New Andean source of resistance to anthracnose and angular leaf spot: Fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar.

Anthracnose (ANT) and angular leaf spot (ALS) caused by Colletotrichum lindemuthianum and Pseudocercospora griseola, respectively, are devastating diseases of common bean around the world. Therefore, breeders are constantly searching for new genes with broad-spectrum resistance against ANT and ALS. This study aimed to characterize the genetic resistance of California Dark Red Kidney (CDRK) to C. lindemuthianum races 73, 2047, and 3481 and P. griseola race 63-39 through inheritance, allelism testing, and molecular analyses. Genetic analysis of response to ANT and ALS in recombinant inbred lines (RILs) from a CDRK × Yolano cross (CY) showed that the resistance of CDRK cultivar is conferred by a single dominant loci, which we named CoPv01CDRK/PhgPv01CDRK. Allelism tests performed with race 3481showed that the resistance gene in CDRK is independent of the Co-1 and Co-AC. We conducted co-segregation analysis in genotypes of 110 CY RILs and phenotypes of the RILs in response to different races of the ANT and ALS pathogens. The results revealed that CoPv01CDRK and PhgPv01CDRK are coinherited, conferring resistance to all races. Genetic mapping of the CY population placed the CoPv01CDRK/PhgPv01CDRK loci in a 245 Kb genomic region at the end of Pv01. By genotyping 19 RILs from the CY population using three additional markers, we fine-mapped the CoPv01CDRK/PhgPv01CDRK loci to a smaller genomic region of 33 Kb. This 33 Kb region harbors five predicted genes based on the common bean reference genome. These results can be applied in breeding programs to develop bean cultivars with ANT and ALS resistance using marker-assisted selection.

Introduction

Phaseolus vulgaris L. (common bean) is the most commonly consumed Phaseolus species worldwide [1, 2, 3], and it is an important primary source of protein in several countries. In particular, common beans are consumed in large quantities in many areas of Africa and Latin America and are part of traditional diets in the Middle East and Europe [4, 5]. However, this legume is susceptible to several diseases threatening its production worldwide [6]. For instance, anthracnose (ANT), caused by Colletotrichum lindemuthianum (Sacc. and Magnus) Briosi and Cavara, and angular leaf spot (ALS), caused by Pseudocercospora griseola (Sacc.) Crous and Braun, are the most widespread, recurrent, and devastating diseases of the common bean in Latin America and Africa [7, 8, 9, 10, 11]. Under favorable climatic conditions for the pathogen and with the use of susceptible cultivars or infected seeds, ANT and ALS can cause field losses of up to 100% and 80%, respectively [7, 12, 13, 14]. Importantly, ANT is not limited to the tropics and is one of the major diseases of beans throughout temperate regions as well [15, 16].

The most desirable strategy to control ANT and ALS is the use of resistant cultivars, which can reduce yield losses without the negative environmental impact of fungicide application [17, 18, 19]. However, the implementation of resistance is challenged by the recurrent emergence of virulence phenotypes in the pathogen population, usually referred to races of C. lindemuthianum and P. griseola. New virulence races of these pathogens have resulted in reduced or complete loss of yield in previously resistant commercial cultivars [17, 20, 21, 22]. Thus, new sources of durable resistance are highly desirable for effective breeding efforts. Gene pyramiding for durable resistance to diseases caused by highly variable pathogens is greatly facilitated by marker-assisted selection, and the development of highly accurate molecular markers that are tightly linked to important disease-resistance genes enables the pyramiding of these genes into single cultivars with broad-spectrum resistance.

Resistance to ANT is conferred by independently segregating individual loci in a series named Co. Currently, the known Co genes are Co-1 and its alleles, Co-14, Co-Pa, Co-x, and Co-won chromosome Pv01 [22, 23, 25, 27, 28, 29, 30, 31]; Co-u and CoPv02 on chromosome Pv02 [18, 22]; Co-13 and Co-17 on chromosome Pv03 [32]; Co-3, Co-3, Co-3, Co-3/Phg-3, Co-y, Co-z, and Co-RVI on chromosome Pv04 [24, 26]; Co-5, Co-6, and Co-v on chromosome Pv07; and Co-2 on chromosome Pv11 [32].

Although resistance to the ALS pathogen is largely conferred by single dominant resistance loci identified by classical genetic approaches, quantitative trait loci (QTLs) have recently been found as well [33, 34, 35, 36]. To date, five resistance loci (the Phg series) have been mapped to the integrated bean linkage map; the three independent loci Phg-1, Phg-2, and Phg-3 are located on chromosomes Pv01, Pv08, and Pv04, respectively [25, 26, 37], while the two major QTLs Phg-4 and Phg-5 are located on Pv04 and Pv10 [33, 34, 36, 38, 39, 40].

Importantly, these Co and Phg loci may be part of disease-resistance clusters on various chromosomes [23, 24, 25, 28, 32, 41]. For instance, linkage group Pv01 contains a gene cluster having ANT (Co-1, Co-AC, Co-14, Co-x, and Co-w), rust (Ur-9), and ALS (Phg-1) resistance genes [18, 25, 26, 28, 32, 29]. The major resistance genes for bean rust, ANT, common bacterial blight, and white mold were mapped in clusters on chromosomes Pv01, Pv04, Pv07, and Pv11 [42, 43]. In addition, a set of resistance gene analogs (RGAs) that are linked to resistance loci for different common bean pathogens were identified [44]. These observations highlight the opportunity for the simultaneous selection of resistance to multiple diseases, especially diseases that occur in similar geographic regions, such as ANT and ALS. The Andean common bean cultivar California Dark Red Kidney (CDRK) is resistant to Mesoamerican races of ANT reported in Brazil, Argentina, and Colombia; all of the Central American races; and races present in Africa and Europe [45, 46, 47, 48, 49, 50, 51].

The availability of reference genomes for the Andean G19833 [41] and Mesoamerican BAT93 [52] has enabled the fine-mapping of many resistance loci, including Co-AC, Co-1, Co-x, and Co-1 on Pv01 [28, 29, 31, 53] and Co-4 on Pv08 [54]. In this study, we verified the resistance inheritance in CDRK. We also found that CDRK is an excellent source to test the hypothesis that ANT and ALS resistance are colocalized in the bean genome and to fine-map the resistance loci using the recombinant inbred line (RIL) mapping population California Dark Red Kidney × Yolano (CY), molecular markers and reference genome.

Material and methods

Plant material and growth conditions

To determine the genetic basis of disease resistance in the genotype CDRK, we used 110 RILs derived from the CY population described by [55]. Seeds were sown in plastic trays (50 × 30 × 9 cm) containing a mixture of the commercial substrate MecPlant (Register EP PB 09549-4/Mapa Brazil, MEC PREC—Ind. Com Ltda, Telemaco Borba, PR), which had been previously fertilized and sterilized. Seedlings were grown under natural light in greenhouses supplemented with 400 W high-pressure sodium lamps, providing a total light intensity of 115 μmoles m-2 s-1 for 15 days until the seedlings reached the first fully expanded trifoliate leaf stage V3 [56]. Plants were inoculated at this stage.

Additionally, cultivars including Michigan Dark Red Kidney (MDRK), Kaboon, Perry Marrow, AND 277, Widusa, Jalo Vermelho, Jalo Listras Pretas, Pitanga, Corinthiano, Paloma, Amendoim Cavalo, Jalo Pintado 2 and Jalo EEP 558 were evaluated for ANT resistance as well as ALS resistance to race 63–39. The experiments comply with the current laws of the country in which they were performed.

Pathogenesis assays

To determine the spectrum of resistance in the above bean genotypes, seedlings were inoculated with the Mesoamerican races 9, 64, 65, 73, 89, 445, 453, 1545, 2047, and 3481, as well as the Andean races 2, 7, 19, 23, 39, and 55 of C. lindemuthianum. Furthermore, seedlings of the CY RIL population were inoculated with races 73, 2047, and 3481 of C. lindemuthianum and race 63–39 of P. griseola to determine segregation patterns of the disease reaction in the CY RIL population.

Monosporic cultures of C. lindemuthianum and of P. griseola were prepared according to the methodologies proposed by Mathur et al. [57] and Sanglard et al. [58]. Inoculum of the ANT races were produced on green common bean pod medium [60] incubated at 22°C for 14 days. The inoculum of race 63–39 of ALS was multiplied in Petri dishes containing 2 mL tomato medium [58] and maintained in a BOD incubator at 24°C for 18 days.

Soon after the expansion of the first trifoliolate leaf, the leaflet of 10 seedlings of each line were inoculated with each race of C. lindemuthianum and the leaflet of 10 seedlings with P. griseola. Each pathogen was inoculated separately. A spore suspension containing 2.0 × 106 spores mL-1 of races 73, 2047 and 3481 of C. lindemuthianum were inoculated using a DeVilbiss number 15 atomizer powered by an electric air compressor (Schulz, SA, Joinville, Santa Catarina, Brazil). A similar procedure was employed for the inoculation with race 63–39 of P. griseola using a spore suspension of 1.2 × 104 conidia mL-1. Ten plants for resistant and susceptible control for each race were inoculated [59, 60].

After inoculation, the plants were maintained at >95% relative humidity, 20 ± 2°C, and 12 h of daily light (680 lux) in a mist chamber for three days. The plants were then transferred to open benches under the same conditions, except for the high humidity, for 7 days (ANT) and 17 days (ALS). ANT and ALS symptoms were evaluated using the disease severity scales (1 to 9) proposed by Pastor-Corrales et al. [61] and Inglis et al. [62]. Plants with disease reaction scores from 1 and 3 were considered resistant, whereas plants with scores from 4 to 9 were considered susceptible [61].

Inheritance of resistance

Studies of the inheritance of resistance in the CDRK genotype were conducted using 110 RILs derived from the CY population described by [55]. The parental line CDRK is resistant to races 73, 2047, and 3481 of C. lindemuthianum and race 63–39 of P. griseola, while the parental line Yolano is susceptible to all races.

Allelism tests

To determine the independence of the ANT resistance allele present in California Dark Red Kidney from Co-1 and Co-AC previously characterized ANT resistance alleles, CDRK was crossed with Andean bean cultivars in the following list: MDRK (Co-1) and Amendoim Cavalo (Co-AC). In all cases, CDRK was used as the female parent. The F1 seeds were sown in polyethylene vases (48 × 30 × 11 cm) containing a mixture of the commercial substrate Plantmax®, which had been previously fertilized and sterilized. The plant vases were kept in a greenhouse until the F2 seeds were produced. The F2 individuals, obtained by selfing individual F1 plants, were used to characterize the plants for resistance to race 3481 of C. lindemuthianum. Seedlings were grown until pod maturation under natural light in greenhouses. The seedlings were maintained in a greenhouse until the first trifoliolate leaves [56] were fully expanded. Race 3481 of C. lindemuthianum was chosen to conduct allelism tests because all parental cultivars inoculated with these races yielded the R × R reaction type.

Statistical analysis

A goodness-of-fit test for the 1:1 segregation ratio was performed for races 73, 2047, 3481, and 63–39 in the CY RIL population. For allelism tests, segregation analysis of two F2 populations from the crosses of CDRK with Andean cultivars (MDRK and Amendoim Cavalo) was also performed using the χ2 test according to the Mendelian segregation null hypothesis of 15: 1 R/S ratio.

SNP genotyping

Total genomic DNA was isolated from the 110 RIL families (F10 generation) and parents (CDRK and Yolano) using the DNeasy Plant Mini Kit (Qiagen, CA, USA) following the manufacturer’s instructions. The DNA was quantified using 1.5% agarose gel (Agarose SFR, Amresco, IL, USA) with TBE buffer (tris-borate-ethylenediamine tetra acetic acid) and stained with 1 μg mL−1 ethidium bromide. The DNA samples were screened with 5,398 SNP DNA markers on the BARCBean6K_3 Illumina BeadChip [63] by following the Infinium HD Assay Ultra Protocol (Illumina, Inc., San Diego, CA, USA). The BeadChip was imaged using the Illumina BeadArray Reader to measure fluorescence intensity. Automatic allele calling for each locus was performed with the Genome Studio Genotyping Module v1.8.4 software (Illumina, San Diego, CA, USA), and all allele calls were visually inspected. Any errors in allele calling due to improper cluster identification were corrected, resulting in 4,633 high-quality SNPs.

Genome-wide linkage map analysis

SNP markers that were polymorphic between the parents CDRK and Yolano segregated at a 1:1 ratio in the RIL population, as measured by the χ2 test at p = 0.01, were used to create a linkage map using the default settings of the JoinMap 4.1 software [64]. Briefly, the regression-mapping algorithm based on the Kosambi map function was used to define the linkage order and genetic distances in centiMorgans (cM). A minimum likelihood of odds (LOD) ≥3.0 and a maximum distance of ≤50 cM were used to test linkages among markers. A genetic linkage map was created using the software MapChart [65]. SNP markers flanking the genomic locations associated with ANT and ALS disease reactions were used to define the physical region of these loci based on the bean reference genome v.1.0 [41] available in NCBI v.1.0 (http://phytozome.jgi.doe.gov).

Fine-mapping

A fine linkage map was developed with 17 SNPs, two additional SSRs (BARCPVSSR01358, BARCPVSSR01361) and the STS CV542014 markers (http://phaseolusgenes.bioinformatics.ucdavis.edu/markers/1009). The selected SSR and STS markers were amplified from the genomic DNA of the parents CDRK (resistant) and Yolano (susceptible) and 19 of the CY RILs to fine-map a genomic region of 245 Kb between the ss715645251 (50,301,592) and ss715645248 (50,546,985) markers in chromosome Pv01. The primer sequences used to genotype BARCPVSSR01358, BARCPVSSR01361 and STS CV542014 were 'TGGCTGGTTGGTGTTTATGA' (forward) and 'GGTCCCACCCTCTTCTCTTC' (reverse), ´GAATGGTTCATCGTTCATGG´ (forward), and ´TCGGCTGTTTAACGTGGTCT´ (reverse), and `CACTTTCCACTGACGGATTTGAACC`(forward) and `CAGAGGATGCTTCTCACGGT`(reverse), respectively. The PCR mixes contained 30 ng of genomic DNA, 0.25 μM of forward and reverse primers, 1 X PCR Buffer (200 mM Tris-HCl (pH 8.0), 500 mM KCl, 2 mM each dNTP, 10% glycerol, 15 mM MgCl2, and 20 ng/μL of single-strand binding protein (SSB)) and 0.1 unit of Taq DNA polymerase (Invitrogen). The PCR cycle consisted of 3 min at 92°C; followed by 38 cycles of 50 s at 90°C, 45 s at 58°C, and 45 s at 72°C; a 5 min extension at 72°C; and a hold at 10°C. A 2 μL aliquot of loading buffer (30% glycerol and 0.25% bromophenol blue) was added to the DNA products, which were then fractionated on 6% polyacrylamide gels at 3 W A−1 cm−1. The amplified fragments were stained using SYBR Safe (0.02%), and the DNA bands were visualized under ultraviolet light. Digital images were recorded using an L-PIX Image EX (Loccus Biotecnologia-Loccus do Brasil, Cotia, SP, Brazil).

Functional annotation of genes linked to ANT and ALS disease reactions

The P. vulgaris reference genome v.1.0 [41] was used to define the physical position of the markers flanking the CoPv01/PhgPv01 resistance loci. The putative genes within this genomic region were annotated as candidate genes associated with resistance or susceptibility to ANT and ALS. The putative functional annotation of each candidate gene was based on the descriptions available in Phytozome v.1.0 (https://phytozome.jgi.doe.gov#). After fine-mapping, the new physical region was defined based on the genomic location of the markers flanking the new CDRK resistance loci. Genes predicted within the fine-mapped region were highlighted, and their putative homologs in Arabidopsis thaliana were identified using BLASTp in NCBI (National Center for Biotechnology Information; https://www.ncbi.nlm.nih.gov). The A. thaliana protein with the lowest E-value (<0.0) and highest identity (>40%) with each bean protein was considered a putative homolog and used to infer its molecular function.

Results

To identify sources of resistance against the ANT pathogen, a panel of 14 Andean cultivars were screened for their reactions to ten Mesoamerican (9, 64, 65, 73, 89, 445, 453, 1545, 2047, and 3481) and six Andean (2, 7, 19, 23, 39, and 55) races of C. lindemuthianum (Table 1). The genomic locations of the known Co genes in each cultivar, except for Jalo Vermelho, Jalo Pintado 2, and CDRK (Table 1), have been previously reported [25, 28, 29, 30, 31, 32, 53]. We observed that five genotypes known to carry alleles at the Co-1 locus (MDRK, Kaboon, Perry Marrow, AND 277, and Widusa) showed different spectra of ANT resistance (Table 1), supporting the hypothesis that they indeed carry different alleles of Co-1 or additional unidentified Co loci. All cultivars except Pitanga were resistant to race 1545 of C. lindemuthianum. By contrast, Pitanga and six other genotypes were resistant to race 2047. Kaboon (Co-12), AND 277 (Co-1), Jalo Vermelho (Co-12), Pitanga (Co-14), Corithiano (Co-15), and CDRK were the only cultivars that showed resistance and susceptibility to C. lindemuthianum races 2 and 7, respectively (Table 1). As CDRK showed resistance to highly virulent races of C. lindemuthianum (Table 1) and it is a parent of a well-described RIL population named CY [55], we further characterized the Co loci that it might carry. We observed that CDRK exhibited resistance to races 2, 9, 39, 55, 64, 65, 73, 89, 1545, 2047, and 3481 of C. lindemuthianum, as well as race 63–39 of P. griseola, while Yolano was susceptible to all races (Table 1). Thus, the CY RIL population was used for co-segregation analysis.

Table 1

Resistant (R) or Susceptible (S) reactions of 15 Phaseolus vulgaris cultivars to nine Mesoamerican (9, 65, 73, 89, 445, 453, 1545, 2047, and 3481) and six Andean (2, 7, 19, 23, 39, and 55) races of C. lindemuthianum and race 63–39 of P. griseola.

Cultivar	Genes	P. griseola 63–39	Races of Colletotrichum lindemuthianuma
			2	7	9	19	23	39	55	64	65	73	89	449	453	1545	2047	3481
MDRKb	Co-1	dNe	S	S	R	S	S	S	S	R	R	R	R	R	R	R	S	R
Kaboon	Co-12	dNe	R	R	R	R	R	S	S	R	R	R	R	R	R	R	S	R
Perry Marrow	Co-13	dNe	R	S	R	R	S	S	S	R	R	R	R	R	S	R	S	R
AND 277	Co-14	S	R	S	R	S	R	S	R	R	R	R	R	R	R	R	R	R
Widusa	Co-15	dNe	R	R	R	S	S	R	S	R	R	R	S	R	R	R	S	S
Jalo Vermelho	Co-12	R	R	S	R	S	R	S	R	R	R	S	R	R	R	R	S	S
Jalo Listras Pretas	Co-13	R	S	S	R	S	S	S	S	R	R	R	R	S	S	R	S	R
Pitanga	Co-14	dNe	R	S	R	R	R	S	R	R	R	R	S	S	S	S	R	S
Corinthiano	Co-15	R	R	S	S	S	R	dNe	S	R	R	R	R	R	S	R	R	S
Paloma	CoPv01PA	dNe	S	S	S	S	R	R	R	R	R	R	S	S	S	R	R	R
Amendoim Cavalo	CoPv01AC	R	R	R	R	R	R	R	R	R	R	R	R	S	S	R	R	R
Jalo Pintado 2	CoPv04JP2	R	R	R	R	S	S	S	S	R	R	R	S	R	R	R	R	R
Jalo EEP558	Co-w, Co-x	R	S	S	dNe	S	dNe	dNe	S	R	R	R	S	R	R	R	S	R
	Co-y, Co-z
CDRKc	CoPv01CDRK	R	R	S	R	S	S	R	R	R	R	R	R	S	dNe	R	R	R
Yolano e(MA)		S	S	S	S	R	S	S	S	S	S	S	S	S	dNe	S	S	S

aRaces = Ten Mesoamerican (9, 64, 65, 73, 89, 445, 453, 1545, 2047 and 3481) and six Andean (2, 7, 19, 23, 39, and 55) races of Colletotrichum lindemuthianum;

bMDRK = Michigan Dark Red Kidney;

cCDRK = California Dark Red Kidney;

dNe = Not evaluated;

eMA = Mesoamerican.

ANT and ALS co-segregation analyses in the CY RIL population

To determine the inheritance of resistance to races 73, 2047, and 3481 of C. lindemuthianum and 63–39 of P. griseola in CDRK, we inoculated 110 RILs (ten plants from each RIL) with each of these races and scored their disease symptoms (S1 Table). As expected for a single, dominant resistance locus, we observed a segregation ratio of 1RR:1rr in the RIL population, namely, 54 RILs were resistant (RR) and 56 RILs were susceptible (rr) (χ = 0.036, p-value = 0.849; Table 2). Interestingly, each RIL showed identical phenotypes in response to each race, indicating that resistances to these ANT and ALS races co-segregate in this population and that the sources of resistance in the CDRK genetic background are either tightly linked. Thus, we named this loci CoPv01/PhgPv01.

Table 2

Segregation for resistance to races 73, 2047, 3481 of Colletotrichum lindemuthianum and 63–39 of Pseudocercospora griseola in common bean F10 RIL population from the California Dark Red Kidney × Yolano cross.

Parental cross	Generation	Observed Ratio (1R:1S)a	Expected Ratio (1R:1S)	χ2	P value (1 df)
Race 73, 2047, and 3481 of Colletotrichum lindemuthianum
CDRKb	RPc	30:0
Yolano	SPd	0:30
CDRK × Yolano	F10	54:56	55:55	0.036	0.849
Race 63–39 of Pseudocercospora griseola
CDRK	RPb	30:0
Yolano	SPc	0:30
CDRK × Yolano	F10	54:56	55:55	0.036	0.849

aR = Resistant; S = Susceptible;

bCDRK = California Dark Red Kidney;

cRP = Resistant Parent;

dSP = Susceptible Parent.

The results of studies of the allelic relationship between the anthracnose resistance gene in the Andean common bean cultivar CDRK crossed with MDRK and Amendoim Cavalo revealed the absence of allelism (S4 Table). In the allelism test using the Fpopulation from the cross CDRK × Amendoim Cavalo (χ2 = 0.026; p-value = 0.87) inoculated with race 3481, a segregation ratio of 15R:1S was obtained, indicating the presence of two independent dominant genes; one gene is Co-AC [66, 32], present in the cultivar Amendoim Cavalo, and the other gene originated in CDRK. The same ratio of 15R:1S was obtained using race 3481 in the cross CDRK × MDRK (χ2 = 0.022; p-value = 0.88), indicating the action of two dominant genes. In this case, the gene present in CDRK was shown to be independent of the gene Co-1 [67] present in MDRK.

Fine-mapping of the CoPv01/PhgPv01 loci

Genetic linkage analysis between the CoPv01/PhgPv01 loci and SNPs showing the expected segregation of 1:1 in the RIL population revealed that CoPv01/PhgPv01 is flanked by the SNP markers ss715645251 and ss715645248 in a genomic region on chromosome Pv01 (Fig 1). The physical locations of the markers ss715645251 and ss715645248 are 50,301,532 bp and 50,546,985 bp, respectively, which correspond to a distance of 245.6 Kb based on the bean reference genome v1.0 (https://www.ncbi.nlm.nih.gov).

Fig 1

Genetic map of common bean linkage group Pv01 containing the anthracnose and angular leaf spot resistance loci and linked Single Nucleotide Polymorphism (SNPs) markers used to genotype the F10 population California Dark Red Kidney × Yolano.

Recombination distances are indicated on the left side of the linkage group in centiMorgans (cM), and the marker names are shown on the right side. The CoPv01/PhgPv01 resistance loci were flanked by SNP markers ss715645251 and ss715645248 in F10 mapping population. The map was drawn with MapChart (65).

To narrow the genomic region harboring the CoPv01/PhgPv01 loci, we performed a fine-mapping analysis by genotyping 19 RILs that showed recombination events in the 245.6 Kb region identified. Recombination events were identified based on the genotypic data of all 110 RILs obtained with the BARCBEAN6K_3 BeadChip. Upon genotyping these 19 RILs with 12 SNPs, two SSRs, and one STS marker, we observed that the susceptible CY5 RIL and the resistant CY48 RIL contained recombination events (Table 3) that allowed us to delimit the CoPv01/PhgPv01 region to the area between the CV542014 and ss715645248 markers. Based on the bean reference genome [41], these new CoPv01/PhgPv01 flanking markers are located at positions 50,513,853 bp (CV542014) and 50,546,985 bp (ss715645248) of chromosome Pv01, spanning 33 Kb (Fig 2).

Table 3

Genotype and phenotype of 19 F10 recombinant events in the region of Pv01 used for fine mapping of the anthracnose and angular leaf spot resistance loci in CDRK.

The phenotype was obtained from the reaction of the 110 F10 RILs to races 73, 2047, and 3481 of Colletotrichum lindemuthianum and race 63–39 of P. griseola. Genotyping was achieved using the flanking markers 12 SNP, two SSR and one STS markers that enabled the positioning of the CoPv01/PhgPv01 loci in a 33 kb genomic region flanked by markers CV542014 and ss715645248.

Marker	SNP position	Recombinant lines from CDRK × Yolano
		5	12	19	20	33	38	43	47	48	62	70	73	79	87	88	91	115	96	146
ss715645260	50115685	AA	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	AA	BB	BB	AA	BB	AB	AB
ss715645259	50130201	AA	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	AA	BB	BB	AA	BB	AB	AB
ss715645258	50155987	AA	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	AA	BB	BB	AA	BB	AB	AB
ss715645257	50161526	AA	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	AA	BB	BB	AA	BB	AB	AB
ss715645256	50182775	AA	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	AA	BB	BB	AA	BB	AB	AB
ss715645254	50203547	AA	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	AA	BB	BB	AA	BB	AB	AB
ss715645252	50222584	AA	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	AA	BB	BB	AA	BB	AB	AB
ss715645251	50301592	AA	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	BB	BB	BB	AA	BB	AB	AB
BARCPVSSR01358	50350345	AA	AA	BB	BB	AA	BB	-	AA	AA	BB	AA	AA	BB	BB	BB	AA	BB	BB	AA
BARCPVSSR01361	50388017	AA	AA	BB	BB	AA	BB	-	AA	AA	BB	AA	AA	BB	BB	BB	AA	BB	BB	AA
CV542014	50513853	AA	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	BB	BB	BB	AA	BB	AB	AB
CoPv01CDRK/PhgPv01CDRK		BB	AA	BB	BB	AA	BB	AA	AA	AA	BB	AA	AA	BB	BB	BB	AA	BB	BB	AA
ss715645248	50546985	BB	AA	BB	BB	AA	BB	AA	AA	BB	BB	AA	AA	BB	BB	BB	AA	BB	AB	AB
ss715645299	51353193	BB	BB	AA	BB	AA	AA	AA	BB	BB	BB	BB	BB	BB	BB	BB	BB	AA	AB	AA
ss715645293	51617802	BB	BB	AA	AA	BB	AA	BB	BB	BB	AA	AA	BB	BB	AA	AA	BB	AA	AA	AA
ss715645250	51726047	BB	BB	AA	AA	BB	AA	BB	BB	BB	AA	AA	BB	BB	AA	AA	BB	AA	BB	AA
ss715645244	51764167	AA	BB	AA	AA	BB	AA	BB	BB	BB	AA	AA	BB	BB	AA	AA	BB	AA	BB	AA
ss715645305	51786948	AA	BB	AA	AA	BB	AA	BB	BB	BB	AA	AA	BB	BB	AA	AA	BB	AA	BB	AA
ss715645301	51819821	AA	BB	AA	AA	BB	AA	BB	BB	BB	AA	AA	BB	BB	AA	AA	BB	AA	BB	AA
ss715648967	51883712	AA	BB	AA	AA	BB	AA	BB	BB	BB	AA	AA	BB	BB	AA	AA	BB	AA	BB	AA
ss715648965	51896315	AA	BB	AA	AA	BB	AA	BB	BB	BB	AA	AA	BB	BB	AA	AA	BB	AA	BB	AA

AA = Resistant; BB = Susceptible; AB = Heterozygous;— = not available.

Fig 2

Fine mapped region for the CDRK resistance lociCoPv01/PhgPv01.

Upper bar represents the entire chromosome Pv01, in which the CoPv01/PhgPv01 region is highlighted as red square at the end of the chromosome. The five predicted genes within this region are shown, where the location of the CoPv01/PhgPv01 flanking markers CV542014 and ss715645248 are indicated by dashed lines, within the predicted genes Phvul.001G246000 and Phvul.001G246400, respectively. The genomic region between these markers is indicated by the lower bar and cover around 33 Kbp of the genome.

Predicted genes and functions associated with the CoPv01/PhgPv01 loci

Based on the bean reference genome, the 33 Kb region contains five predicted genes (Table 4). The predicted genes encode the proteins Phvul_001G246000 (ATP-dependent RNA Helicase), Phvul.001G246100 (Cation-dependent mannose-6-phosphate receptor), Phvul.001G246200 (Protein Trichome Birefringence-like 33), Phvul.001G246300 (Abscisic Acid (ABA) receptor PYL5), and Phvul.001G246400 (SNF2 domain-containing protein classy 1-related). The putative orthologs for these genes were identified in the Arabidopsis genome (TAIR) for further functional reference (Table 4).

Table 4

Gene models found in delimitated region CDRK resistance loci against anthracnose and angular leaf spot were fine-mapped, gene position in reference genome v1.0 and annotation.

Gene Model in P. vulgaris	Homolog in A. thaliana	E-valuea	Identitya	Functional annotation on TAIRb	Functional annotation on Phytozomec
Phvul.001G245300	AT4G18640	8 × 10−169	43.40%	Male Discoverer 2	Protein tyrosine kinase (pkinase_tyr) // leucine rich repeat n-terminal domain (lrrnt_2)
Phvul.001G246000	AT5G05450	0	70.50%	RNA Helicase 18	ATP-dependent RNA helicase ddx55/spb4 [ec:3.6.4.13] (ddx55, spb4)
Phvul.001G246100	AT2G37390	1 × 10−105	52.60%	Sodium Potassium Root Defective 2	Cation-dependent mannose-6-phosphate receptor
Phvul.001G246200	AT2G40320	0	69.90%	Trichome Birefringence-Like 33	Protein trichome birefringence-like 33
Phvul.001G246300	AT2G40330	1 × 10−76	56.90%	ABA Receptor PYL6	Abscisic acid receptor pyl5
Phvul.001G246400	AT5G20400	0	48.30%	Flavanone 3 Hydroxylase-like	SNF2 domain-containing protein classy 1-related
Phvul.001G246800	AT3G50740	0	60.60%	UDP-Glucosyl Transferase 72E1	Leucine-rich repeat receptor-like protein kinase imk3-related

aE-values and Identity for BLASTp analysis performed on NCBI (National Center for Biotechnology Information; https://www.ncbi.nlm.nih.gov)

b Functional gene annotation resource: TAIR—The Arabidopsis Information Resource (https://www.arabidopsis.org)

cFunctional gene annotation resource: Phytozome—Common bean reference genome v1.0 (https://phytozome.jgi.doe.gov#

Interestingly, the marker CV542014 is physically mapped at 946 bases upstream the stop codon of the Phvul.001G246000, at the last predicted intron (Fig 2). Furthermore, the marker ss715645248 is located at 1,283 bases from the stop codon of the predicted gene Phvul.001G246400 (Fig 2), resulting in a mutation in the last exon of this gene, which encodes for a putative DEXH-box Helicase Domain (DEXHc_ATRX-like; Conserved Domain cd18007, e-value = 9.8 × 10−73).

Additionally, the predicted gene Phvul.001G245300, which encodes a putative Leucine-Rich Repeat Protein Kinase (LRR-Kinase), was detected approximately 66 Kb upstream of the marker locus CV542014 (Table 4). An additional putative LRR-kinase (Phvul.001G246800) was found 26 Kb downstream of the marker ss715645248 (Table 4). These five genes are interesting candidates for CoPv01/PhgPv01 and may confer resistance to ANT and ALS pathogens. The Fig 3 shows the ANT resistance cluster present at the end of chromosome Pv01.

Fig 3

Anthracnose cluster 1.1 on Pv01 with specific candidate genes within and close to the genomic region where these resistance genes were mapped.

Molecular markers linked to the resistance genes are displayed in black color. In red candidate genes that encode kinases, in blue candidate genes encoding NB-LRR and in green candidate genes with other domains. The resistance gene in CDRK cultivar was fine mapped in a region having five candidate genes and close to LRR. Co-1, Co-x and Co-1 harbor the same kinases. CoPv01, Co-1 and CoPv01 are the resistance genes of the Amendoim Cavalo, AND 277 and Paloma cultivars, respectively.

Discussion

The spectra of resistance observed for CDRK were different from those of the four Andean cultivars that have ANT resistance alleles at the Co-1 locus. CDRK is resistant to race 2 while MDRK is susceptible. In relation to races 39, 55 and 2047 CDRK was resistant and MDRK, Kaboon and Perry Marrow were susceptible. Additionally, AND 277 showed compatible reaction to race 39. The resistance of CDRK to races 2, 9, 64, 65, and 73 of C. lindemuthianum and race 63–39 of P. griseola is important for common bean breeding programs in Brazil, where these races have high rates of occurrence [45, 46, 47, 49].

The results of inoculating the 110 CY RILs with races 73, 2047, and 3481 of C. lindemuthianum and 63–39 of P. griseola showed that 54 RILs were resistant, while 56 were susceptible. These results fit a segregation ratio of 1R:1S, revealing a monogenic inheritance. It is important to note that all RILs resistant to race 73 were also resistant to races 2047, 3481, and 63–39, while all RILs susceptible to race 73 were also susceptible to races 2047, 3481, and 63–39.

The present study established that the resistance of CDRK to races 73, 2047, and 3481 of C. lindemuthianum and race 63–39 of P. griseola is conferred by a dominant gene. The dominant nature of resistance in the CDRK cultivar suggests that resistance is transferable to commercial cultivars.

In addition, allelism tests conducted in two F2 populations from crosses R × R between the CDRK × MDRK, and CDRK × Amendoim Cavalo inoculated with race 3481 revealed the presence of two dominant genes in each population that conferred resistance to anthracnose. One of these genes (Co-1) is present in MDRK [67], and the other gene is present in CDRK. Notably, the segregation results for the F2 population from the cross CDRK × Amendoim Cavalo highlighted the presence of a dominant gene in CDRK that is independent of the Co-AC genes present in Amendoim Cavalo. The monogenic nature of Amendoim Cavalo resistance to C. lindemuthianum race 3481 was reported by [31]. These results support the hypothesis that the gene conferring resistance to race 3481 of this fungal pathogen, present in CDRK, is independent from other genes (Co-1 and Co-AC genes), harbored in Michigan Dark Red Kidney and Amendoim Cavalo, respectively.

In this study, we elucidated the inheritance of anthracnose resistance in the Andean bean cultivar CDRK and established the genetic relationship between this resistance locus and two known ANT resistance genes mapped to Cluster 1.1 at the end of Pv01. Additional segregation analysis in populations derived from crossing CDRK with two Andean bean cultivars, each carrying different ANT resistance genes, revealed that the ANT resistance of CDRK is conferred by a new gene that is distinct from the previously reported resistance genes Co-1 and Co-AC in common bean. Based on this evidence, the authors propose that the symbol for anthracnose resistance loci in the CDRK cultivar be named CoPv01/PhgPv01.

The co-segregation analysis of the ANT and ALS resistance genes was observed in 110 CY RILs originating from a CDRK × Yolano cross, which showed identical phenotypes in response to both diseases. A total of 54 RILs that were resistant to the ANT pathogen were also resistant to all races of the ALS pathogen; 56 RILs that were susceptible (S) to the ANT pathogen were also susceptible to the ALS pathogen. These results suggest that the CoPv01 and PhgPv01 loci are closely linked.

ANT and ALS are two of the most widespread and severe diseases of common bean in the Americas and Africa, which are considered the two largest producers and consumers of this crop [8, 11]. Moreover, these genes protect common bean against two pathogens possessing high and possibly rapidly changing virulence diversity. Thus, the availability of accurate molecular markers to transfer these genes into commercial common bean cultivars would probably increase resistance durability in these cultivars against highly variable pathogens. In the present study, we conducted a co-segregation analysis of the CoPv01 and PhgPv01 loci using two sets of CY RILs, which were inoculated independently with specific races of the ANT and ALS pathogens, to ensure accurate phenotypic evaluations. We combined separate co-segregation tests for ALS and ANT using a large set of phenotyped plants (4,400 F10 plants) with the power of an Illumina BeadChip (containing over 5,398 SNPs). These large sets of information enabled the creation of a genetic linkage map and revealed the genetic distance between the genes CoPv01 and PhgPv01 at the end of chromosome Pv01. Most of the disease-resistance genes of common bean that have already been characterized are located in distal chromosome regions with high levels of recombination, thus favoring the identification of molecular markers closely linked to disease-resistance genes. However, the presence of repeated sequences, such as khipu satellites, at several large resistance clusters of Pv04, Pv10, and Pv11 might complicate the process of designing locus-specific primers [32].

The candidate region containing the CoPv01 and PhgPv01 loci in linkage group Pv01 is located close to one of the most important clusters of ANT resistance genes in the common bean genome [32]. The Pv01 cluster includes the following ANT disease-resistance genes: Co-1, Co-1, Co-1; Co-x, Co-Pa, Co-AC, and Co-1 [23, 25, 28, 29, 30, 31, 53, 68]. The CoPv01/PhgPv01 loci was found in a genomic region flanked by the markers ss715645251 (50,301,532 bp) and ss715645248 (50,546,925 bp) on Pv01 (Fig 1).

Furthermore, the kinase Phvul.001G243800 was significantly associated with responses to races 65, 73, and 3481 in a genome-wide association study of Andean bean lines [68]. This study used an Andean diversity panel (ADP) and identified the SNP marker ss715645251, which was associated with ANT, in the gene Phvul.001G243800 at position 50,301,532; the authors attributed this gene to the Co-1 locus [68]. Moreover, the Co1 resistance gene in the Hongyundou cultivar was fine-mapped between the markers TF1 and Clp-N1, positioned at 50,286,325 and 50,332,737, respectively. This 46 Kb region harbors four candidate genes: Phvul.001G243500, Phvul.001G243600, Phvul.001G243700, and the previously mentioned candidate gene for the Co-1 locus, Phvul.001G243800 [29].

The resistance gene Co-x was identified in the Jalo EEP558 cultivar and fine-mapped to a genomic region (56 Kb) flanked by the markers P05 and K06 at positions 50,264,307 and 50,320,695. This 56 Kb region overlaps the 34 Kb of Co-1, which contains the four candidate genes mentioned above, and the larger region harbors three additional genes, Phvul.001G243200, Phvul.001G243300, and Phvul.001G243400 [28]. The resistance gene in the Xana cultivar, named Co-1, was mapped between the markers SNP01_483 and SNP01_490, located in a 153 Kb region from 50,223,771 and 50,377,556. A total of 17 candidate genes were identified in this region, which also covers part of the Co-1 and Co-x region [53].

Furthermore, the resistance gene of Amendoim Cavalo was recently fine-mapped between the markers SS102 and SS165, located at 50,377,247 and 50,386,692. This 9 Kb interval harbors three candidate genes: Phvul.001G244300, Phvul.001G244400, and Phvul.001G244500. The first of these genes is also present in the Co-1 interval, sharing 0.309 kb.

The AND 277 resistance allele (Co-1) was mapped between the markers CV542014450 (50,513,853) at 0.7 cM and TGA1.1570 (50,741,598) at 1.3 cM. Fine-mapping studies are being conducted to reduce this 227 Kb interval. Mapping analysis located the CoPv01 resistance gene in a 390 Kb region flanked by the SNP markers SS82 (50,155,987) and SS83 (50,546,985) at distances of 1.3 and 2.1 cM, respectively. This region contains 46 annotated genes, nine of which contain domains with functions related to pathogen resistance: Phvul.001G243200, Phvul.001G243300, Phvul.001G243500, Phvul.001G243600, Phvul.001G243700, the abovementioned Phvul.001G243800, Phvul.001G243100, Phvul.001G245100 and Phvul.001G245300.

CoPv01 was fine-mapped to a 33 Kb interval between CV542014 (50,513,853) and ss715645248 (50,546,985) harboring Phvul.001G246000, Phvul.001G246100, Phvul.001G246200, Phvul.001G246300 and Phvul.001G246400 and close to the genes Phvul.001G245300 and Phvul.001G246800 that encode NB-LRR domains. In this context and based on the physical positions of the aforementioned markers, CoPv01 is clearly positioned downstream of the Co-1, Co-1, Co-x, CoPv01, and Co-1 loci (Fig 3). These results suggest that the CoPv01 locus is different from the aforementioned loci.

Among the candidate genes identified in the CoPv01/PhgPv01 loci, the genomic sequences of Phvul.001G246000 and Phvul.001G246400 contain the locus-flanking markers CV542014 and ss715645248, respectively (Fig 2, Table 4). Phvul.001G246000 is a homolog of A. thaliana RNA Helicase 18 (RH18), which was linked to spontaneous chlorosis in hybrids [69]. Several members of the RNA helicase family were found to be involved in the chlorotic phenotype in young leaves by affecting chloroplast biogenesis and reducing photosynthesis [70, 71]. Interestingly, C. lindemuthianum was previously shown to modulate the expression of several genes predicted to be located in the chloroplast [33], and a decrease in plant photosynthetic rates was observed after ANT infection [72]. Indeed, chlorosis can arise due to a delay in chloroplast biogenesis, functionality, or metabolism [73]. Therefore, Phvul.001G246000 could affect photosynthesis to control the chlorosis induced by ANT and ALS, causing resistant plants not to present disease symptoms. Similarly, Phvul.001G246400 is a homolog of Arabidopsis Flavanone 3 Hydroxylase-like (F3H-like), a flavonol synthase involved in the accumulation of flavonoids under light [74]. Hence, it is possible that Phvul.001G246400 could be involved in the biosynthesis of flavonoids to avoid light stress, preventing damage in the chloroplast and contributing to the absence of necrosis after fungal infection. Moreover, flavonoids are secondary metabolites known to be induced upon pathogenic attack, mainly by the induction of the phytohormone jasmonic acid (JA) [75]. JA is well known as an antifungal plant hormone and has previously been linked to defense against ANT in common bean [33] and ALS [36]. The CoPv01/PhgPv01 loci also contains Phvul.001G246300, a homolog of Arabidopsis ABA Receptor PYL6 (Table 4), which plays a central role in the crosstalk between the ABA and JA responses [76]. This suggests that Phvul.001G246300 may have a role in JA/ABA responses during common bean interaction with C. lindemuthianum and P. griseola.

Moreover, Phvul.001G246100 in the CoPv01/PhgPv01 loci is a homolog of Arabidopsis Sodium Potassium Root Defective 2 (NAKR2), which belongs to a family of proteins known to have a heavy-metal-associated domain that is linked to the cell division rate in the root meristem [77]. Another gene in the CoPv01/PhgPv01 loci is Phvul.001G246200, a homolog of Arabidopsis Trichome Birefringence-Like 33 (TBL33), a protein known to be involved in the synthesis and deposition of secondary wall cellulose [78]. Finally, receptor-like kinases are known to function in plant defense against pathogens [79], including common bean response to ANT and ALS [33, 36]. Therefore, we also investigated the closest LRR-Kinases to the fine-mapped CoPv01/PhgPv01 loci (Table 4). Phvul.001G245300 was shown to be a homolog of Arabidopsis Male Discoverer 2 (MDIS2), a receptor located in the pollen tube that perceives a female attractant signal to promote fertilization [80]. Phvul.001G246800 is homologous to Arabidopsis UDP-Glucosyl Transferase 72E1 (UGT72E1), an enzyme thought to be involved in lignin metabolism [81]. Although none of these proteins has any directly established function in plant defense against pathogens, it is possible that NAKR2, TBL33, and UGT72E1 have roles in plant cell wall strengthening to avoid fungal penetration. MDIS2 is involved in plant fertilization [80]. Another protein putatively involved in plant fertility and linked to ANT resistance in beans is Feronia-like, which is closely related to the ANT resistance gene COK-4 [54] and is thought to function in the regulation of both plant growth and defense [82]. Therefore, it seems that proteins involved in pollen–gametophyte recognition have roles in common bean defense against ANT and possibly also against ALS.

Conclusions

The results presented here showed that CDRK cultivar has the CoPv01 and PhgPv01 genes conferring resistance to races 73, 2047, and 3481 of C. lindemuthianum and race 63–39 of P. griseola. The CoPv01 and PhgPv01 loci co-segregated and were completely linked on chromosome Pv01. New resistance loci, CoPv01 and PhgPv01, against C. lindemuthianum and P. griseola were fine-mapped in a genomic region of 33 Kb on chromosome Pv01 that harbors five predicted genes. Allelism tests showed that CoPv01resistance gene is different from the Co-1 and Co-AC loci mapped on Pv01; the physical distances of these genes from CoPv01 are 211,376 bp and 126,216 bp, respectively. In addition, CoPv01 and PhgPv01 resistance alleles are inherited together and can be monitored with high efficiency using SNP markers. These results can be applied to breeding programs aimed at developing bean cultivars with ANT and ALS resistance using marker-assisted selection.

Reaction of the F2 seedlings derived from the cross California Dark Red Kidney (CDRK) × Michigan Dark Red Kidney (MDRK) inoculated with race 3481 of C. lindemuthianum for allelism tests.

(TIF)

Click here for additional data file.

Disease reaction (resistance = R or susceptibility = S) in 110 F10 RILs (CY = California Dark Red Kidney × Yolano population) to races 73, 2047 and 3481 of C. lindemuthianum and race 63–39 of P. griseola.

Ten plants per each RIL were evaluated. Lines written in italics underlined carry recombinant events in the predicted location of the Co/Phg loci.

(DOC)

Click here for additional data file.

Gene models found in the Pv01 region between 50,301,592 and 50,301,592 delimited by the markers ss715645251 and ss715645248, respectively.

Gene positions and their functional annotations are based on the bean reference genome available at Phytozome.

(DOC)

Click here for additional data file.

SNP markers associated with the anthracnose resistance locus in the common bean cultivar CDRK discovered by co-segregation and genetic mapping analysis and located on the lower end of chromosome Pv01 of common bean.

*Genetic position in centiMorgans (cM), based on the map developed by Song et al. (2015).

(DOC)

Click here for additional data file.

Allelism tests in F2 populations for the anthracnose resistance gene in the common bean cultivar California Dark Red Kidney (CDRK).

(DOC)

Click here for additional data file.

11 Mar 2020

PONE-D-20-00761

New Andean source of resistance to anthracnose and angular leaf spot: fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar

PLOS ONE

Dear Dr. Maria Celeste Gonçalves-Vidigal,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

ACADEMIC EDITOR:

The manuscript was reviewed by two reviewers and both recommended the manuscript after addressing some minor changes/comments. Therefore we advise authors to incorporate these minor changes suggested by both the reviewers and resubmit the manuscript.

==============================

We would appreciate receiving your revised manuscript by %March 30, 2020%. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Reyazul Rouf Mir, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

The manuscript entitled "New Andean source of resistance to anthracnose and angular leaf spot: fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar" is dealing with most important disease in common bean. The manuscript reports the fine mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar. The information will prove useful in gene cloning and use of genes in marker-assisted selection for breeding common bean cultivars with enhanced disease resistance. Based on the advise received by two reviewers, I recommend acceptance of manuscript after minor revision. The authors may consider minor comments made by the two reviewers.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Acknowledgments Section of your manuscript:

"M.C. Gonçalves-Vidigal is grateful for grant from Capes number BEX 88881.170662//2018-01."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

3. Your ethics statement must appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please also ensure that your ethics statement is included in your manuscript, as the ethics section of your online submission will not be published alongside your manuscript.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript entitled "New Andean source of resistance to anthracnose and angular leaf spot: fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar" by Gonçalves-Vidigal et al is an interesting subject and very well written. Anthracnose and angular leaf spot caused by Colletotrichum lindemuthianum and Pseudocercospora griseola , respectively, are devastating diseases of common bean around the world. The have concluded with the results by showing the fine mapping of CoPv01 CDRK / PhgPv01 CDRK loci to a smaller genomic region of 33 Kb. This information can be applied in breeding programs to develop bean cultivars with ANT and ALS resistance using marker-assisted selection.

Some minor comments for authors to address arguing below

Line no. 128: Please mention number of plants evaluated for non-inoculated control

Line no. 148: Elaboration is required for how and where F1 hybrids seeds were selfed to obtain F2 i.e whether the procedure development of F2 from F1 was done in field conditions or in control conditions

Line no. 78: Uniform style citing the reference

While citing a reference in the introduction section, authors are suggested to cite only the original reference and furthermore reduce the references cited for a particular sentence. Eg in line No. 73, there are eleven references quoted by the author, better is to reduce it as minimum

In the introduction and discussion sections, support your conclusions regarding fine mapping with recent published reports of 2020.

Lastly authors are requested to please go through the author guidelines of the journal before submitting the final revised manuscript.

Reviewer #2: The manuscript is well written and the information at Co-1 locus is well described. The new R gene and it mapping will assist development of breeding lines in the region. I therefore recommend its publication. There are few typos that need attention.

L124 please mention authors

L124 please check Inocula

L128 rewrite

L135 by [61, 62]. please add authors

L135 Between change it to from

L191 space after and" and , before and

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Bilal A Padder

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

1 Apr 2020

DATE: March 28, 2020

TO: Reyazul Rouf Mir, PhD, Academic Editor PLOS ONE

FROM: Maria Celeste Gonçalves-Vidigal, Corresponding Author

SUBJECT: Manuscript [PONE-D-20-00761] - [EMID:c34843a9dba2cb7e]

We appreciate your thoughtful comments and suggestions to improve the manuscript entitled "New Andean source of resistance to anthracnose and angular leaf spot - fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar" based on the recommendations on the cover letter.

I received this communication from you on a e-mail dated Wednesday, March 11, 2020 - onbehalfof+ PloS One Editorial Office:em@editorialmanager.com

We have carefully reviewed the manuscript and believe that this problem has been properly addressed in the revised manuscript. The revisions and corrections are shown in red colored font on the text of the revised manuscript and all response to the reviewer comments are provided this letter.

Thank you for your collaboration and attention.

Comments from the Editor and Reviewers to the Authors

Reviewer #1

'The manuscript entitled "New Andean source of resistance to anthracnose and angular leaf spot: fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar" by Gonçalves-Vidigal et al isan interesting subject and very well written. Anthracnose and angular leaf spot caused by Colletotrichum lindemuthianum and Pseudocercospora griseola, respectively, are devastating diseases of common bean around the world. They have concluded with the results by showing the fine mapping of CoPv01CDRK / PhgPv01CDRKloci to a smaller genomicregion of 33 Kb. This information can be applied in breeding programs to develop bean cultivars with ANT and ALS resistance using marker-assisted selection.

Some minor comments for authors to address arguing below:'

Line no. 128: Please mention number of plants evaluated for non-inoculated control.

Page # 6, Lines 131 to 138: All plants were inoculated and the paragraph has been rewritten:

'After the expansion of the first trifoliolate leaf, the leaflet of 10 seedlings of each line were inoculated with each race of C. lindemuthianum and the leaflet of 10 seedlings with P. griseola. Each pathogen was inoculated separately. A spore suspension containing 2.0 × 106 spores mL-1 of races 73, 2047 and 3481 of C. lindemuthianum were inoculated using a DeVilbiss number 15 atomizer powered by an electric air compressor (Schulz, SA, Joinville, Santa Catarina, Brazil). A similar procedure was employed for the inoculation with race 63-39 of P. griseola using a spore suspension of 1.2 × 104 conidia mL-1. Ten plants for resistant and susceptible control for each race were inoculated [59, 60].'

Line no. 148: Elaboration is required for how and where F1 hybrids seeds were selfed to obtain F2 i.e whether the procedure development of F2 from F1 was done in field conditions or in control conditions

Page #7, Lines # 156 to 162

The paragraph starting at the line 148 to 149, the paragraph has been rewritten:

'The F1 seeds were sown in polyethylene vases (48 × 30 × 11 cm) containing a mixture of the commercial substrate Plantmax®, which had been previously fertilized and sterilized. The plant vases were kept in a greenhouse until the F2 seeds were produced. The F2 individuals, obtained by selfing individual F1 plants, were used to characterize the plants for resistance to race 3481 of C. lindemuthianum. Seedlings were grown until pod maturation under natural light in greenhouses. The seedlings were maintained in a greenhouse until the first trifoliolate leaves [56] were fully expanded.'

Line no. 78: Uniform style citing the reference.

While citing a reference in the introduction section, authors are suggested to cite only the original reference and furthermore reduce the references cited for a particular sentence. Eg in line No. 73, there are eleven references quoted by the author, better is to reduce it as minimum.

Pages # 3 and 4, Lines # 70 to 75: The number of authors in the line # 73 was reduced and they were added along of the paragraph according to the specific phrase of the author, the paragraph has been rewritten as see below :

'Resistance to ANT is conferred by independently segregating individual loci in a series named Co. Currently, the known Co genes are Co-1 and its alleles, Co-14, Co-Pa, Co-x, and Co-w on chromosome Pv01 [22, 23, 25, 27, 28, 30, 31, 32]; Co-u and CoPv02 on chromosome Pv02 [18, 22]; Co-13 and Co-17 on chromosome Pv03 [29]; Co-3, Co-32, Co-33, Co-34/Phg-3, Co-y, Co-z, and Co-RVI on chromosome Pv04 [24, 26]; Co-5, Co-6, and Co-v on chromosome Pv07; and Co-2 on chromosome Pv11 [29].'

In the introduction and discussion sections, support your conclusions regarding fine mapping with recent published reports of 2020.

Page # 29, Lines # 634 to 637: A new bibliographic reference was added in the Introduction on the mapping of anthracnose resistance genes in Pv01. Consequently, it was also mentioned in the Discussion

'Farooq M, Padder BA, Bhat NN, Shah MD, Shikari AB, Awale HE, Kelly JD. Temporal expression of candidate genes at the Co-1 locus and their interaction with other defense related genes in common bean. Physiol Mol Plant Pathol. 2019; 108: 101424. doi: 10.1016/j.pmpp.2019.101424.'

Lastly authors are requested to please go through the author guidelines of the journal before submitting the final revised manuscript.

The guidelines was checked and changes were made

Reviewer #2

The manuscript is well written and the information at Co-1 locus is well described. The new R gene and it mapping will assist development of breeding lines in the region. I therefore recommend its publication. There are few typos that need attention.

L124 please mention authors

Page # 6, Line # 126: The authors were mentioned:

'Monosporic cultures of C. lindemuthianum and of P. griseola were prepared according to the methodologies proposed by Mathur et al. [57] and Sanglard et al. [58].'

L124 please check Inocula

Page # 6, Line #127: The word Inocula was replaced by Inoculum

L128 rewrite

Page # 6, Lines # 130 to 137, the paragraph has been rewritten as see below:

'Soon after the expansion of the first trifoliolate leaf, the leaflet of 10 seedlings of each line were inoculated with each race of C. lindemuthianum and the leaflet of 10 seedlings with P. griseola. Each pathogen was inoculated separately. A spore suspension containing 2.0 × 106 spores mL-1 of races 73, 2047 and 3481 of C. lindemuthianum were inoculated using a DeVilbiss number 15 atomizer powered by an electric air compressor (Schulz, SA, Joinville, Santa Catarina, Brazil). A similar procedure was employed for the inoculation with race 63-39 of P. griseola using a spore suspension of 1.2 × 104 conidia mL-1. Ten plants for resistant and susceptible control for each race were inoculated [59, 60].'

L135 by [61, 62].please add authors

L135 Between change it to from

Page # 6, Line 142: The name of authors were added and the word 'from' was inserted:

Pastor-Corrales et al. [61] and Inglis et al. [62]. Plants with disease reaction scores from 1

L191 space after and" and , before and

Page # 9, Line # 205: The space was inserted

Funding: This research was supported by Brazilian Federal Funding Institutions National Council for Scientific and Technological Development (CNPq) for financial support and scholarship grants and the Coordination for the Improvement of Higher Education Personnel (Capes). M.C. Gonçalves-Vidigal is grateful for grant from Capes number BEX 88881.170662//2018-01.

We would like to thank for the suggestions from the Editor and the reviewers that have improved this manuscript.

Regards,

M. C. Gonçalves-Vidigal

Corresponding Author

11 Jun 2020

New Andean source of resistance to anthracnose and angular leaf spot: fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar

PONE-D-20-00761R1

Dear Dr. Maria Celeste Gonçalves-Vidigal,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Reyazul Rouf Mir, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: All the queries and suggestions pointed out in the manuscript "New Andean source of resistance to anthracnose and angular leaf spot: fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar" have been well addressed and presented in the revised manuscript

Reviewer #2: I have no further queries but a suggestion. Please check reference no 23, Farooq et al., After checking it I found Mahiya-Farooq on running head of the paper. So in my opinion it should be Mahiya-Farooq.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

18 Jun 2020

PONE-D-20-00761R1

New Andean source of resistance to anthracnose and angular leaf spot: fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar

Dear Dr. Gonçalves-Vidigal:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Reyazul Rouf Mir

Academic Editor

PLOS ONE