 1	not deposited	Brazil	Amazonas	MK953291	–	–
Phaeopterula (Pterula) anomala	KM38182	K(M) 38182	Cameroon	–	MK953295	–	–
Phaeopterula (Pterula) cf. juruensis	F45 Consensus 1	FLOR 63732	Brazil	Paraná	MK953296	MK953417	MK944331
Phaeopterula (Pterula) cf. juruensis	F79 Consensus 1	FLOR 63717	Brazil	Paraná	MK953299	MK953418	–
Phaeopterula (Pterula) cf. stipata	F66 Consensus 1	HSTM-Fungos 9938	Brazil	Pará	MK953301	–	–
Phaeopterula (Pterula) cf. stipata	F98 Consensus 1	HSTM-Fungos 9929	Brazil	Pará	MK953302	–	–
Phaeopterula (Pterula) cf. taxiformis	M4	FLOR 56367	Brazil	Santa Catarina	MK953303	MK953419	–
Phaeopterula (Pterula) juruensis	F41	FLOR 63728	Brazil	Paraná	MK953304	MK953420	MK944332
Phaeopterula (Pterula) juruensis	M21	FLOR 56381	Brazil	Minas Gerais	MK953305	–	–
Phaeopterula (Pterula) juruensis	M36	FLOR 56396	Brazil	Santa Catarina	MK953307	MK953422	–
Phaeopterula (Pterula) sp.	F63 Consensus 1	HSTM-Fungos 9935	Brazil	Pará	MK953316	MK953425	MK944335
Phaeopterula (Pterula) sp.	F78 Clone 1	FLOR 63716	Brazil	Paraná	MK953321	MK953428	MK944338
Phaeopterula (Pterula) sp.	KM135954	K(M) 135954	Belize	–	MK953326	–	–
Phaeopterula (Pterula) sp.	KM137475	K(M) 137475	Puerto Rico	–	MK953327	–	–
Phaeopterula (Pterula) stipata	M15 Consensus 1	FLOR 56375	Brazil	Minas Gerais	MK953330	MK953431	–
Phaeopterula sp. (Allantula?)	F7 Consensus 1	HSTM-Fungos 9944	Brazil	Pará	MK953331	MK953432	MK944339
Pterula cf plumosa	KM167176	K(M) 167176	Ethiopia	–	MK953333	–	–
Pterula cf. loretensis	RLC273	K(M) 205553	Ecuador	Imbabura	MK953334	MK953398	MK944371
Pterula multifida	KM195746	K(M) 195746	UK	England	MK953335	MK953399	MK944372
Pterula sp.	F42	FLOR 63729	Brazil	Paraná	MK953336	MK953433	–
Pterula sp.	F48	FLOR 63735	Brazil	Paraná	–	MK953434	–
Pterula sp.	M112 Consensus 1	FLOR 56452	Brazil	Santa Catarina	MK953337	MK953435	MK944340
Pterula sp.	M153	FLOR 57849	Brazil	Santa Catarina	MK953339	MK953436	MK944341
Pterula sp.	M54	FLOR 56407	Brazil	Santa Catarina	MK953341	MK953438	–
Pterula sp.	M71 Consensus 1	FLOR 56424	Brazil	Santa Catarina	MK953342	MK953439	MK944342
Pterula sp.	KM141379	K(M) 141379	Puerto Rico	–	MK953344	–	–
Pterula sp.	KM167221	K(M) 167221	Australia	Queensland	MK953345	–	–
Pterula subulata	KM145950	K(M) 145,950	Italy	–	MK953346	–	–
Pterula subulata	KM167186	K(M) 167,186	Sweden	–	MK953347	–	–
Pterula verticillata	KM27119	K(M) 27119	Brunei	–	MK953348	–	–
Pterulicium (Deflexula) fasciculare	KM167225	K(M) 167225	Australia	–	MK953349	–	–
Pterulicium (Deflexula) fasciculare	KM167227	K(M) 167227	Malaysia	–	MK953350	–	–
Pterulicium (Deflexula) lilaceobrunneum	M117	FLOR 56455	Brazil	Rio de Janeiro	MK953351	MK953440	MK944343
Pterulicium (Deflexula) secundirameum	BZL44	RB 575791	Brazil	Rio de Janeiro	MK953353	MK953400	MK944373
Pterulicium (Deflexula) secundirameum	M50	FLOR 56403	Brazil	Santa Catarina	MK953354	MK953442	MK944344
Pterulicium (Deflexula) sp.	KM167228	K(M) 167228	Malaysia	–	MK953357	–	–
Pterulicium (Deflexula) sp.	KM167233	K(M) 167233	Sierra Leone	–	MK953358	–	–
Pterulicium (Deflexula) sprucei	F68	HSTM-Fungos 9940	Brazil	Pará	MK953361	MK953447	MK944349
Pterulicium (Deflexula) subsimplex	KM160100	K(M) 160100	Ecuador	–	–	MK953449	–
Pterulicium (Deflexula) subsimplex	M33	FLOR 56393	Brazil	Santa Catarina	MK953363	MK953450	MK944351
Pterulicium (Pterula) brunneosetosum	M35 Consensus 1	FLOR 56395	Brazil	Santa Catarina	MK953366	MK953452	MK944353
Pterulicium (Pterula) caricispendulae	KM155784	K(M) 155784	UK	England	MK953367	–	–
Pterulicium (Pterula) sp.	F20	INPA 280129	Brazil	Amazonas	MK953370	MK953454	–
Pterulicium (Pterula) sp.	F21	INPA 280132	Brazil	Amazonas	MK953371	MK953455	MK944355
Pterulicium (Pterula) sp.	F26	not deposited	Brazil	Espírito Santo	MK953372	MK953456	MK944356
Pterulicium (Pterula) sp.	F30	not deposited	Brazil	Espírito Santo	MK953373	MK953457	MK944357
Pterulicium (Pterula) sp.	F57	HSTM-Fungos 9925	Brazil	Pará	MK953376	MK953460	MK944359
Pterulicium (Pterula) sp.	F76 Consensus 1	HSTM-Fungos 9950	Brazil	Pará	MK953382	MK953461	MK944360
Pterulicium (Pterula) sp.	M1	FLOR 56364	Brazil	Santa Catarina	MK953383	MK953462	MK944361
Pterulicium (Pterula) sp.	M6	FLOR 56369	Brazil	Santa Catarina	MK953384	MK953463	–
Pterulicium (Pterulicium) xylogenum	KM167222	K(M) 167222	Bangladesh	–	MK953387	–	–
Aphanobasidium pseudotsugae	K6	K(M) 170662	UK	England	MK953243	MK953402	–
Aphanobasidium pseudotsugae	K7	K(M) 180787	UK	Scotland	MK953244	–	–
Radulomyces confluens	KM167249	K(M) 167249	Brazil	–	MK953388	–	–
Radulomyces confluens	KM167250	K(M) 167250	Argentina	–	MK953389	–	–
Radulomyces confluens	KM181613	K(M) 181613	UK	England	MK953390	MK953401	MK944374
Radulomyces copelandii	M150	K(M) 173275	USA	–	MK953391	MK953465	–

Fig. 3

Maximum-likelihood tree of Pterulaceae and Radulomycetaceae. Support values on the branches are UFBoot/BPP and shown only for UFBoot≥70 and BPP ≥ 0.70 and branch length ≥ 0.003 substitutions per site. Asterisks (*) represent maximum UFBoot/BPP values, dashes (−) represent values below the cut-off threshold (70%), and dots (.) represent ML clades that were not recovered in the BI tree. Details for the complete tree can be found in Additional file 2 and TreeBase (ID: 24428). Scale bar: nucleotide substitutions per site

Phylogenetic analyses

A preliminary maximum-likelihood (ML) analysis was conducted with the sequences generated in this study alongside GenBank sequences to find the best outgroup for Pterulaceae based on previous studies (Dentinger et al. 2016; Zhao et al. 2016; Matheny et al. 2006; Larsson 2007) and to assess the similarities between the cloned sequences (Additional file 1; Additional file 2).

A reduced version of the previous dataset with only one sequence from each cloned sample was created. After removing near-identical sequences with no phylogenetic resolution, the final dataset comprised 119 sequences, including 32 sequences from GenBank and four sequences of Stephanospora as outgroups, and was divided into five partitions for further analyses: ITS1, 5.8S, ITS2, LSU and RPB2. Each partition was aligned separately with MAFFT v7.311 (Katoh and Standley 2013) using the E-INS-i algorithm for ITS1 and ITS2, and L-INS-i for 5.8S, LSU and RPB2. The alignments were examined and corrected manually in AliView v1.5 (Larsson 2014) and trimmed to remove uneven ends. Following the simple indel coding (Simmons and Ochoterena 2000), a morphological matrix were constructed using SeqState (Müller 2005) where indels were coded as binary characters. The nucleotide alignments were then trimmed with trimAl v1.4.rev22 (Capella-Gutiérrez et al. 2009) with the option -gappyout to remove unaligned regions.

Maximum-likelihood tree reconstruction was performed with IQ-TREE v1.6.7.1 (Nguyen et al. 2015). The best-fit evolutionary models and partitioning scheme for this analysis were estimated by the built-in ModelFinder (option -m MF + MERGE) allowing the partitions to share the same set of branch lengths but with their own evolution rate (−spp option) (Chernomor et al. 2016; Kalyaanamoorthy et al. 2017). Branch support was assessed with 1000 replicates of ultrafast bootstrapping (UFBoot) (Hoang et al. 2018) and allowing resampling partitions and then sites within these partitions to reduce the likelihood of false positives on branch support (option -bspec GENESITE).

Bayesian Inference (BI) was implemented using MRBAYES v3.2 (Ronquist et al. 2012) with two independent runs, each one with four chains and starting from random trees. The best-fit evolutionary models and partitioning scheme for these analyses were estimated as for the ML analysis but restricting the search to models implemented on MRBAYES (options -m TESTMERGEONLY -mset mrbayes). Chains were run for 107 generations with tree sampling every 1000 generations. The burn-in was set to 25% and the remaining trees were used to calculate a 50% majority consensus tree and Bayesian Posterior Probability (BPP). The convergence of the runs was assessed on TRACER v1.7 (Rambaut et al. 2018) to ensure the potential scale reduction factors (PSRF) neared 1.0 and the effective sample size values (ESS) were sufficiently large (> 200). Nodes with BPP ≥0.95 and/or UFBoot ≥95 were considered strongly supported. Alignment and phylogenetic trees are deposited in Treebase (ID: 24428).

RESULTS

From this section, all taxa are referred to by the names proposed in this study.

Field data

Fieldwork resulted in the discovery of approximately 100 new specimens, now placed within Pterulaceae (Table 2). Axenic culture isolation was also possible from several of these specimens.

A total of 278 sequences from 123 samples were generated in this study: 153 nrITS, 74 nrLSU and 51 RPB2; 61 from cloning and 40 from genome mining. The final alignment consisted of 113 sequences with 2737 characters and 1050 parsimony-informative sites. The BI analysis converged both runs as indicated by the effective sample sizes (ESS) of all parameters above 2800 and the potential scale reduction factors (PSRF) equal 1.000 for all the parameters according to the 95% HPD Interval.

The new classification proposed in this study (Fig. 3), highlights six main clades containing nine genera: Radulomycetaceae (containing Aphanobasidium, Radulotubus and Radulomyces), Phaeopterula (hereinafter abbreviated as Ph.; previously Pterula spp.), Coronicium superclade (grouping Merulicium and Coronicium), Pterulicium (previously Pterulicium, Pterula spp. and Deflexula spp.), Pterula and Myrmecopterula (Myrmecopterula gen. nov., previously Pterula spp.).

Radulomycetaceae (UFBoot = 99; BPP = 1)

This clade groups with strong support three of the five resupinate genera recognized in Pterulaceae, namely Aphanobasidium (UFBoot = 100; BPP = 1), Radulotubus (UFBoot = 100; BPP = 1) and Radulomyces (UFBoot = 100; BPP = 0.86). The placement of Aphanobasidium and Radulomyces into Pterulaceae was previously shown by phylogenetic reconstructions of corticioid taxa (Larsson et al. 2004; Larsson 2007). Radulotubus was proposed by Zhao et al. (2016) as sister clade of Radulomyces to accommodate one species bearing poroid hymenophore. In our analyses, Radulotubus was recovered in the same position as in the original publication. This is the only poroid species within Pterulaceae.

No members of the three genera within this superclade are pteruloid (i.e. coralloid basidiomes with dimitic hyphal system) in their morphology and consequently we introduce the family name Radulomycetaceae fam. nov. to accommodate them, as discussed further below. The current sister clade to Pterulaceae in our analyses is Stephanosporaceae, from which members of the Radulomycetaceae clade are clearly distinct phylogenetically and morphologically.

Phaeopterula (UFBoot = 100; BPP = 1)

Phaeopterula received maximum support in both analyses. It includes Pterula stipata, Pt. anomala, Pt. juruensis and other species which all have dark brown basidiomes. This clade is the first coralloid lineage to diverge within Pterulaceae. As these species render Pterula paraphyletic, a reclassification is needed. The generic name Phaeopterula was originally proposed as a subgenus of Pterula to accommodate Ph. hirsuta and Ph. juruensis (Hennings 1900; Hennings 1904). We propose its reintroduction below to distinguish these brown-pigmented taxa from Pterula s. str.

Coronicium superclade (UFBoot = 98; BPP = 1)

This clade groups the remaining two resupinate genera of Pterulaceae, the monospecific Merulicium and Coronicium (UFBoot = 100; BPP = 1). Both genera form resupinate basidiomes but differ in the hyphal system present (dimitic in Merulicium, monomitic in Coronicium). Some Pterulicium species also show transitions in their morphology to a resupinate state. Corner (1950) showed that Pm. xylogenum Corner could form monomitic corticioid patches independent of the coralloid state and even in its absence, thus appearing to be truly corticioid. Furthermore, experimental studies on Pm. echo show a dimitic, resupinate, fertile corticioid phase both on agar and when cultured on cocoa twigs (McLaughlin and McLaughlin 1972; McLaughlin et al. 1978; McLaughlin and McLaughlin 1980). Despite the morphological distinctiveness from the rest of Pterulaceae, there is a trend in the morphology and strong phylogeny support for the placement of the Coronicium superclade among Pterula/Myrmecopterula and Pterulicium clades within Pterulaceae.

Pterulicium (UFBoot = 99; BPP = 1)

Two type species, Pterulicium xylogenum and Deflexula fascicularis, are nested within this clade alongside several species currently assigned to Pterula but which all have simple basidiomes (unbranched or limited branching). The Pterula species are interspersed with some Deflexula, rendering both genera polyphyletic. Pterulicium xylogenum forms a well-supported subclade with Pterula secundiramea (= Pt. palmicola). Deflexula fascicularis forms a subclade with other Deflexula species that share globose spores, an unusual feature within Pterulaceae, most of which form ellipsoid to subamygdaliform spores.

Pterula (UFBoot = 100; BPP = 1)

This clade groups the true Pterula spp. that are represented by very bushy coralloid basidiomes, usually robust and taller than those of Pterulicium, stipe concolorous with hymenophore and lacking a cottony subiculum. Pterula has a mainly pantropical and pan-subtropical distribution, with occurrence reported to all continents except Antarctica (Corner 1970).

Myrmecopterula (UFBoot = 97; BPP = 1)

This sister clade of Pterula represents the newly proposed genus (see below). It groups the two species cultivated by attine ants in the Apterostigma pilosum group with M. moniliformis and several unidentified free-living species. The species in this clade are only known from the Neotropics. Myrmecopterula is divided into seven subclades (Fig. 3) representing the two mutualists (MUTV and MUTN), three closely related to M. velohortorum (SAPV 1–3) and two closely related to M. nudihortorum (SAPN 1–2).

TAXONOMY

Radulomycetaceae Leal-Dutra, Dentinger, G.W. Griff., fam. nov.

MycoBank MB831047.

Diagnosis: Differs from resupinate forms of Pterulaceae in the monomitic hyphal system and the absence of cystidia. Cystidia may be either present or absent in Pm. xylogenum, in the latter case the amygdaliform spores differentiate the species from Radulomyces that has ellipsoid to globose spores.

Etymology: From the type genus Radulomyces.

Type genus: Radulomyces M.P. Christ. 1960.

Description: Basidiome resupinate, effused, mostly adnate, ceraceous, hymenophore smooth, tuberculate, odontioid, raduloid or poroid. Hyphal system monomitic, generative hyphae with clamps, hyaline, thin- to slightly thick-walled. Cystidia absent. Basidia terminal clavate or other form if pleural, usually with 4-sterigmata and a basal clamp. Basidiospores ellipsoid to globose, hyaline, mostly smooth, thin- to slightly thick-walled, acyanophilous, inamyloid and non-dextrinoid.

Notes: Radulomyces, Aphanobasidium and Radulotubus are placed in Radulomycetaceae. Larsson (2007) suggested that Lepidomyces had affinities to Aphanobasidium and could possibly be placed in Pterulaceae. However, no sequence data for the genus are available. Lepidomyces is described as bearing pleurobasidia as in Aphanobasidium, but also leptocystidia as in Coronicium and Merulicium. Given its morphological similarities to Aphanobasidium and the Coronicium superclade, we retain Lepidomyces as incertae sedis until molecular data are available to confirm its phylogenetic position

Myrmecopterula Leal-Dutra, Dentinger & G.W. Griff., gen. nov.

MycoBank MB831048.

Etymology: From the ancient Greek μύρμηκος (=mýrmēkos), genitive form of μύρμηξ (=mýrmēx), ants. Thus, Pterula of the ants, due to the observed relationship of several taxa in this genus with nests of fungus-growing ants.

Diagnosis: Differs from Pterula in the presence of the cottony subiculum.

Type species: Myrmecopterula moniliformis (Henn.) Leal-Dutra et al. 2019.

Description: Basidiome if present bushy, pteruloid, white-cream to light brown and greyish surface, normally concolorous or stipe with a darker tone than the hymenophore, arising from cottony subiculum with mycelial cords. Stipe surface sterile. Hyphal system, dimitic hyphal system. Basidiospores relatively small spores, usually less than 7 μm wide.

Ecology: Usually associated with the nests of ants, growing on top, or from a living or dead nest, or being cultivated by the ants.

Notes: Basidiomes of Myrmecopterula species are very similar to those of Pterula in habit, shape, and colour, but differ in the presence of mycelial cords and a cottony subiculum from which the basidiomes emerge. Some species of Myrmecopterula arise from soil, while others superficially appear to grow on wood. Closer observation of basidiomes formed on wood revealed that, rather than being lignicolous, they instead grow from a loose, granular substrate within a cavity inside the wood. This substrate in some cases resembles the substrate in the fungus gardens of the Apterostigma pilosum group of ants. In addition, M. moniliformis, which arises from soil, has been found emerging from active and inactive attine nests, (S. Sourell, pers. comm.; M. C. Aime, pers. comm.). Thus, all but one of the Myrmecopterula clades found to date had some association with attine ants, of which the two farmed mutualist species (M. nudihortorum and M. velohortorum) are best known. The five other species (of which only M. moniliformis is named) are less well studied and may play a role in decomposition of residual substrates in abandoned fungus garden, or potentially even as mycoparasites of the ant cultivar. In contrast, no Pterula spp. have any reported association with ants, but instead are found growing directly from wood and leaf litter.

Myrmecopterula moniliformis (Henn.) Leal-Dutra, Dentinger & G.W. Griff., comb. nov.

MycoBank MB831049.

Basionym: Lachnocladium moniliforme Henn., Hedwigia 43: 198 (1904).

Synonyms: Pterula moniliformis (Henn.) Corner, Ann. Bot., Lond., n.s. 16: 569 (1952).

Thelephora clavarioides Torrend, Brotéria, sér. Bot. 12: 61 (1914).

Description: Corner (1952b: 546–548).

Myrmecopterula nudihortorum (Dentinger) Leal-Dutra, Dentinger & G.W. Griff., comb. nov.

MycoBank MB831050.

Basionym: Pterula nudihortorum Dentinger, Index Fungorum 98: 1 (2014); as ‘nudihortus’, and later ‘nudihorta’.

Diagnosis: In the field, recognized by the absence of any veil on the fungus garden in Apterostigma nests, usually inside decomposing trunks or underground. In culture, it forms very little aerial mycelium and exhibits very slow growth (2–3 mm/week radial growth rate on PDA at 25C). Hyphal clamps abundant.

Notes This species was formerly known as the ant cultivar G4. It is only known from the nest of fungus-growing ants in the Apterostigma pilosum group in the A. manni subclade (Schultz 2007).

Myrmecopterula velohortorum (Dentinger) Leal-Dutra, Dentinger & G.W. Griff., comb. nov.

MycoBank MB831051.

Basionym: Pterula velohortorum Dentinger. Index Fungorum 98: 1 (2014); as ‘velohortus’, and later ‘velohorta’.

Diagnosis: In the field, recognized by the Apterostigma garden covered by a mycelial veil, usually inside decomposing trunks, below the leaf litter or hanging on exposed surfaces aboveground. In culture, it forms very cottony aerial mycelia with presence of racquet hyphae (Fig. 5 in Additional file 3). Large and abundant hyphal clamps. Slow growth rate, but faster than M. nudihortorum.

Notes: This species was formerly known as the ant cultivar G2. It is only known from the nest of fungus-growing ants in the Apterostigma pilosum group in the A. dentigerum subclade (Schultz 2007).

Phaeopterula (Henn.) Sacc. & D. Sacc., Syll. Fung. 17: 201 (1905).

Basionym: Pterula subgen. Phaeopterula Henn., Monsunia 1: 9 (1900) [“1899”].

Type species: Phaeopterula hirsuta (Henn.) Sacc. & D. Sacc. 1899.

Description: Basidiomes pteruloid, solitary or gregarious, scarcely branched to almost bushy, monopodial and slightly symmetric, branches from light brownish pink or greyish to pale brown and stipe dark reddish to rusty brown. Stipe surface glabrous with agglutinated hyphae (not sclerotioid) to villose-tomentose. Dark brown mycelial cords usually present. Hyphal system dimitic with thick-walled skeletal hyphae, generative hyphae thin-walled and often clamped. Hymenial cystidia absent, caulocystidia sometimes present. Basidia terminal, clavate to suburniform. Basidiospores less than 9 μm varying between pip-shaped, subamygdaliform and ellipsoid.

Ecology: Growing on dead twigs or dead wood.

Notes: Hennings (1900) recognized the subgenus Phaeopterula to accommodate Pterula hirsuta that was distinguished from other Pterula species by the reportedly brown spores. Hennings (1904) later described a second species in the subgenus, Ph. juruensis, but noted that it was morphologically quite distinct from Ph. hirsuta. Phaeopterula was raised to generic level by Saccardo and Saccardo (1905) who cited only Ph. juruensis. Pterula hirsuta was recombined in Dendrocladium by Lloyd (1919) but later returned to Pterula by Corner (1950), even though Corner did not confirm the presence of brown spores in the samples he examined. Although we also have not observed pigmented spores in any of these taxa, dark brown pigments in the stipe hyphae are a consistent and diagnostic feature in this group, so we resurrect the name Phaeopterula. The term ‘Phaeo-’ relates to brown-pigmented basidiospores, but while members of this genus do not have brown basidiospores, they do contain brown hyphal pigments.

Phaeopterula anomala (P. Roberts) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB830999.

Basionym: Pterula anomala P. Roberts, Kew Bull. 54(3): 528 (1999).

Description: Roberts (1999: 528–529).

Phaeopterula hirsuta (Henn.) Sacc. & D. Sacc., Syll. fung. (Abellini) 17: 201 (1905).

MycoBank MB469044.

Basionym: Pterula hirsuta Henn., Monsunia 1: 9 (1899) [1900].

Synonym: Dendrocladium hirsutum (Henn.) Lloyd, Mycol. Writ. 5: 870 (1919).

Description: Corner (1950: 517).

Phaeopterula juruensis Henn. ex Sacc. & D. Sacc., Syll. Fung. 17: 201 (1905).

MycoBank MB634235.

Basionym: Henn. ex Sacc. & D. Sacc., Syll. Fung. 17: 201 (1905).

Synonym: Dendrocladium juruense (Henn. ex Sacc. & D. Sacc.) Lloyd, Mycol. Writ. 5: 870 (1919).

Pterula juruensis (Henn. ex Sacc. & D. Sacc.) Corner, Monogr. Clavaria.: 518 (1950).

Phaeopterula juruensis Henn., Hedwigia 43 (3): 175 (1904).

Descriptions: Corner (1950:518; 1952b: 542–544).

(Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831000.

Basionym: Pterula stipata Corner, Ann. Bot., Lond., n.s. 16: 568 (1952).

Description: Corner (1952b: 556–557).

Phaeopterula taxiformis (Mont.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831001.

Basionym: Pterula taxiformis Mont., Syll. Gen.: 181 (1856).

Synonyms: Lachnocladium taxiforme (Mont.) Sacc., Syll. Fung. 6: 740 (1888).

Pterula humilis Speg., Revista Argent. Hist. Nat. 1(2): 110 (1891).

Pterula humilis var. tucumanensis Speg., Anal. Mus. nac. B. Aires, Ser. 3 12: 280 (1909).

Descriptions: Corner (1950: 523–524; 1952b: 560–561).

Phaeopterula taxiformis var. gracilis (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831002.

Basionym: Pterula taxiformis var. gracilis Corner, Ann. Bot., Lond., n.s. 16: 568 (1952).

Description: Corner (1952b: 561).

Pterulicium Corner, Monogr. Clavaria.: 699 (1950).

Synonym: Deflexula Corner, Monogr. Clavaria.: 695 (1950).

Type Species: Pterulicium xylogenum (Berk. & Broome) Corner 1950.

Description: Basidiomes pteruloid rarely corticioid, solitary or gregarious, simple or scarcely branched, occasionally exhibiting abundant unilateral branching (Figs. 1i, l), varying from creamy white to brown on the stipe and creamy white on the tips or creamy white or pale lilaceous to pale brown on uniformly coloured basidiomes. Stipe surface sometimes sclerotioid (see Corner 1950). Hyphal system dimitic with slightly thick-walled skeletal hyphae, generative hyphae thin-walled and often clamped. Hymenial cystidia usually present, caulocystidia sometimes present. Basidia terminal, clavate to suburniform. Basidiospores shape varying between globose to subglobose, pip-shaped, amygdaliform to subamygdaliform, ellipsoid.

Ecology: On dead leaves, dead twigs or dead wood, rarely as a pathogen or endophyte of living plants.

Notes: Deflexula is synonymised with Pterulicium in this study. In addition, several species previously placed in Pterula are transferred to Pterulicium below. Other Pterula species that might need to be recombined in Pterulicium, require further investigation since their original descriptions do not provide enough information to confidently assign them here.

Pterulicium argentinum (Speg.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831003.

Basionym: Mucronella argentina Speg., Anal. Mus. nac. Hist. nat. B. Aires 6: 178 (1899) [“1898”].

Synonyms: Deflexula argentina (Speg.) Corner, Ann. Bot., Lond., n.s. 16: 276 (1952).

Deflexula lilaceobrunnea var. elongata Corner, Ann. Bot., Lond., n.s. 16: 276 (1952).

Descriptions: Corner (1952a: 276; 1970: 196).

Pterulicium argentinum var. ramosum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831004.

Basionym: Deflexula argentina (Speg.) Corner, Ann. Bot., Lond., n.s. 16: 276 (1952).

Description: Corner (1970: 197).

Pterulicium bambusae (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831005.

Basionym: Pterula bambusae Corner, Beih. Nova Hedwigia 33: 209 (1970).

Description: Corner (1970: 209).

Pterulicium bromeliphilum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831006.

Basionym: Pterula bromeliphila Corner, Beih. Nova Hedwigia 33: 210 (1970)

Description: Corner (1970: 210).

Pterulicium brunneosetosum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831007.

Basionym: Pterula brunneosetosa Corner, Ann. Bot., Lond., n.s. 16: 566 (1952).

Descriptions: Corner (1952b: 535–536; 1970: 210).

Pterulicium campoi (Speg.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831008.

Basionym: Pterula campoi Speg., Bol. Acad. nac. Cienc. Córdoba 25: 29 (1921).

Descriptions: Corner (1970: 210–211) and Spegazzini (1921: 29–30).

Pterulicium caricis-pendulae (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831009.

Basionym: Pterula caricis-pendulae Corner, Beih. Nova Hedwigia 33: 211 (1970).

Description: Corner (1970: 211–212).

Pterulicium crassisporum (P. Roberts) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831010.

Basionym: Pterula crassispora P. Roberts, Kew Bull. 54: 531 (1999).

Description: Roberts (1999: 531–532).

Pterulicium cystidiatum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831011.

Basionym: Pterula cystidiata Corner, Ann. Bot., Lond., n.s. 16: 567 (1952).

Description: Corner (1952b: 537–539).

Pterulicium debile (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831012.

Basionym: Pterula bromeliphila Corner, Monogr. Clavaria.: 698 (1950).

Description: Corner (1950: 508–510).

Pterulicium echo (D.J. McLaughlin & E.G. McLaughlin) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831013.

Basionym: Pterula echo D.J. McLaughlin & E.G. McLaughlin, Can. J. Bot. 58: 1328 (1980).

Description: McLaughlin and McLaughlin (1980: 1328–1332).

Pterulicium epiphylloides (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831014.

Basionym: Pterula epiphylloides Corner, Ann. Bot., Lond., n.s. 16: 567 (1952).

Description: Corner (1952b: 540).

Pterulicium epiphyllum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831015.

Basionym: Pterula epiphylla Corner Monogr. Clavaria.: 698 (1950).

Description: Corner (1950: 510–511).

Pterulicium fasciculare (Bres. & Pat.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831016.

Basionym: Pterula fascicularis Bres. & Pat., Mycol. Writ. 1: 50 (1901).

Synonym: Deflexula fascicularis (Bres. & Pat.) Corner, Monogr. Clavaria.: 395 (1950).

Description: Corner (1950: 395–397).

Pterulicium fluminense (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831017.

Basionym: Pterula fluminensis Corner, Ann. Bot., Lond., n.s. 16: 567 (1952).

Descriptions: Corner (1952b: 541–542; 1970: 215).

Pterulicium gordium (Speg.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831018.

Basionym: Clavaria gordius Speg., Anal. Soc. cient. Argent. 17(2): 83 (1884).

Synonym: Pterula gordius (Speg.) Corner, Monogr. Clavaria.: 513 (1950).

Description: Corner (1950: 513–514).

Pterulicium gordium var. macrosporum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831019.

Basionym: Pterula gordius var. macrospora Corner, Proc. Linn. Soc. London 178: 100 (1967).

Description: Corner (1967: 100–101).

Pterulicium gracile (Desm. & Berk.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831020.

Basionym: Typhula gracilis Desm. & Berk., Ann. nat. Hist., Mag. Zool. Bot. Geol. 1: 202 (1838).

Synonyms: Pistillaria gracilis (Desm. & Berk.) Pat., Tab. analyt. Fung. (Paris)(6): 30 (1886).

Hirsutella gracilis (Desm. & Berk.) Pat., Revue mycol., Toulouse 14(no. 54): 69 (1892).

Pterula gracilis (Desm. & Berk.) Corner, Monogr. Clavaria.: 514 (1950).

Clavaria aculina Quél., C. r. Assoc. Franç. Avancem. Sci. 9: 670 (1881) [1880].

Pistillaria aculina (Quél.) Pat., Tab. analyt. Fung. (Paris)(6): 29 (Fig. 570) (1886).

Ceratella aculina (Quél.) Pat., Hyménomyc. Eur. (Paris): 157 (1887).

Cnazonaria aculina (Quél.) Donk, Meded. Bot. Mus. Herb. Rijks Univ. Utrecht 9: 97 (1933).

Pistillaria aculina subsp. juncicola Bourdot & Galzin, Hyménomyc. de France (Sceaux): 138 (1928) [1927].

Pistillaria aculina subsp. graminicola Bourdot & Galzin, Hyménomyc. de France (Sceaux): 139 (1928) [1927].

Pistillaria aculina subsp. acicula Bourdot & Galzin, Hyménomyc. de France (Sceaux): 139 (1928) [1927].

Typhula brunaudii Quél., C. r. Assoc. Franç. Avancem. Sci. 13: 283 (1885) [1884].

Clavaria brunaudii (Quél.) Sacc., Syll. fung. (Abellini) 6: 730 (1888).

Ceratella ferryi Quél. & Fautrey, Revue mycol., Toulouse 15(no. 57): 15 (1893).

Pistillaria ferryi (Quél. & Fautrey) Sacc., Syll. fung. (Abellini) 11: 141 (1895).

Pistillaria ferryi subsp. tremula Sacc., Syll. fung. (Abellini) 17: 202 (1905).

Mucronella rickii Oudem., Ned. kruidk. Archf, 3 sér. 2(3): 667 (1902).

Cnazonaria rickii (Oudem.) Donk, Meded. Bot. Mus. Herb. Rijks Univ. Utrecht 9: 99 (1933).

Ceratellopsis rickii (Oudem.) Corner, Monogr. Clavaria.: 205 (1950).

Description: Corner (1950: 514–516).

Pterulicium incarnatum (Pat.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831021.

Basionym: Pterula incarnata Pat., in Patouillard & Lagerheim, Bull. Herb. Boissier 3(1): 58 (1895).

Descriptions: Corner (1950: 517; 1970: 215–216).

Pterulicium intermedium (Dogma) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831022.

Basionym: Pterula intermedia Dogma, Philipp. Agric. 49: 852 (1966).

Descriptions: Corner (1970): 216 and Dogma (1966: 852-855).

Pterulicium laxum (Pat.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831023.

Basionym: Pterula laxa Pat., Bull. Soc. mycol. Fr. 18(2): 175 (1902).

Descriptions: Corner (1950: 518; 1970: 217).

Pterulicium lilaceobrunneum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831024.

Basionym: Deflexula lilaceobrunnea Corner, Monogr. Clavaria.: 695 (1950).

Description: Corner (1950: 397–398).

Pterulicium lilaceobrunneum var. evolutius (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831025.

Basionym: Deflexula lilaceobrunnea var. evolutior Corner, Beih. Nova Hedwigia 33: 197 (1970).

Description: Corner (1970: 197–198).

Pterulicium longisporum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831026.

Basionym: Pterula longispora Corner, Ann. Bot., Lond., n.s. 16: 567 (1952).

Description: Corner (1952b: 544–545).

Pterulicium macrosporum (Pat.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831027.

Basionym: Ceratella macrospora Pat., in Patouillard & Lagerheim, Bull. Soc. mycol. Fr. 8(3): 119 (1892).

Synonyms: Pistillaria macrospora (Pat.) Sacc., Syll. fung. (Abellini) 11: 142 (1895).

Pterula macrospora (Pat.) Corner, Monogr. Clavaria.: 518 (1950).

Descriptions: Corner (1950: 518; 1970: 218).

Pterulicium majus (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831028.

Basionym: Deflexula major Corner, Ann. Bot., Lond., n.s. 16: 277 (1952).

Description: Corner (1952a: 277–278).

Pterulicium mangiforme (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831029.

Basionym: Deflexula mangiformis Corner, Ann. Bot., Lond., n.s. 16: 278 (1952).

Description: Corner (1952a: 278).

Pterulicium microsporum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831030.

Basionym: Deflexula microspora Corner, Bull. Jard. bot. État Brux. 36: 264 (1966).

Description: Corner (1966: 264).

Pterulicium nanum (Pat.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831031.

Basionym: Pterula nana Pat., Bull. Soc. mycol. Fr. 18(2): 175 (1902).

Synonyms: Deflexula nana (Pat.) Corner, Bull. Jard. bot. État Brux. 36: 264 (1966).

Pterula vanderystii Henn. [as ‘vanderysti’], Ann. Mus. Congo Belge, Bot., Sér. 5 2(2): 96 (1907).

Deflexula vanderystii (Henn.) Corner, Ann. Bot., Lond., n.s. 16: 284 (1952).

Description: Corner (1966: 264).

Pterulicium naviculum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831032.

Basionym: Pterula navicula Corner, Ann. Bot., Lond., n.s. 16: 568 (1952).

Description: Corner (1952b: 549–550).

Pterulicium oryzae (Remsberg) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831033.

Basionym: Pistillaria oryzae Remsberg, Mycologia 32(5): 668 (1940).

Synonym: Pterula oryzae (Remsberg) Corner, Monogr. Clavaria.: 519 (1950).

Descriptions: Corner (1950: 519–520) and Remsberg (1940: 668–670).

Pterulicium phyllodicola (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831034.

Basionym: Pterula phyllodicola Corner, Beih. Nova Hedwigia 33: 220 (1970).

Description: Corner (1970: 220).

Pterulicium phyllophilum (McAlpine) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831035.

Basionym: Clavaria phyllophila McAlpine, Agric. Gaz. N.S.W., Sydney 7: 86 (1896).

Synonym: Pterula phyllophila (McAlpine) Corner, Monogr. Clavaria.: 520 (1950).

Description: Corner (1950: 520).

Pterulicium rigidum (Donk) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831036.

Basionym: Pterula rigida Donk, Monogr. Clavaria.: 698 (1950).

Description: Corner (1950: 521).

Pterulicium sclerotiicola (Berthier) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831037.

Basionym: Pterula sclerotiicola Berthier, Bull. trimest. Soc. mycol. Fr. 83: 731 (1968) [1967].

Description: Corner (1970: 221).

Pterulicium secundirameum (Lév) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831038.

Basionym: Clavaria secundiramea Lév., Annls Sci. Nat., Bot., sér. 3 2: 216 (1844).

Synonyms: Pterula secundiramea (Lév.) Speg., Bol. Acad. nac. Cienc. Córdoba 11(4): 466 (1889).

Deflexula secundiramea (Lév.) Corner, Beih. Nova Hedwigia 33: 199 (1970).

Pterula palmicola Corner, Ann. Bot., Lond., n.s. 16: 568 (1952).

Descriptions: Corner (1950: 521–522; 1952b: 555–556).

Notes: The synonymisation of Pm. palmicola (samples M50 and M83) in Pm. secundirameum (samples M70 and genome5) is based on our phylogenetic results and morphological comparisons. The only morphological difference between the two species is the shape of the basidiome, however, the other characters are similar and both species are nested together within our tree (Additional file 2).

Pterulicium sprucei (Mont.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831039.

Basionym: Hydnum sprucei Mont., Syll. gen. sp. crypt. (Paris): 173 (1856).

Synonyms: Pterula sprucei (Mont.) Lloyd, Mycol. Writ. 5: 865 (1919).

Deflexula sprucei (Mont.) Maas Geest., Persoonia 3(2): 179 (1964).

Pterula pennata Henn., Hedwigia 43(3): 174 (1904).

Deflexula pennata (Henn.) Corner, Ann. Bot., Lond., n.s. 16: 278 (1952).

Descriptions: Corner (1952a: 278–279 as ‘D. pennata’; 1970: 200–201) and Maas Geesteranus (1964: 178–179).

Pterulicium subsimplex (Henn.) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831040.

Basionym: Pterula subsimplex Henn., Hedwigia 36(4): 197 (1897).

Synonyms: Deflexula subsimplex (Henn.) Corner, Ann. Bot., Lond., n.s. 16: 279 (1952).

Pterula nivea Pat., Bull. Soc. mycol. Fr. 18(2): 174 (1902).

Deflexula nivea (Pat.) Corner, Monogr. Clavaria.: 398 (1950).

Mucronella pacifica Kobayasi, Bot. Mag., Tokyo 53: 160 (1939).

Deflexula pacifica (Kobayasi) Corner, Monogr. Clavaria.: 399 (1950).

Descriptions: Corner (1952a: 279–282; 1950: 399 as ‘D. pacifica’.

Pterulicium subsimplex var. multifidum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831041.

Basionym: Deflexula subsimplex var. multifida Corner, Ann. Bot., Lond., n.s. 16: 282 (1952).

Description: Corner (1952a: 282–283).

Pterulicium subtyphuloides (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831042.

Basionym: Pterula subtyphuloides Corner, Monogr. Clavaria.: 698 (1950).

Description: Corner (1950: 522–523).

Pterulicium sulcisporum (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831043.

Basionym: Deflexula sulcispora Corner, Ann. Bot., Lond., n.s. 16: 283 (1952).

Description: Corner (1952a: 283–284).

Pterulicium tenuissimum (M.A. Curtis) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831044.

Basionym: Typhula tenuissima M.A. Curtis, Am. Journ. Art. Scienc. 6: 351 (1848).

Synonym: Pterula tenuissima (M.A. Curtis) Corner, Monogr. Clavaria.: 524 (1950).

Description: Corner (1950: 524).

Pterulicium typhuloides (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB832820.

Basionym: Pterula typhuloides Corner, Monogr. Clavaria.: 698 (1950).

Description: Corner (1950: 525–526).

Pterulicium typhuloides var. minor (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB832821.

Basionym: Pterula typhuloides var. minus Corner, Monogr. Clavaria.: 699 (1950).

Description: Corner (1950: 526–527).

Pterulicium ulmi (Peck) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831045.

Basionym: Mucronella ulmi Peck, Ann. Rep. Reg. N.Y. St. Mus. 54: 154 (1902) [1901].

Synonym: Deflexula ulmi (Peck) Corner, Monogr. Clavaria.: 400 (1950).

Descriptions: Corner (1950: 400; 1970: 202).

Pterulicium velutipes (Corner) Leal-Dutra, Dentinger, G.W. Griff., comb. nov.

MycoBank MB831046.

Basionym: Pterula velutipes Corner, Ann. Bot., Lond., n.s. 16: 569 (1952).

Description: Corner (1952b: 565–566).

Key to genera ofand

* Myrmecopterula cultivated by Apterostigma was never reported forming basidiomes

** Allantoid = sausage-shaped, in this case with inflated portions of hymenium intercalating with rhizomorph (see Allantula in Corner 1952c)

*** Pterulicium xylogenum and Pm. echo can have corticioid growth independently of coralloid basidiomes. The cystidia in the former may be either present or absent

DISCUSSION

Introduction of Radulomycetaceae

We consider that it is better to erect a new family for these three genera (i.e. Radulomyces, Radulotubus and Aphanobasidium) than to leave them in Pterulaceae where they are clearly phylogenetically and morphologically distinct from nearly all the other members of Pterulaceae. In contrast, Merulicium (Fig. 2b-c) and Coronicium (Fig. 2a) form corticioid basidiomes but our phylogenetic analyses place them clearly within Pterulaceae. Two Pterulicium species, Pm. echo and Pm. xylogenum, also form both pteruloid and corticioid basidiomes, either independently or together (McLaughlin and McLaughlin 1980; Corner 1950).

Whilst the corticioid basidiomes of Merulicium and Pm. echo contain a dimitic hyphal system, typical of Pterulaceae, those of Coronicium spp. and Pterulicium xylogenum form a monomitic hyphal system, like all members of Radulomycetaceae. However, no members of Radulomycetaceae form cystidia, whereas these cells are found in most Pterulaceae (Corner 1950, 1952a, 1952b, 1967, 1970; McLaughlin and McLaughlin 1980; Bernicchia and Gorjón 2010), including Coronicium spp. Thus, Radulomycetaceae is morphologically characterized by the combination of resupinate basidiomes, monomitic hyphal system and lack of cystidia. Moreover, our phylogenetic analyses strongly support the segregation of Radulomycetaceae from Pterulaceae.

Reintroduction of Phaeopterula

Phaeopterula spp. are distinct from other pterulaceous genera due to the distinctive brown colour of the main axis of the basidiome and monopodial/symmetric branching of these structures. This contrasts with other Pterulaceae which are either highly branched (bushy) and of uniform colour (Pterula and Myrmecopterula) or pigmented only at the stipe base, and (mostly) unbranched (Pterulicium). Hennings (1900) originally defined Phaeopterula by its brown spores. Corner (1950) cast doubt on the significance of this trait, but our results show that, despite an apparently misguided justification, Hennings was correct to group Ph. juruensis with Ph. hirsuta.

All Phaeopterula spp. are exclusively found on decaying wood, whereas members of other genera of Pterulaceae inhabit more diverse lignocellulosic substrates. Given the basal position of Phaeopterula in Pterulaceae, and the fact that all members of the sister family Radulomycetaceae are also lignicolous on wood, this habit is parsimoniously the ancestral condition. The reintroduction of Phaeopterula aims to pay tribute to Paul Hennings’ work and his contribution to the taxonomy of Pterulaceae.

Synonymy of Deflexula with Pterulicium

Besides the paraphyly represented by Phaeopterula, the Pterulicium clade shows polyphyly of Pterula and Deflexula. Several species in the two latter genera are intermixed in a strongly supported subclade (Fig. 3). The presence of the type species of both Deflexula and Pterulicium within this clade requires that only one name be kept. Both genera were proposed by Corner (1950), to accommodate the dimitic and coralloid (but non-bushy) species, not fitting the description of Pterula. The name Pterulicium was based on a ‘portmanteau’ combination of Pterula and Corticium to reflect the presence of a corticioid patch at the stipe base (Corner 1950). However, this patch has only been reported in two species, Pterulicium xylogenum (Corner 1950) and Pm. echo (McLaughlin and McLaughlin 1980). Deflexula was named for the downward-oriented (positively geotropic) basidiomes (Corner 1950). Corner (1950) stated that the resupinate patch in Pterulicium xylogenum is monomitic, can exist independently of the coralloid basidiome and is fertile when facing downward; he suggested that there was a close similarity between Deflexula and Pterulicium in the way the resupinate patch develops from the base of the basidiome. He also made a case for the formation of a fertile hymenium when facing downward in the two genera as supporting this similarity. Nonetheless, experimental studies on Pm. echo show that orientation of the hymenium does not affect the ability to produce spores, i.e., the hymenium is ageotropic (McLaughlin et al. 1978) and raised doubts about the validity of the genus Deflexula. This morphological distinction is not supported by phylogenetic analysis (Dentinger et al. 2009, Fig. 3) and its emphasis through taxonomic preservation would perpetuate misunderstanding. Accordingly, we propose to retain Pterulicium for this clade to avoid major misinterpretations of the species morphology.

Introduction of Myrmecopterula gen. nov.

Two species of Pterulaceae are cultivated by fungus-farming ants of the Apterostigma pilosum group in South and Central America (Dentinger et al. 2009; Munkacsi et al. 2004; Villesen et al. 2004; Mueller et al. 2018). Despite intensive investigation, neither has been observed to form basidiomes, but M. velohortorum is characterised by the formation of a veil of mycelium around the fungus garden, whilst M. nudihortorum lacks this veil. We recovered both species in a strongly supported clade, as a sister clade of Pterula, alongside five other subclades containing fertile, apparently free-living species.

All the samples in this clade were collected from neotropical habitats (Fig. 1a-f), mostly as part of our recent fieldwork. During sampling campaigns by ourselves and others, it was observed that many of the ‘free-living’ specimens were associated in some way with living ant colonies or abandoned attine nests. Two Myrmecopterula samples belonging to subclade SAPV1 (CALD170307–02 and CALD170307–03; Fig. 1a) were found forming basidiomes atop two distinct but adjacent (1 m apart) living Apterostigma nests in Amazonian Rainforest. The cultivated mutualists from both nests were also analysed and found to belong to M. velohortorum confirming that the basidiomes were not linked to the cultivated mycelia in these nests. The third member of subclade SAPV1 was also reported forming a nascent basidiome on a living Apterostigma nest in Panama (Munkacsi et al. 2004). M. moniliformis (SAPN1; Fig. 1e) has been reported to be found outside both active and apparently inactive (see Myrmecopterula: Notes on Taxonomy section above) attine nests (S. Sourell, pers. comm.; M.C. Aime, pers.comm.) as was CALD170315–04 (SAPV2; Fig. 1b) and CALD170122–04 (SAPV3; Fig. 1c). Lastly, the mycelium of one sample (JSP 07–03 B 5.1; SAPV3) was isolated from a living Atta capiguara nest by Pereira et al. (2016).

The observations above and the phylogenetic analyses suggests that association with attine ants is a widespread trait amongst members of this clade, hence its naming as Myrmecopterula.

Most recent attention on Pterulaceae has been lavished on the ant-cultivated mutualists M. nudihortorum and M. velohortorum. These were once thought to be sister clades (Munkacsi et al. 2004; Villesen et al. 2004) but are now known to be only distantly related within the Myrmecopterula clade (Dentinger et al. 2009, Fig. 3). This suggests two possibilities for the evolution of the Myrmecopterula-Apterostigma mutualism: (1) that it evolved independently on two occasions, or (2) that it is an ancestral condition of all Myrmecopterula. However, it is at present unclear whether the extant mutualistic association found for M. nudihortorum and M. velohortorum is ancestral, implying that the other taxa escaped the mutualism, or whether the looser association with ant nests widespread amongst members of Myrmecopterula was more recently elevated to a higher level of interdependence for these two species, as suggested by Dentinger et al. (2009). It is also possible that the free-living species within the Myrmecopterula may be specialised parasites specifically targeting their sister species that have formed a mutualism with the ants. An analogous situation is found in the leaf-cutting ants species Acromyrmex echinatior and its sister species Acromyrmex insinuator, the latter a highly specialised social parasite of the former (Sumner et al. 2004).

The basis of the association of ‘free-living’ species with attine ants and/or their abandoned nests is unclear. Given the apparent preference of some for abandoned nests, they may be specialised early stage colonisers of ant nest debris. A further possibility is that they are cheaters, deriving nutrition from the ant-collected biomass but not reciprocating by producing hyphae palatable to ants. This would represent a novel form of fungal mimicry, perhaps achieved by the ants’ inability to differentiate hyphae of closely related species. Lastly, they may be mycoparasitic, including on ant cultivars, although there is currently no direct evidence supporting this hypothesis.

Re-delimitation of Pterulaceae

All the accepted genera in Pterulaceae were sampled in this study except for the monotypic Allantula. One specimen, with morphology consistent with Corner’s description of Allantula diffusa, with pteruloid basidiomes borne on slender mycelial cords as curved intercalary swellings, was collected during our fieldwork (Fig. 1m). Phylogenetic reconstruction placed this specimen firmly within Phaeopterula. However, we have been unable to obtain the type specimen (no other collections authenticated exist) for more detailed analysis.

Thus, we re-delimit Pterulaceae as containing six genera: Allantula, Coronicium, Merulicium, Myrmecopterula, Phaeopterula, Pterula, and Pterulicium.

CONCLUSION

In this study, we presented a reclassification of Pterulaceae based on morphological and phylogenetic analyses with samples from six out of seven genera previously accepted in the family. Three early diverging resupinate genera were placed in the new family Radulomycetaceae (Aphanobasidium, Radulomyces and Radulotubus); the new genus Myrmecopterula was introduced to accommodate ant associated species previously classified in Pterula; several species from the latter were also recombined in the reintroduced Phaeopterula and in Pterulicium, and finally Deflexula was synonymised with Pterulicium. Pterulaceae was thus re-delimited to accommodate seven genera Allantula, Coronicium, Merulicium, Myrmecopterula, Phaeopterula, Pterula and Pterulicium. Some species kept in Pterula might also need to be recombined since the original description was not enough to make these changes. Type specimens should be analysed considering the delimitations proposed in this study.

Additional file 1. Full details of all samples studied here (simplified in Table 2; as excel file)

Additional file 2. Additional phylogenetic reconstructions, including detailed analyses relating to Fig. 3

Additional file 3 Additional images of coralloid Pterulaceae and micrographs of Myrmecopterula velohortorum.

1	Cultivated by ants of the Apterostigma pilosum group	Myrmecopterula*
	Not cultivated by ants	2
2 (1)	Basidiomes resupinate to effused	3
	Basidiomes coralloid, thread like or allantoid**	10
3 (2)	Hymenophore surface poroid	Radulotubus
	Hymenophore surface smooth, tuberculate, odontioid to raduloid or merulioid	4
4 (3)	Cystidia present	5
	Cystidia absent	8
5 (4)	Hyphal system monomitic	6
	Hyphal system dimitic	7
6 (5)	Spores ellipsoid to navicular, thin-walled, cystidia with incrustation	Coronicium
	Spores amygdaliform, slightly thick-walled, cystidia smooth	Pterulicium xylogenum***
7 (5)	Hymenophore surface merulioid, presence of cystidia with resinous excretion	Merulicium
	Hymenophore surface smooth, cystidia smooth	Pterulicium echo***
8 (4)	Basidia formed laterally from generative hyphae (pleural)	Aphanobasidium
	Basidia formed at the end of generative hyphae (terminal)	9
9 (8)	Spores ellipsoid to globose	Radulomyces
	Spores amygdaliform	Pterulicium xylogenum***
10 (2)	Basidiome allantoid with swollen fertile regions intercalating with mycelial chords	Allantula
	Basidiome coralloid or thread like	11
11 (10)	Stipe and base of branches very dark brown fading towards the tips	Phaeopterula
	Basidiomes concolourous or only the stipe light brown coloured	12
12 (11)	Basidiomes simple or scarcely branched, growing up- or downwards	Pterulicium
	Basidiomes densely ramified, always ageotropic	13
13 (12)	Cottony subiculum present, associated with attine ants	Myrmecopterula
	Cottony subiculum absent, without association with attine ants	Pterula