Molecular characteristics of fluoroquinolone-resistant avian pathogenic Escherichia coli isolated from broiler chickens.

Avian pathogenic Escherichia coli (APEC) is a major pathogen in the poultry industry worldwide including Korea. In this study, the phenotypic and genotypic characteristics of 33 fluoroquinolone (FQ)-resistant APEC isolates from broilers were analyzed. All FQ-resistant APEC isolates showed amino acid exchanges at both gyrA and parC and high minimal inhibitory concentrations for FQs. A total of 11 (33.3%) isolates were positive for the plasmid-mediated quinolone resistance (PMQR) genes, qnrA (8 isolates) and qnrS (3 isolates), and showed multidrug resistance. Among the 11 PMQR-positive isolates, 1 and 2 isolates carried blaCTX-1 and blaCTX-15, respectively, as extended-spectrum β-lactamase (ESBL) producers, and the non-ESBL gene, blaTEM-1, was found in 4 isolates. Among 3 aminoglycoside-resistant isolates, aac(3)-II was only detected in 1 isolate. All 8 APEC isolates with resistance to tetracycline carried the tetA gene. Overall, 6 of the 7 trimethoprim-sulfamethoxazole-resistant isolates carried the sul1 or sul2 genes, while only 2 of the 8 chloramphenicol-resistant isolates carried the catA1 gene. Although 9 isolates carried class I integrons, only 4 isolates carried the gene cassettes dfrA12-aadA2 (2 isolates), dfrA17-aadA5 (1 isolate), extX-psp-aadA2 (1 isolate), and dfrA27 (1 isolate). The most common plasmid replicon was FIB (8 isolates, 72.7%), followed by K/B (4 isolates, 36.4%). Antimicrobial resistance monitoring and molecular analysis of APEC should be performed continuously to surveil the transmission between poultry farms.

Introduction

Colibacillosis caused by Escherichia coli () in mammals is most often a primary enteric or urinary tract disease, whereas colibacillosis in poultry is typically a localized or systemic disease occurring secondarily when host defenses have been impaired or overwhelmed by virulent E. coli strains (Jahantigh and Dizaji, 2015). Avian pathogenic E. coli (APEC) is a major pathogen in the poultry industry worldwide and often causes severe colibacillosis after respiratory stress from infections with Mycoplasmas or respiratory viral agents (Matthijs et al., 2003). In Korea, many poultry flocks also suffer from infection with APEC (Kim et al., 2007, Kim et al., 2009, Oh et al., 2011). Therefore, the use of antimicrobial drugs such as β-lactams, aminoglycosides, and fluoroquinolones (FQs) has remained the primary option for controlling colibacillosis.

FQs are broad-spectrum antibacterial agents and exert their effects by binding to and inhibiting bacterial DNA gyrase. Since enrofloxacin (ENR) have been introduced to the poultry industry in Korea in 1987, they have been widely used throughout the country for mass medication in farms. Approximately 50 tons of FQs are sold every year for animal production, including poultry in Korea (Kim et al., 2018). However, the continuous use of FQs in poultry production has resulted in the emergence and maintenance of flouoroquinolone (FQ)-resistant APEC (Kim et al., 2009).

The World Health Organization has classified quinolones as “critically important antimicrobials for human medicine” because FQ-resistant microorganisms are a serious global public and animal health problem (WHO, 2017). Several researchers have reported that most cases of FQ resistance in human zoonotic infections may be attributed to farm animal antimicrobial use (Endtz et al., 1991, Chiu et al., 2002). Evidence for resistance transmission from farm animals to humans is particularly strong in the use of the antimicrobials in poultry (Johnson et al., 2006). In Korea, the mass medication of poultry with ENR is still permitted, and the sale volume of ENR is the highest among all antimicrobials used to treat poultry (APQA, 2017). Although previous studies have found that FQ treatment against colibacillosis in chicken could result in FQ-resistant APEC, a comprehensive evaluation of the virulence and resistance of isolates has not been fully performed in Korea. Therefore, this study was conducted to determine the phenotypic and genotypic characteristics of FQ-resistant APEC.

Materials and methods

Sampling

Liver swab samples were collected from 60 broiler farms suffering from colibacillosis nationwide in 2018. The swabs were placed in transport medium (Noble Bio, Hwaseong, Korea) and sent to the laboratory in a cooler. All specimens were inoculated into 10 mL of modified E. coli broth with Novobiocin (Merck, Darmstadt, Germany) within 24 h of collection.

Bacterial Isolates

The enriched modified E. coli was streaked onto MacConkey agar (BD Biosciences, Sparks, MD) containing 4 μg/mL of ciprofloxacin (CIP; Sigma-Aldrich, St. Louis, MO). Subsequently, suspected E. coli colonies were identified by PCR as previously described (Candrian et al., 1991). Confirmed E. coli were also analyzed for 5 genes (iroN, ompT, hlyF, iss, and iutA) as the minimal predictors of APEC virulence described by Johnson et al. (2008). If isolates from the same farm showed the same antimicrobial susceptibility patterns, one isolate was randomly selected. A total of 33 FQ-resistant APEC isolates were included in this study.

Antimicrobial Susceptibility Test

The disk diffusion method was performed according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (CLSI, 2017). The 16 antimicrobial disks (BD Biosciences) used in this study were amoxicillin-clavulanate (20/10 μg), ampicillin (10 μg), cefazolin (30 μg), cefepime (30 μg), cefotaxime (30 μg), cefoxitin (30 μg), ceftazidime (30 μg), cefuroxime (30 μg), cephalexin (30 μg), cephalothin (30 μg), chloramphenicol (C, 30 μg), CIP (5 μg), gentamicin (10 μg), imipenem (10 μg), tetracycline (TE, 30 μg), and trimethoprim-sulfamethoxazole (1.25/23.75 μg). Multidrug resistance (MDR) was defined as acquired resistance to at least one agent in 3 or more antimicrobial classes (Magiorakos et al., 2012). The minimum inhibitory concentration (MIC) for CIP, ENR, and norfloxacin (NOR) was determined by standard agar dilution methods using the Mueller-Hinton agar (BD Biosciences) method according to the guidelines of the CLSI (CLSI, 2017). The breakpoints of CIP and NOR were determined according to the guidelines of the CLSI (CLSI, 2017), and the breakpoint of ENR was determined according to the guidelines of the CLSI (2002). E. coli ATCC 25922 was used as a quality control strain.

Serogrouping

O-serogroups were determined by multiplex PCR using 162 primer pairs including O1 to O187 as described by Iguchi et al. (2015).

Analysis of Quinolone Resistance-Determining Regions

PCR was performed to amplify the gyrA and parC of the quinolone resistance-determining region to identify mutations in 33 FQ-resistant APEC isolates using primers and conditions described previously (Pons et al., 2014). The PCR products were purified using GFX PCR DNA and the Gel Band Purification Kit (Amersham Biosciences, Freiburg, Germany) and sequenced using an automatic sequencer (Cosmogenetech, Seoul, Korea). The sequences were compared with those in the GenBank nucleotide database using the Basic Local Alignment Search Tool program available through the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST).

Molecular Analysis

The detection of integrons, antimicrobial resistance genes, and gene cassettes was performed by PCR using the primers described in Table 1. All FQ-resistant APEC isolates were tested for resistance genes related to β-lactam antimicrobials (blaTEM, blaSHV, blaOXA, and blaCTX-M families), quinolones (qnrA, qnrB, qnrD, qnrS, and qepA), TE (tetA, tetB, and tetC), C (cmlA and catA1), sulfonamides (sul1 and sul2), and aminoglycosides (aac (3)-II, ant (2″)-I, and aac (6′)-Ib). Class 1 and 2 integrons (intl1 and intl2) were also investigated.

Table 1

Primer sequences used for the amplification.

Primer	Sequence (5′ → 3′)	Size (bp)	Reference
E. coli identification
E. coli	F: GACCTCGGTTTAGTTCACAGA	585	Candrian et al. 1991
	R: CACACGCTGACGCTGACCA
Quinolone resistance determining region (QRDR)
gyrA	F: AAATCTGCCCGTGTCGTTGGT	343	Pons et al. 2014
	R: GCCATACCTACGGCGATACC
parC	F: AAACCTGTTCAGCGCCGCATT	395	Pons et al. 2014
	R: GTGGTGCCGTTAAGCAAA
Plasmid-mediated quinolone
qnrA	F: TCAGCAAGAGGATTTCTCA	627	Wang et al. 2003
	R: GGCAGCACTATTACTCCCA
qnrB	F: CGACCTGAGCGGCACTGAAT	515	Jiang et al. 2008
	R: TGAGCAACGATGCCTGGTAG
qnrD	F: CGAGATCAATTTACGGGGAATA	582	Cavaco et al. 2009
	R: AACAAGCTGAAGCGCCTG
qnrS	F: ACCTTCACCGCTTGCACATT	571	Jiang et al. 2008
	R: CCAGTGCTTCGAGAATCAGT
qepA	F: CGTGTTGCTGGAGTTCTTC	403	Minarini et al. 2008
	R: CTGCAGGTACTGCGTCATG
β-lactamases
TEM	F: CATTTCCGTGTCGCCCTTATTC	800	Dallenne et al. 2010
	R: CGTTCATCCATAGTTGCCTGAC
SHV	F: CACTCAAGGATGTATTGTG	885	Briñas et al. 2002
	R: TTAGCGTTGCCAGTGCTCG
OXA	F: TTCAAGCCAAAGGCACGATAG	702	Briñas et al. 2002
	R: TCCGAGTTGACTGCCGGGTTG
CTX-M group I	F: GACGATGTCACTGGCTGAGC	499	Pitout et al. 2004
	R: AGCCGCCGACGCTAATACA
CTX-M group II	F: GCGACCTGGTTAACTACAATCC	351	Pitout et al. 2004
	R: CGGTAGTATTGCCCTTAAGCC
CTX-M group III	F: CGCTTTGCCATGTGCAGCACC	307	Pitout et al. 2004
	R: GCTCAGTACGATCGAGCC
CTX-M group IV	F: GCTGGAGAAAAGCAGCGGAG	474	Pitout et al. 2004
	R: GTAAGCTGACGCAACGTCTG
Aminoglycoside-modifying enzymes (AMEs)
aac(6′)-Ib	F: TGACCTTGCGATGCTCTATG	509	Jiang et al. 2008
	R: TTAGGCATCACTGCGTGTTC
aac(3)-II	F: TGAAACGCTGACGGAGCCTC	369	Sandvang and Aarestrup. 2000
	R: GTCGAACAGGTAGCACTGAG
ant(2″)-I	F: GGGCGCGTCATGGAGGAGTT	740	Sandvang and Aarestrup. 2000
	R: TATCGCGACCTGAAAGCGGC
Tetracyclines
tetA	F: GTAATTCTGAGCACTGTCGC	956	Sengeløv et al. 2003
	R: CTGCCTGGACAACATTGCTT
tetB	F: CTCAGTATTCCAAGCCTTTG	414	Sengeløv et al. 2003
	R: ACTCCCCTGAGCTTGAGGGG
tetC	F: CCTCTTGCGGGATATCGTCC	505	Sengeløv et al. 2003
	R: GGTTGAAGGCTCTCAAGGGC
Sulfonamide
sul1	F: CTTCGATGAGAGCCGGCGGC	433	Sandvang et al. 1998
	R: GCAAGGCGGAAACCCGCGCC
sul2	F: CGGCATCGTCAACATAACC	722	Maynard et al. 2003
	R: GTGTGCGGATGAAGTCAG
Chloramphenicol
catA1	F: AGTTGCTCAATGTACCTATAACC	547	Van et al. 2008
	R: TTGTAATTCATTAAGCATTCTGCC
cmlA	F: CCGCCACGGTGTTGTTGTTATC	698	Van et al. 2008
	R: CACCTTGCCTGCCCATCATTAG
Integrons and cassettes
Class 1 integron	F: GCCTTGCTGTTCTTCTACGG	558	Ng et al. 1999
	R: GATGCCTGCTTGTTCTACGG
Class 1 cassettes	F: GGCATCCAAGCAGCAAG	variable	Ng et al. 1999
	R: AAGCAGACTTGACCTGA
Class 2 integron	F: CACGGATATGCGACAAAAAGGT	788	Sáenz et al. 2004
	R: GTAGCAAACGAGTGACGAAATG
Class 2 cassettes	F: CGGGATCCCGGACGGCATGCACGATTTGTA	variable	Sáenz et al. 2004
	R: GATGCCATCGCAAGTACGAG

Abbreviations: CTX, cefotaxime; OXA, oxacillinase.

The presence of gene cassettes in integron-positive isolates was determined. The purification and sequencing of PCR products were performed as described previously. Gene cassette homology was performed by Basic Local Alignment Search Tool analysis (www.ncbi.nlm.nih.gov/BLAST).

Plasmid Replicon Typing

All FQ-resistant APEC isolates were screened for 18 plasmid replicons using a PCR-based typing method with 3 multiplex panels as previously described (Johnson et al., 2007).

Transconjugation

The transfer of plasmid-mediated quinolone resistance (PMQR) genes was performed by conjugation experiments using the broth mating method with sodium azide–resistant E. coli J53 as a recipient (Tamang et al., 2012). Transconjugants were selected on MacConkey agar (BD Biosciences) plates with sodium azide (100 μg/mL; Sigma-Aldrich, ST Louis, MO) and ampicillin or TE (100 μg/mL; Sigma-Aldrich). Transferability was confirmed by antimicrobial susceptibility tests and PCR for molecular analysis as described previously.

Results

Antimicrobial Resistance

The antimicrobial resistance analysis is shown in Figure 1. All FQ-resistant APEC isolates showed the highest resistance to penicillins (90.9%), followed by TEs (78.8%), phenicols (66.7%), folate pathway inhibitors (57.6%), cephems (45.5%), aminoglycosides (12.1%), and β-lactam/β-lactamase inhibitor combinations (6.1%). A total of 30 (90.9%) APEC isolates were identified as having MDR. The rate of resistance to 3 antimicrobial classes was the highest at 30.3%, and one (3.0%) FQ-resistant APEC isolate showed resistance to 6 classes.

Figure 1

Antimicrobial resistance spectrum (A) and classes (B) in 33 fluoroquinolone-resistance avian pathogenic E. coli isolates. AMGs, aminoglycosides; BL/BLICs, β-lactam/β-lactamase inhibitor combinations; CARs, carbapenems; CEPs, cephems; FPIs, folate pathway inhibitors; PCNs, penicillins; PHs, phenicols; TETs, tetracyclines.

Characteristics of FQ-Resistant APEC

The molecular characteristics of 33 FQ-resistant APEC isolates are shown in Table 2. Among the isolates, 30 isolates were classified into 18 O-serogroups, and 3 isolates were ungrouped. The most common serogroup was O78 (5 isolates, 15.2%). All FQ-resistant APEC isolates showed amino acid exchanges at both gyrA and parC, and the MIC ranges for CIP, ENR, and NOR were 4 to 128 μg/mL, 8 to 128 μg/ml, and 8 to >512 μg/mL, respectively. A total of 11 (33.3%) isolates were positive for the PMQR genes qnrA (8 isolates) and qnrS (3 isolates). However, only one of 7 isolates, which showed the highest MICs for CIP (≥64 μg/mL), ENR (128 μg/mL), and NOR (≥256 μg/mL), carried the PMQR gene qnrA.

Table 2

Amino acid changes within QRDRs and prevalence of PMQR genes in 33 fluoroquinolone-resistant avian pathogenic E. coli isolates.

O Serotype	PMQR genes	Amino acid change		MIC (μg/mL)			No. of isolates included
		gyrA	parC	CIP	ENR	Nor
O2	-1	S83 L/D87Y	S80 R	4	8	8	3
O3	-	S83 L/D87 N	S80I	8	16	16	1
O3	-	S83 L/D87 N	S80 R	4	16	16	1
O3	-	S83 L/D87 N	S80I	8	32	16	1
O9	qnrA	S83 L/D87 N	S80I	8	32	16	1
O9	qnrA	S83 L/D87 N	S80I	16	32	32	1
O45	-	S83 L/D87Y	S80I	16	128	64	1
O45	-	S83 L/D87 N	S80I/E84 G	64	128	>512	1
O78	qnrA	S83 L/D87 N	S80I	8	32	16	1
O78	-	S83 L/D87 N	S80I	16	32	64	1
O78	-	S83 L/D87 N	S80I	8	32	16	1
O78	-	S83 L/D87 N	S80I/E84 A	64	128	>512	1
O78	-	S83 L/D87 N	S80I/E84 G	64	128	>512	1
O86	-	S83 L/D87 N	S80I	128	128	256	1
O86	-	S83 L/D87 N	S80I	64	128	>512	1
O88	qnrA	S83 L/D87 N	S80I	8	32	16	1
O99	-	S83 L/D87 N	S80I	8	16	16	1
O104	-	S83 L/D87Y	S80 R	8	32	16	1
O111	-	S83 L/D87 N	S80I	8	32	16	1
O115	qnrA	S83I/D87 E	S80I	8	32	16	1
O128	-	S83 L/D87Y	S80I	16	64	64	1
O128	qnrS	S83 L/D87 N	S80I	16	32	128	1
O133	-	S83 L/D87 N	S80 R	8	16	16	1
O141	qnrS	S83 L/D87 N	S80I	16	32	16	1
O148	-	S83 L/D87 N	S80I	32	64	64	1
O166	-	S83 L/D87Y	S80I	8	32	16	1
Ogp82	qnrA	S83 L/D87 N	S80I	8	32	16	1
Ogp8	qnrS	S83 L	S80I	16	32	16	1
ONT3	qnrA	S83 L/D87 N	S80I	64	128	256	1
ONT	qnrA	S83 L/D87 N	S80I	16	32	64	1
ONT	-	S83 L/D87 N	S80I	128	128	>512	1

Abbreviations: CIP, ciprofloxacin; ENR, enrofloxacin; MIC, minimum inhibitory concentration; NOR, norfloxacin; PMQR, plasmid-mediated quinolone resistance; QRDR, quinolone resistance-determining regions.

Not detected.

O107 or O117.

Untyped.

Characterization of PMQR-Positive FQ-Resistant APEC

The phenotypic and genotypic characteristics of 11 PMQR-positive FQ-resistant APEC isolates are shown in Table 3. All PMQR-positive isolates showed MDR with resistance to 3-11 antimicrobials. Five isolates were identified as β-lactamase–producing APEC. As extended-spectrum β-lactamase producers, one and 2 isolates carried blaCTX-1 and blaCTX-15, respectively. The non–extended-spectrum β-lactamase gene, blaTEM-1, was found in 4 isolates. Of the 5 β-lactamase–producing APEC isolates, 2 isolates had both the TEM and CTX-M genes. The other β-lactamase–encoding genes, SHV, OXA, and CTX-M group Ⅱ, Ⅲ, and Ⅳ, were not detected in any of the PMQR-positive isolates. Among 3 aminoglycoside-resistant isolates, aac(3)-Ⅱ was only detected in one isolate. All 8 APEC isolates with resistance to TE carried the tetA gene, and the tetB and tetC genes were not present. Overall, 6 of the 7 trimethoprim-sulfamethoxazole–resistant isolates carried the sul1 or sul2 genes, and only 2 of the 8 C-resistant isolates carried the catA1 gene.

Table 3

Phenotypes and genotypes of 11 PMQR-positive avian pathogenic E. coli isolates.

Strain no.	PMQR genes	Resistance phenotypes	Resistance genes	Integron and gene cassettes	Plasmid replicon type	O Serotype
CC-23-10	qnrA	AM, AMC, CF, CL, CTX, CXM, CZ, CIP, SXT, TE	blaTEM-1, blaCTX-1tetA, sul2	Ⅰ	FIB, HI1, I1, K/B	O88
CC-32-20	qnrA	AM, AMC, CAZ, CF, CL, CZ, FOX, CIP, TE	tetA	-1	B/O, FIB, K/B, N	O78
CC-32-48	qnrA	AM, CIP, SXT, TE	tetA, sul2	Ⅰ (-)	FIB, Y	ONT2
CC-35-27	qnrA	AM, CF, CIP, TE	blaTEM-1, tetA	Ⅰ (dfrA17-aadA5)	FIB	O9
CC-35-46	qnrA	C, CIP, SXT, TE	tetA, sul2	Ⅰ (estX-psp-aadA2)	B/O, FIB, K/B, N	Ogp83
CC-35-47	qnrA	AM, C, CF, CL, CTX, CXM, CZ, FEP, CIP, SXT, TE	blaTEM-1, blaCTX-15, tetA, sul1	-	FIB	O9
CC-37-25	qnrA	AM, C, CIP	catA1	Ⅱ (-)	FIB	O115
PS-35-14	qnrA	AM, C, CF, CL, CTX, CXM, CZ, GM, CIP, SXT, TE	blaCTX-15, tetA	Ⅰ (-)	FIB, I1	ONT
CC-9-91	qnrS	AM, CF, CL, CZ, CIP, TE	blaTEM-1, tetA	Ⅰ (dfrA12-aadA2)	FIA, FIC, Frep, N	O128
CC-34-53	qnrS	AM, C, GM, CIP, SXT	aac(3)-Il, sul1, catA1	Ⅰ (dfrA12-aadA2)	FIA, FIC, X	O141
CC-35-51	qnrS	AM, C, GM, CIP A, SXT	sul1	Ⅰ (dfrA27)	K/B, HI2, W, Y	Ogp8

Underline indicate that was found in the transconjugant strains.

Abbreviations: AM, ampicillin; AMC, amoxicillin-clavulanate; C, chloramphenicol; CAZ, ceftazidime; CF, cephalothin; CIP, ciprofloxacin; CL, cephalexin; CTX, cefotaxime; CXM, cefuroxime; CZ, cefazolin; FEP, cefepime; FOX, cefoxitin; GM, gentamicin; SXT, trimethoprim/sulfamethoxazole; TE, tetracycline.

Not detected.

Untyped.

O107 or O117.

Among 9 isolates with integrons, 8 isolates harbored class 1 integrons, and only 1 isolate harbored class 2 integrons. Class 1 integrons contained 4 types of gene cassettes, dfrA12-aadA2 (2 isolates), dfrA17-aadA5 (1 isolate), extX-psp-aadA2 (1 isolate), and dfrA27 (1 isolate). Five isolates did not carry any of the gene cassettes. A total of 13 plasmid replicon types were identified in all 11 PMQR-positive FQ-resistant APEC isolates. The most common plasmid replicon was FIB (8 isolates, 72.7%), followed by K/B (4 isolates, 36.4%). Transferability was only identified in 8 isolates among 11 PMQR-positive FQ-resistant APEC isolates.

Discussion

APEC is associated with extraintestinal infections in poultry and is considered one of the main causes of mortality and morbidity, resulting in heavy economic losses in the industry worldwide including Korea (Kim et al., 2007, Oh et al., 2011, Varga et al., 2018). Antimicrobials play a key role in treating and preventing infectious diseases in livestock including poultry (Yang et al., 2004, Li et al., 2015). In particular, FQs are broad-spectrum synthetic drugs used extensively for the control of bacterial infections in Korea (APQA, 2017). Resistance to FQs has emerged after their widespread use; thus, the probability of treatment failure may be increased (Li et al., 2015). Moreover, the prevalence and dissemination of resistance of FQs in APEC have increased significantly in recent years because FQ-resistant E. coli often exhibits a multidrug-resistant phenotype (Kim et al., 2007, Seo and Lee, 2018, Seo and Lee, 2019). In this study, 33 FQ-resistant APEC isolates showed coresistance to penicillins (90.9%), TEs (78.8%), phenicols (66.7%), and folate pathway inhibitors (57.6%), and 30 (90.1%) isolates expressed a typical MDR phenotype with antimicrobial resistance to 3-7 antimicrobial classes including FQs. These results are consistent with those of recent studies showing high MDR rates among FQ-resistant E. coli (Li et al., 2015, Seo and Lee, 2019).

Bacterial resistance to FQs is caused by mutations in the quinolone resistance-determining regions. In gram-negative bacteria including E. coli, gyrA is the primary target and commonly exhibits substitutions at amino acid residues 83 and 87. Substitutions at amino acid residues 80 and 84 in the parC subunit of topoisomerase IV are less common. In this study, all FQ-resistant APEC isolates had mutations in both the gyrA and parC genes. In particular, 32 (97.0%) isolates had double point mutations in gyrA, and the most common mutation was S83 L/D87 N (24 isolates). Also, previous studies report that S83 L and D87 N in gyrA and S80I in parC were the most common type of amino acid substitution in E. coli (Yang et al., 2004, Uchida et al., 2010, Liu et al., 2012). However, regardless of the various double amino acid substitutions in gyrA, there was no significant difference in the MICs. Only 3 isolates had double point mutations in the parC gene, which included S80I/E84 G (2 isolates) and S80I/E84 A (1 isolate). But these 3 isolates possessed both double mutation at gyrA and parC and showed the highest MICs for CIP (64 ug/mL), ENR (128 ug/mL), and NOR (>512 ug/mL).

In this study, 11 FQ-resistant APEC isolates carried 2 types of PMQR genes, qnrS (3 isolates) and qnrA (8 isolates). This result is consistent with recent studies of APEC isolates from Egypt, Taiwan, and South Korea (Ahmed et al., 2013, Yeh et al., 2017, Seo and Lee, 2019). The PMQR genes may contribute to the increased prevalence of resistant mutants by conferring a low resistance level in a population (Varela et al., 2015). In this study, although 7 isolates showed the highest MICs for CIP (≥64 μg/mL), ENR (128 μg/mL), and NOR (≥256 μg/mL), only one isolate carried the PMQR gene, qnrA. However, 11 PMQR-positive APEC isolates carried a variety of antimicrobial resistance genes such as blaCTX-1, blaCTX-15, blaTEM-1, aac(3)-II, tetA sul1, sul2, and catA1 and harbored mobile elements such as integrons and gene cassettes at the same time. The rise of antimicrobial resistance is thought to be closely associated with the widespread transfer of resistance genes between bacterial species. CTX-M-type β-lactamase genes hydrolyze the characteristic β-lactam ring and confer resistance to most β-lactam antimicrobials, including cephalosporins (Paterson and Bonomo., 2005). The blaTEM-1 gene code for narrow-spectrum β-lactamases that can inactivate penicillins and aminopenicillins (Poirel et al., 2018). The prevalence of the PMQR genes in poultry varies in Korea (Oh et al., 2016, Seo and Lee, 2019); however, the PMQR genes in β-lactamase–producing E. coli were detected at high levels (Seo and Lee, 2019). The presence of the PMQR genes may be significantly associated with the β-lactamase gene, perhaps due to common carriage on a plasmid in Enterobacteriaceae (Xue et al., 2017).

In this study, 6 and one of 11 PMQR-positive APEC isolates contained class 1 and 2 integrons, respectively. Five isolates also contained at least one more cassette. Although dfrA-aadA was the dominant gene cassette array in this study and has been identified in E. coli from the poultry industry (Kim et al., 2007, Dessie et al., 2013, Seo and Lee, 2018), this is the first report of this cassette in APEC isolates in Korea.

Plasmids are extrachromosomal genetic elements that act as excellent delivery vectors for the dissemination of antimicrobial resistance through horizontal gene transfer (Yang et al., 2015, Son et al., 2019). In our study, most isolates (90.1%) among the PMQR-positive APEC isolates harbored IncF plasmids including FIA, FIB, and FIC. Wu et al. (2010) and Yang et al. (2015) have suggested that IncF plasmids may be associated with a wide range of genes conferring resistance to important classes of antimicrobials including quinolones, β-lactams, TEs, sulfonamides, chloramphenicol, and aminoglycosides.

This study investigated the molecular characteristics of FQ-resistant APEC from broiler chickens. Almost all FQ-resistant APEC showed MDR phenotype, and the most prevalent of the mutations were double point mutations in gyrA and single mutation in parC. FQ-resistant APEC with PMQR genes carried various antimicrobial genes and harbored mobile elements and plasmid replicons. The overuse of various antimicrobials in poultry production may have served as a major selection pressure for the horizontal transfer of resistance elements. Therefore, antimicrobial resistance monitoring and molecular analysis of APEC should be performed continuously to surveil the transmission between poultry farms.