OncotRF: an online resource for exploration of tRNA-derived fragments in human cancers.

Transfer RNA-derived fragments (tRFs) are a new class of small non-coding RNAs whose biological roles in cancers are not well understood. Emerging evidence suggests that tRFs are involved in gene regulation at multiple levels. In this study, we constructed an integrative database, OncotRF (http://bioinformatics.zju.edu.cn/OncotRF), for in silico exploration of tRF functions, and identification of diagnostic and prognostic biomarkers in cancers. The database contains an analysis pipeline for tRF identification and characterization, analysis results of 11,211 small RNA sequencing samples and 8,776 RNA sequencing samples, and clinicopathologic annotation data from The Cancer Genome Atlas (TCGA). The results include: tRF identification and quantification across 33 cancers, abnormally expressed tRFs and genes, tRF-gene correlations, tRF-gene networks, survival analyses, and tRF-related functional enrichment analyses. Users are also able to identify differentially expressed tRFs, predict their functions, and assess the relevance of the tRF expression levels to the clinical outcome according to user-defined groups. Additionally, an online Kaplan-Meier plotter is available in OncotRF for plotting survival curves according to user-defined groups. OncotRF will be a valuable online database and functional annotation tool for researchers studying the roles, functions, and mechanisms of tRFs in human cancers.

Introduction

High-throughput deep sequencing technologies have led to the discovery of a wide spectrum of small non-coding RNA species. Although some of these have been well-characterized, such as microRNAs (miRNAs) and Piwi-interacting RNAs, most are not fully understood [1]. Initially, transfer RNA-derived fragments (tRFs) were considered to be tRNA degradation products. Upon further analysis, these sequence reads were recognized as being abundant, with recurring sequences, suggesting the existence of a novel class of small RNAs. Generally, at least six types of tRFs have been defined based on their cleavage sites in tRNAs: 5ʹ-and 3ʹ-halves (>30 nt), 5ʹ- and 3ʹ-tRFs (15–30 nt), i-tRFs and 3ʹU-tRFs (also named as tsRNAs) [2-4]. Several recent studies have shown that tRFs regulate gene expression at multiple levels [2,3]. Emerging evidence has demonstrated that tRFs have biological functions through the regulation of various cellular processes at both post-transcriptional and translational levels [5]. They can regulate RNA silencing [6], long terminal repeat retrotransposons [7], ribosome biogenesis [8], viral infections [9,10], and translation [11,12]. Additionally, some parental sperm tRFs contribute to an offspring’s metabolism [13,14].

tRFs are abundant and conserved across species [15]. They are derived from mature or precursor tRNAs by specific cleavage. Recently, tRFs were found to play important roles in cancer development and progression through the regulation of cell proliferation, invasion, metastasis, and gene expression [16]. Aberrantly expressed tRFs have the potential to serve as diagnostic biomarkers and therapeutic targets in cancer treatments [15,16]. For example, tRF-1001 was the first reported tRF to modulate cell proliferation in prostate cancer [3]. CU1276 was shown to function similar to a miRNA and suppress proliferation in B cell lymphoma [17]. SHOT-RNAAsp-GUC, SHOT-RNAHis-GUG, and SHOT-RNALys-CUU are sex hormone-dependent tRNA halves that promote cell proliferation in breast and prostate cancers [18]. 5ʹ-halves from tRNAGlu, tRNAAsp, tRNAGly, and tRNATyr can bind to oncogenic protein YBX1 competitively with pro-oncogenic transcripts, resulting in inhibition of tumour metastasis in breast cancer cells [19]. However, the mechanism of action of tRFs and their role in cancer development and progression remains largely unexplored.

Currently, only two databases have been constructed for tRFs in humans [20]. tRFdb is a database that contains the sequences and read counts of tRFs from eight species [21]. MINTbase is a repository with tRF information that arises from nuclear and mitochondrial tRNAs [22]. There is another web server named tRF2 Cancer, which can be used for identifying tRFs from small RNA sequencing datasets and it contains tRF expression information from various cancer types [23]. However, these databases only contain tRF expression across cancer types or focus on the identification of tRFs from small RNA-sequencing data. There is currently no database which includes information regarding dysregulated tRFs, the potential functions of these tRFs in cancers, the gene network they may participate in, their clinical and functional relevance to cancers, and whether they are validated by other low throughput methods.

To fill this gap, we constructed a comprehensive tRF database named OncotRF (Fig. 1). With this database, we aim to provide the most comprehensive tRF resource in human cancers and include large-scale integration of small RNA sequencing, RNA sequencing, clinicopathologic datasets from The Cancer Genome Atlas (TCGA), chemical modification sites on their parental tRNAs, and validated literature manually curated from PubMed. OncotRF is a valuable online resource for identifying diagnostic and prognostic biomarkers, developing cancer therapeutic targets, and studying cancer pathogenesis. It is of great interest to cancer and RNA biology fields.

Figure 1.

Schematic representation of data processing and flowchart of OncotRF construction.

Results

OncotRF contains 11,211 small RNA sequencing samples, 8776 RNA sequencing samples, and clinicopathologic annotation data from TCGA. It adopts a highly conserved filtering strategy in which only the tRFs with 10th quantile reads per million (RPM) >1 were retained in the reported candidate list, which was widely used in miRNA studies and other non-coding RNA studies [24,25]. As a result, 6966 abundant tRFs derived nuclear and mitochondrial tRNAs were detected in OncotRF, including 992 5ʹ-tRFs, 799 3ʹ-tRFs, 271 3ʹU-tRFs and 4933 i-tRFs (Table 1). Based on these datasets, OncotRF provides five main functions to retrieve various data records, including ‘Search’, ‘Cancer’, ‘Custom’, ‘KM-plotter’, and ‘JBrowse’. Various graphical visualization pages are also provided to display the tRF analysis results. From the website, users can retrieve the following data records regarding tRFs: (i) detailed information of each tRF and its expression among different cancer types; (ii) validation information, if available; (iii) differential expression analysis of tRFs and mRNAs between tumour and normal tissues; (iv) genes associated with tRFs; (v) regulatory network; (vi) functional analysis; (vii) survival analysis; (viii) tRF modifications; and (ix) Kaplan-Meier survival curves. We also allow researchers to identify differentially expressed tRFs and provide an online Kaplan-Meier plotter according to two user-defined groups.

Table 1.

Summary of TCGA samples used in the study and 5ʹ-tRFs, 3ʹ-tRFs,3ʹU-tRFs and i-tRFs identified in the study.

Cancer Types	Sample size				Number of tRFs*				tRF Average Expression (RPM)
	miR-seq		RNA-seq		5ʹ-tRFs	3ʹ-tRFs	3ʹU-tRFs	i-tRFs	5ʹ-tRFs		3ʹ-tRFs		3ʹU-tRFs		i-tRFs
	Normal	Tumour	Normal	Tumour					Normal	Tumour	Normal	Tumour	Normal	Tumour	Normal	Tumour
ACC	0	80	0	0	501	235	102	1591	NA	11688	NA	4603	NA	1332	NA	18880
BLCA	19	418	17	301	461	237	76	1030	522	6833	497	2121	104	345	955	6017
BRCA	104	1102	113	1064	577	316	91	1363	3414	11402	2092	2750	316	504	4305	9828
CESC	3	308	3	261	557	281	97	1442	917	11639	606	2607	113	423	1327	11076
CHOL	8	36	0	0	377	185	71	843	12519	4324	2572	1206	500	342	6092	4159
CNTL	112	0	0	0	551	280	63	694	6265	NA	2610	NA	292	NA	2774	NA
COAD	1	446	41	453	628	393	119	1736	5832	7763	3899	4130	976	715	2206	11420
DLBC	0	47	0	0	580	357	112	1651	NA	12541	NA	2929	NA	606	NA	9320
ESCA	13	187	0	0	464	191	76	1121	2208	9521	1261	1539	322	327	1814	7075
GBM	0	5	0	166	338	250	92	1144	3589	NA	2721	NA	553	NA	5930	NA
HNSC	44	525	42	482	626	403	104	1732	6674	13675	8379	4117	757	460	11119	12588
KICH	25	65	0	0	432	280	79	1153	4896	9312	1567	4476	412	1130	5560	7468
KIRC	71	544	72	526	519	319	84	1199	8251	8798	2851	2913	641	429	9783	6928
KIRP	34	292	32	222	418	257	76	882	6766	5099	2423	2913	624	875	9019	6454
LAML	0	191	0	173	755	577	220	3298	NA	14229	NA	12815	NA	2670	NA	27673
LGG	0	530	0	453	460	269	92	1124	NA	9055	NA	2002	NA	320	NA	5917
LIHC	50	375	48	297	482	289	86	1166	14143	8717	5934	3649	759	666	15178	8268
LUAD	46	521	55	488	469	330	69	1017	1916	5742	2466	2970	268	401	2338	4942
LUSC	45	478	45	428	614	362	94	1611	3391	10699	2019	3246	216	442	3453	10265
MESO	0	87	0	0	439	174	76	916	NA	12810	NA	907	NA	274	NA	4642
OV	0	499	0	265	375	402	99	1082	NA	10152	NA	8407	NA	493	NA	7507
PAAD	4	179	3	142	288	143	40	466	2822	2456	1087	687	271	173	1827	1732
PCPG	3	184	0	0	248	139	61	680	13334	3859	3484	955	553	284	18051	3699
PRAD	52	499	52	379	366	212	49	988	2041	6482	1675	1985	96	175	3081	6984
READ	0	160	9	154	664	395	116	1863	NA	8979	NA	3621	NA	732	NA	12740
SARC	0	263	0	0	308	151	55	654	NA	4043	NA	678	NA	158	NA	2649
SKCM	2	450	1	433	749	701	138	2547	5171	22597	4188	13301	534	1009	6392	20000
STAD	45	446	35	415	467	241	70	997	2545	4935	1115	1526	234	315	1877	5089
TGCT	0	156	0	0	539	247	114	1373	NA	18264	NA	2040	NA	599	NA	9003
THCA	79	540	58	508	547	338	96	1435	17057	10478	6791	4977	594	1032	11702	12670
THYM	2	123	0	0	389	192	78	912	5375	7991	1642	1262	288	392	3795	5316
UCEC	33	545	23	517	605	330	89	1632	4508	18719	2236	3115	336	576	5058	13612
UCS	0	55	0	0	559	172	81	1342	NA	24084	NA	1194	NA	355	NA	9374
UVM	0	80	0	0	511	478	109	1391	NA	8595	NA	7941	NA	1024	NA	11367
Total	795	10416	649	8127	992	799	271	4933

*number of tRFs identified in the study after the filtering. NA, not available.

ACC, Adrenocortical carcinoma; BLCA, Bladder Urothelial Carcinoma; BRCA, Breast Invasive Carcinoma; CESC, Cervical Squamous Cell Carcinoma; CHOL, Cholangiocarcinoma; CNTL, Controls; COAD, Colon Adenocarcinoma; DLBC, Lymphoid Neoplasm Diffuse Large B-cell Lymphoma; ESCA, Oesophageal carcinoma; GBM, Glioblastoma multiforme; HNSC, Head and Neck Squamous Cell Carcinoma; KICH, Kidney Chromophobe; KIRC, Kidney Renal Clear Cell Carcinoma; KIRP, Kidney Renal Papillary Cell Carcinoma; LAML, Acute Myeloid Leukaemia; LGG, Lower Grade Glioma; LIHC, Liver Hepatocellular Carcinoma; LUAD, Lung Adenocarcinoma; LUSC, Lung Squamous Cell Carcinoma; MESO, Mesothelioma; OV, Ovarian Serous Cystadenocarcinoma; PAAD, Pancreatic adenocarcinoma; PCPG, Pheochromocytoma and Paraganglioma; READ, Rectum adenocarcinoma; SARC, Sarcoma; SKCM, Skin Cutaneous Melanoma; STAD, Stomach Adenocarcinoma; TGCT, Testicular Germ Cell Tumours; THCA, Thyroid Carcinoma; THYM, Thymoma; UCEC, Uterine Corpus Endometrial Carcinoma; UCS, Uterine Carcinosarcoma; UVM, Uveal Melanoma.

tRF data search

OncotRF provides an easily searchable interface and can be queried through the tRF ID, tRF type, sequence, source tRNA name, anti-codon, genomic locus, and aliases from the literature. The results returned from the search are organized in an HTML table, listing the detailed information of tRFs including tRF ID, tRF type, source tRNAs, genome loci (hg19), tRF length, sequence, and links to the three additional pages (‘Expression’, ‘Alignment & Modification’, and ‘Validation’ pages). To demonstrate the search function, we took 3ʹ-M-tRNA-Gly-GCC-2-6_L22 (also known as CU1276 and tRF-3018) as an example in Fig. 2 because it was a previously reported 3ʹ-tRF that functions similar to a miRNA and suppresses proliferation in B cell lymphoma [17]. When ‘3ʹ-M-tRNA-Gly-GCC-2-6_L22’ is searched, a detailed page will be displayed as Fig. 2A. If a tRF sequence can be also mapped to non-tRNA regions, its associated chromosomes and regions will also be provided. For example, ‘5ʹ-tRNA-Ala-AGC-6-1_L24’ can be derived from tRNA ‘tRNA-Ala-AGC-6-1’ (tRF: chr6:28779897-28779920(-)), but can also be mapped to a non-tRNA region on chromosome 10 (chr10:125664644-125664667(-)). Furthermore, these tRF IDs will be highlighted in bold red, and a note will be shown at the top of the search table, warning the possibility of false positiveness.

Figure 2.

Search functions of OncotRF. (A) Search result of 3ʹ-M-tRNA-Gly-GCC-2-6_L22. (B) 3ʹ-M-tRNA-Gly-GCC-2-6_L22 expression in cancers. (C) Validation result of 3ʹ-M-tRNA-Gly-GCC-2-6_L22. (D) 3ʹ-M-tRNA-Gly-GCC-2-6_L22 alignment with tRNA-Gly-GCC-2-1, its position on the secondary structure of tRNA-Gly-GCC-2-1, and possible modifications of tRNA-Gly-GCC-2-1 from MODIFICS database.

The ‘Expression’ page includes a boxplot of the tRF expression for each cancer and an expression table of the searched tRF in cancers. As shown in Fig. 2B, the expression table displayed the median expression of 3ʹ-M-tRNA-Gly-GCC-2-6_L22 in tumour samples (‘Median Expression of Tumor (RPM)’) and normal samples (‘Median Expression of Normal (RPM)’), the number of tumour samples (‘Tumor Samples (RPM>1)’) and normal samples (‘Normal Samples (RPM>1)’) with RPM>1, total number of tumour samples (‘Total Tumor Samples’), total number of normal samples (‘Total Normal Samples’) and total number of samples (‘Total Samples’) (Fig. 2B).

The ‘Alignment & Modification’ page provides a visualization of the tRF on the secondary structure of the source tRNA, including possible modifications (Fig. 2C). As shown in Fig. 2C, 3ʹ-M-tRNA-Gly-GCC-2-6_L22 can be derived from the tRNA ‘tRNA-Gly-GCC-2-1’ on which ten nucleotides are potentially modified based on the information from MODOMICS database. Users can click the link of the nucleotide in blue for the detailed information about its modification. Such modifications may play a role in the tRF function and biogenesis in cancers [26].

The ‘Validation’ page will also be provided if any reports regarding the searched tRF are published in PubMed. For example, a recent study showed that ‘3ʹ-M-tRNA-Gly-GCC-2-6_L22’, alias ‘CU1276’ and ‘tRF-3018’, is down-regulated in B cell lymphoma and possesses a miRNA-like function [17]. As shown in Fig. 2D, the information regarding this research article will be displayed by clicking the ‘Validation’ link in Fig. 2A. Five terms can be viewed in this page, including the tRF name in the literature (alias), cancer, expression pattern, PubMed ID, and description of the functions. Users can easily access the literature through the link of the PubMed ID.

We also provide a keyword search in ‘Search’ page, such as tissue ‘bladder’, cancer type ‘bladder cancer’ or gene symbol ‘CALD1’. For tissue or cancer type, OncotRF will return the links to i) tRF expression in corresponding cancers, similar to the table shown in Fig. 2B; ii) differential expressed tRFs, mRNAs, and functional analysis; and iii) survival analysis results (similar to Fig. 3). For example, if users search keywords ‘bladder cancer’, a page shown in Fig. S1 will be displayed. For gene symbol ‘CALD1’, OncotRF will return a table of tRFs which are significantly related to the searched gene in each cancer (Fig. S2). Detailed usage can be found in the ‘Help’ web page of OncotRF (http://bioinformatics.zju.edu.cn/OncotRF/Pages/Help.html).

Figure 3.

Cancer functions. (A) Differentially expressed 3ʹU-tRFs in BLCA. (B) Differentially expressed mRNAs in BLCA. (C) Correlation analysis of tRFs and mRNAs in BLCA. tRF-mRNA pairs with their absolute correlation coefficients > 0.4 (i.e., |r|>0.4) were presented. (D) Network analysis of differentially expressed tRFs and mRNAs in BLCA. tRF-mRNA pairs with |r|>0.4 in Figure 3 C were subjected to network analysis. (E) Functional enrichment analysis of genes that are co-expressed with 3ʹ- U-tRFs (|r|>0.4). (F) Survival analysis of differentially expressed 3ʹU-tRFs in BLCA.

Analysis of cancer-related tRFs

A key feature of OncotRF is the comprehensive display of cancer-related tRFs. Users can browse this information by clicking the tree navigation bar on the left (e.g. ‘Differential Expression Analysis’ – ‘BLCA’ – ‘3ʹU-tRF’). The differentially expressed tRFs and mRNAs between tumour and normal tissues were calculated using Wilcoxon rank-sum test with default parameters [27] and filtered by the absolute value of Log2FoldChange > 1 and Pvalue < 0.05. The result tables display the mean expression of the tRF or mRNA in tumour and normal tissues, Log2FoldChange, Pvalue, and Qvalue when comparing tumour and normal tissues (Fig. 3A, B). The tables can be reordered by clicking the ‘up and down arrows’ next to the column names. Users can also filter the content by keyword search in the top, right corner of each table. For example, users can enter a tRF ID such as the first tRF in the result table ‘3ʹU-mito-tRNA-Val-TAC_L20’ in the ‘Search’ box of the ‘Differential Expressed tRFs in BLCA’ table (Fig. 3A), and then only the information including ‘3ʹU-mito-tRNA-Val-TAC_L20’ will be displayed in the table. It is useful for users to quickly identify a particular tRF when there are a very large number of records in the table.

To predict the potential function of tRFs, we calculated the association between tRFs and mRNAs, and took 3ʹU-tRFs and BLCA as an example (Fig. 3C). This prediction method is commonly based on ‘guilt-by-association’ from co-expression patterns [28], namely tRFs share similar functions with their co-expressed mRNAs. In our database, tRF and mRNA are treated as a strong relationship, if their absolute correlation coefficients exceed 0.4; whereas, they are treated as a weak relationship, if their absolute correlation coefficients are smaller than 0.4. Users can change this default threshold according to their research design and aim. Strong tRF-mRNA relationships, whose absolute correlation coefficients exceed 0.4, are organized as a network using Cytoscape [29] (Fig. 3D). Hub genes or tRFs (e.g., 3ʹU-mito-tRNA-Val-TAC_L22) that have a high degree of intra-module connectivity can be identified in the network. If there are too many tRF-mRNA pairs whose absolute correlation coefficients exceed 0.4, it will be difficult for the user’s web browser to display the correlation table (Fig. 3C) and network (Fig. 3D). Under this circumstance, OncotRF will automatically increase the correlation threshold and display the correlation table (Fig. 3C) and network (Fig. 3D) with their absolute correlation coefficients exceeding 0.5 or greater. Users can download the large correlation table and network when there are too many tRF-mRNA pairs with smaller correlation thresholds, and view them using Cytoscape [29] or text editor locally. The filtered mRNAs interacting with tRFs were further functionally analysed using KOBAS 3.0 to predict the cancer tRF-mediated pathways (Fig. 3E), incorporating four pathway databases (KEGG PATHWAY, BioCyc, Reactome and PANTHER) and two human disease databases (OMIM and KEGG DISEASE). Significantly enriched Gene Ontology (GO) terms can also be identified and displayed (p-value < 0.05). Each table displays the pathway/disease terms (Term), databases names (Database), pathway ID (ID), the number of genes that are co-expressed with tRFs in the pathway or disease category (Input Number), total number of genes involved in a particular pathway or disease category in human genome (Background Number), Pvalue and Qvalue. A p-value or q-value < 0.05 is statistically significant. Users can view the detailed information by clicking the link of the pathway term. For example, by clicking the first term ‘Vascular smooth muscle contraction’ in Fig. 3E, a pathway graph will be shown in Fig. S3. The box with red background indicates genes which are significantly associated with those abnormally expressed tRFs.

The survival analyses of tRFs in a specific cancer type are also displayed (Fig. 3F). Three types of survival outcomes were included in the results including overall survival (OS), disease-free survival (DFS), and relapse-free survival (RFS). OS is the length of time that the patients survive from either the date of diagnosis or the start of treatment. DFS is the length of time following treatment during which no disease is found. RFS is the length of time between when a primary treatment for a cancer ends and the patient survives without any signs or symptoms of that cancer. As shown in Fig. 3F, each table displays six columns: tRF IDs (tRF_ID), the p-value (Logtest pvalue) and q-value (Logtest qvalue) of log-rank test, hazard ratio (HR), lower 95% confidence interval (Lower), and upper 95% confidence interval (Upper).

The survival analysis of a specific tRF in all cancers and Kaplan-Meier plots for each cancer type can also be obtained by clicking the lower left navigation bar ‘Survival Analysis’ (e.g. ‘Survival Analysis’ – ‘tRF’ – ‘3ʹU-tRF’ – ‘3ʹU-M-mito-tRNA-Tyr-GTA_L20’). In default survival analysis, the patients are divided into two groups with higher or lower expression according to the median of tRF expression. For each tRF, we took ‘3ʹU-M-mito-tRNA-Tyr-GTA_L20’ (the first tRF of 3ʹU-tRF in the navigation bar) as an example. By clicking ‘Survival Analysis’ – ‘tRF’ – ‘3ʹU-tRF’ – ‘3ʹU-M-mito-tRNA-Tyr-GTA_L20’, three types of survival analysis results of this tRF in each cancer, if available, will be displayed in tables, and Kaplan-Meier curves will be also displayed (Fig. S4). For each cancer type, we took ‘ACC’ as an example. By clicking ‘Survival Analysis’ – ‘Cancer Type’ – ‘ACC’, four tRF types will be displayed. Then clicking ‘3ʹU-tRF’, the survival analysis results of all the 3ʹU-tRFs which can be detected in ACC will be displayed in tables (Fig. S5). The only difference of this table from Fig. 3F is that the table displays all the 3ʹU-tRFs detected in ACC rather than only the tRFs that differentially expressed between tumour and normal tissues (Fig. S5).

tRFs custom analysis

Another key function of the database is its ability to analyse differentially expressed tRFs between two user-defined groups. Users can filter the datasets by clinical criteria such as cancer subtype, tissue type, gender, age at diagnosis, vital status, days to death, race, or ethnicity (Fig. 4A). For example, if we want to compare the difference in tRF expression in tumours between men and women, we can choose the parameters as shown in Fig. 4A. By clicking ‘GO’ in Fig. 4A, the results of differentially expressed tRFs between the two user-defined groups will be displayed in Fig. 4B when the analysis is completed.

Figure 4.

Custom functions. (A) Clinical criteria and other parameters for custom functions. (B) tRF differences between two customized groups as defined in (A).

KM-plotter

The discovery of prognostic biomarkers is an important task in cancer research. This section can estimate the prognostic value of any selected tRFs in a large cohort of clinical patients. In order to analyse the association between a queried tRF and survival, the samples are separated into two groups according to the mean, median, or other quartile expressions of the selected tRF. Then, the two groups are compared using a Kaplan-Meier plot. Before running the analysis, the patients can be filtered using age, AJCC stage, gender, race, or ethnicity (Fig. 5A). Additionally, three types of survival (i.e., OS, DFS, and RFS) can be chosen. The patients are divided into two groups with higher or lower expression according to the split cut-off (such as mean, median, etc). The log-rank test is performed to evaluate statistical differences in survival between the two groups. Taking ‘3ʹ-M-tRNA-Gly-GCC-2-6_L22’ as an example, a web page as shown in Fig. 5B will be displayed, including the parameters users chose and a survival curve in ‘png’ format. A ‘pdf’ format of high resolution survival curve can be downloaded by click ‘PDF’ link.

Figure 5.

Kaplan-Meier plotter. (A) Choosing plot parameters for the overall survival analysis of 3ʹ-M-tRNA-Gly-GCC-2-6_L22 in ACC. (B) Survival curves of 3ʹ-M-tRNA-Gly-GCC-2-6_L22 in ACC.

JBrowse

The JBrowse genome browser [30], a javascript-based genome browser, is a useful tool for inspecting sequences and locations in a visual way. We configured JBrowse in OncotRF to display tRF, tRNA, and mRNA sequences in the genome (hg19) (Fig. S6). Users can view the position of these tRFs, tRNA or genes on the genome as well as the upstream and downstream of tRFs, tRNA or genes. A pop-up will show details of the tRF, tRNA or gene name in the genome when users click on the tRF, tRNA or gene name. For example, by clicking the tRF ‘i-tRNA-Thr-CGT-chr1-118_L21_pos112’ in red box, a pop-up of the tRF will be shown in the middle of the screen (Fig. S6).

Case analysis

Bladder urothelial carcinoma (BLCA) is a major cause of morbidity and mortality worldwide, causing an estimated 150,000 deaths per year [31]. To identify 3ʹU-tRFs which are potentially involved in BLCA, we first examined OncotRF using the ‘Cancer’ function. After clicking ‘Differential Expression Analysis’, ‘BLCA’, and ‘3ʹU-tRF’ on the menu, a detailed webpage was shown on the right screen. Abnormally expressed tRFs and genes were organized into tables (Fig. 3A, B). Based on these differential expression tables, the correlations between 3ʹU-tRFs and mRNAs were estimated in Fig. 3C and subsequently visualized in Fig. 3D. Next, OncotRF performed a functional enrichment analysis of genes that are co-expressed with 3ʹU-tRFs in the correlation table. As the functional results showed in Fig. 3E, the related tRFs and genes were involved in multiple KEGG pathways such as ‘Vascular smooth muscle contraction’, ‘Dilated cardiomyopathy’, ‘Hypertrophic cardiomyopathy (HCM)’, and ‘Focal adhesion’. We took ‘Vascular smooth muscle contraction’ as an example, which was the most significant KEGG pathway enriched in 3ʹU-tRF-related genes. Then, we focused on dysregulated genes that potentially participate in this pathway. By clicking the link of the term ‘Vascular smooth muscle contraction’, a pathway graph will be shown as in Fig. S3. The box with red background indicates genes which are significantly correlated with these aberrantly expressed 3ʹU-tRFs. Based on prior knowledge, CALD1 encodes a calmodulin- and actin-binding protein that plays an essential role in the regulation of smooth muscle and nonmuscle contraction [32]. By clicking the red box ‘CaD’, a web page including the gene name of ‘CaD’ will be shown in Fig. 7SA. In order to filter the related 3ʹU-tRFs and the information of ‘CALD1’, copy the gene name ‘CALD1’ and enter it to the ‘Search box’ on the top right corner of ‘Correlation Analysis in BLCA’ table and ‘Differential Expressed mRNAs in BLCA’. As shown in Fig. S7B-C, six 3ʹU-tRFs were highly correlated with ‘CALD1’, and the expression of CALD1 was significantly differentially expressed between BLCA tumour tissues and normal tissues (Log2FoldChange = −1.629, P = 3.009 × 10−5). Among them, ‘3ʹU-mito-tRNA-Val-TAC_L22’ was the most negatively correlated with ‘CALD1’. It was also significantly upregulated in BLCA tumours (Log2FoldChange = 2.396, P = 1.995 × 10−9) (Fig. S7D). Taken together, these results generated a testing hypothesis for users: ‘3ʹU-mito-tRNA-Val-TAC_L22’ is a potential oncogenic regulator in BLCA through its negative regulation of ‘CALD1’ in the ‘Vascular smooth muscle contraction’ pathway.

Discussion

OncotRF is a comprehensive catalogue for dysregulated tRFs across human cancers. It provides several prominent features that were previously either naïvely obtained or unattainable using existing databases [21,22].

First, OncotRF provides an integrated view of dysregulated tRFs among cancers. Users can retrieve the median expression levels in tumour and normal tissue groups, fold changes, p-values, and false discovery rates for differential expression analysis of dysregulated tRFs in each cancer type. Our custom analysis can also detect differential expression of tRFs between two customized groups. Users can specify different clinical parameters such as sex through the ‘Custom’ page, allowing to identify sex-dependent tRFs in cancer. These dysregulated tRFs are relatively stable due to their own chemical modification, and thereby can serve as promising biomarkers for cancer diagnosis and potential new targets for cancer treatment. This resource also serves as a starting point for users to study tRF gene regulation and functional roles in cancers.

Second, OncotRF provides comprehensive functional annotations of dysregulated tRFs among cancers. Studies of tRF functions have been problematic due to a lack of ‘a priori’ knowledge. Therefore, we integrated TCGA RNA-seq datasets with these dysregulated tRFs to allow functional correlation analyses between tRFs and mRNAs. Enrichment analyses of mRNAs co-expressed with dysregulated tRFs can then be performed using multiple annotation categories including GO terms, bio-pathways, and disease associations. Additionally, the regulatory network of tRFs and genes can be visualized online. Based on the functional enrichment results, the potential functions of tRFs can be predicted from their co-expression patterns, namely tRFs share similar functions with their co-expressed mRNAs. This resource provides new insights into dysregulated tRFs and helps users to design their experiments and generate testable hypotheses to study the molecular mechanisms of tRFs in cancers.

Third, OncotRF provides the clinical relevance of these dysregulated tRFs to cancers. Comprehensive clinicopathologic annotation data from TCGA were integrated into the database, along with the dysregulated tRFs for performing survival analysis. An online Kaplan-Meier plotter was also provided as an individual module. The user-friendly interface and additional parameters, such as adjusting for clinical variables like tumour stage and size, were included in the design for plotting survival curves with hazard ratios and log-rank p-values. This function can evaluate the prognostic value of any selected tRFs in a large cohort of clinical patients. This resource helps users to identify promising prognostic biomarkers and new relevant targets for cancer therapy in their clinical investigations.

It is also worth noting that the number of tRFs detected in our OncotRF database is smaller than previously reported in the TCGA datasets [21-23]. This is largely attributed to the different filtering approaches utilized to address low-expression tRFs. For instance, those tRFs that exceeded a normalized abundance of 1 RPM in one sample of each cancer type were retained in MINTbase [22]. However, we adopted a highly conserved strategy in which only the tRFs with the 10th quantile RPM > 1 were included in our reported candidate list, which has been used widely in miRNA and other non-coding RNA studies [24,25]. The robust tRF list obtained led to unbiased findings in our downstream analysis.

Several study caveats should be acknowledged. First, since most small RNA sequencing datasets contain transcripts that are smaller than 30 nts, tRNA halves were not examined. RNA sequencing from total RNA with rRNA depletion or polyA (-) samples may complement this resource. Second, chemical modifications may prematurely terminate cDNA synthesis during library preparation for sequencing. This may affect the detection and quantification of tRFs. Some newly developed methods may overcome this obstacle such as AlkB-facilitated RNA methylation sequencing (ARM-seq) [33]. Therefore, we will collect more ARM-seq-like datasets and improve our pipeline for a full characterization of cancer-related tRFs. Third, tRNA annotation in the human genome is incomplete. It is unclear whether currently unannotated genomic regions similar to the tRNA sequences are true tRNAs, truncated tRNAs, or unrelated to tRNAs entirely. Mapping to the whole genome would result in ambiguity about the origin of many reads [34,35]. In our study, approximately 63% (4410/6966) of the detected tRFs were mapped to the tRNA space as well as to other non-tRNA locations of the genome with unknown transcript statuses. If these sequences were discarded, we would exclude a large number of tRFs that are potentially involved in cancers, thereby running into the risk of greatly inflating the false negative rates. On the contrary, if these reads are retained, a number of multi-mapped reads would be treated as tRFs, thereby running the risk of inflating the false positive rates. The resulting false positive rate is relatively low because the current tRNA annotation of the human genome is incomplete and only the transcribed genome (e.g., small RNAs) is made for sequencing libraries. However, further investigations are required to develop probabilistic models to assign these tRF multireads to their most likely locations using prior information hidden in the genome (e.g., transcript status inferred from the NIH Roadmap Epigenomics Program[36]). We look forward to further updating our database once such new tools are available.

Conclusions

In summary, OncotRF is a valuable online resource for identifying diagnostic and prognostic biomarkers, developing cancer therapeutic targets, and studying cancer pathogenesis. It is of great interest to cancer and gene regulation fields. It provides several prominent features over currently existing databases including information about dysregulated tRFs and their clinical and functional relevance to cancers. We will continue to expand the number of small RNA-seq datasets in our database allowing for more comprehensive functional analyses of cancer-related tRFs. Furthermore, we will continue to increase the database functionality and optimize the organization and layout of our site to improve the user experience and usability.

Methods

Data collection

The data processing and flow chart for constructing the database are shown in Fig. 1. The BAM files of 11,211 small RNA sequencing samples were downloaded from the Genomic Data Commons (https://portal.gdc.cancer.gov/). The mRNA expression profiles of 8776 RNA sequencing samples, and the corresponding patient clinical information, including survival time, age, tumour stage, and tumour grade were downloaded from the International Cancer Genome Consortium (ICGC) Data Portal (http://dcc.icgc.org) (Table 1). Human genome (hg19) gene annotations and corresponding sequences of 610 nuclear tRNA genes in humans were downloaded from GtRNAdb (http://gtrnadb.ucsc.edu) [37]. The sequences and positions of 22 mitochondrial tRNA genes were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/nuccore/251831106) and named as ‘mito-tRNA-amino acid abbreviations-anticodon’. For example, ‘mito-tRNA-Val-TAC’ indicates mitochondrially encoded tRNA valine (Val) with anticodon ‘TAC’. tRNA modification information was retrieved from MODOMICS database (http://modomics.genesilico.pl/) [38]. MODOMICS manually curated tRNAs with experimentally validated modified nucleosides.

tRF identification and characterization

A bank of non-redundant tRFs of 15 to 30 nts in length was created. ‘CCA’ was added to the 3ʹ end of mature tRNA sequences, resulting in the CCA-tRNA annotation. All sequences with 15 to 30 nts were enumerated from the 5ʹ or 3ʹ end of these CCA-tRNA sequences. Identical sequences were further merged, and 4,894 and 5,260 unique sequences from the 5ʹ and 3ʹ end (5ʹ-tRFs and 3ʹ-tRFs respectively) of CCA-tRNAs were retained. 271,287 unique i-tRFs sequences were extracted from the body of CCA-tRNAs. Additionally, a 50-nt downstream sequence at the 3ʹ end of each non-CCA tRNA was obtained using bedtools, resulting in the pre-tRNA annotation (https://bedtools.readthedocs.io/en/latest/). In the same way as above, all 15 to 30-nt sequences from the 3ʹ end (3ʹ U tRFs) of pre-tRNAs were selected and then identical sequences were collapsed, yielding 9,103 unique sequences. In total, we built a tRF annotation database with 290,457 candidate tRF sequences with unique identifiers.

As shown in Fig. S8, each class of tRFs in our tRF annotation database starts with a unique class identifier (i.e., 3ʹ U-tRFs start with 3ʹU-, 5ʹ-tRFs start with 5ʹ-, 3ʹ-tRFs start with 3ʹ- and i-tRFs start with i-). The tRFs that are derived from more than one tRNA gene are assigned an identifier ‘-M’ next to the class identifier. The tRNA gene identifier is retrieved from GtRNAdb tRNA id (e.g. tRNA-Ala-AGC-3-1) or mitochondrial tRNA id (e.g. mito-tRNA-Val-TAC). The next identifier is the length of tRF sequence, such as ‘L16ʹ means the tRF is 16 nucleotides in length. For i-tRFs, there is one more identifier which indicates position of the first nucleotide on the source tRNA. For example, ‘3ʹ-M-tRNA-Ala-AGC-3-1_L20’ indicates this tRF is 3ʹ-tRF and can be derived from at least two tRNA genes (one of these source tRNAs is ‘tRNA-Ala-AGC-3-1’). If a sequence belongs to two or more types of tRFs, the following priorities for naming this tRF sequence are applied: 5ʹ-tRF > 3ʹ-tRF > 3ʹ U tRFs > i-tRF. For example, ‘GAGAAAGCTCACAAGAACTGC’ is not only derived from 5ʹ end of mature mitochondrial tRNA mito-tRNA-Ser-GCT, but also derived from pre-mature mitochondrial mito-tRNA-His-GTG. According to the above naming priorities, this sequence is termed as ‘5ʹ-M-mito-tRNA-Ser-GCT_L21’. Detailed nomenclature of tRFs can be found in the ‘Help’ web page.

The small RNA sequencing reads were remapped to the human genome (hg19), and sequences of our tRF annotation database using Burrows-Wheeler Transform (BWA) [39], allowing for no mismatch per read. Next, the remapped reads were used to count the number of reads belonging to each of the candidate tRFs (Table 1). Other non-tRNA genome locations to which the tRF candidates were potentially mapped were fetched by samtools [40]. These non-tRNA loci are likely a part of tRNA-lookalikes that harbour sequences resembling known tRNAs [41,42]. Finally, the expression of the tRFs was calculated as reads per million (RPM) of total mapped reads, which has been commonly used in miRNA analyses [24,25]. To obtain robust tRFs, we filtered out the tRFs with 90th quantile RPM < 1, and those remaining were considered detectable tRFs for each cancer type. Prior to the downstream analysis, the tRFs expression was transformed using log2, and was normalized by the upper quantile across samples, and then was adjusted for potential batch effects with sequencing plates as covariates using ComBat [43].

tRFs on tRNA secondary structures

tRNA secondary structures were predicted using the tRNA covariance model of tRNAscan-SE 2.0 [44] and visualized using forna [45].

Differential expression analysis

To compare the expression profile patterns of tRFs and mRNAs between tumour and normal samples in TCGA, we utilized cancer types with at least 15 normal samples. Differentially expressed tRFs were defined as those with pvalues < 0.05 (i.e., p-values < 0.05, obtained using the Wilcoxon rank-sum test) and fold change of expression between tumour and normal samples > 2 or < 0.5 (i.e., the absolute value of Log2FoldChange > 1). Qvalue are corrected p-values with Benjamini-Hochberg (BH) method.

Correlation analysis and network display

Pearson correlation was estimated for each pair of significantly differentially expressed tRFs and mRNAs. Two-sided t-test was used for hypothesis test. The correlation coefficients exceeding a threshold (default as |r| > 0.4) were organized as a network using Cytoscape (v3.7.2) [29].

Enrichment analysis

KOBAS 3.0 [46] was used for identification of enriched pathways and diseases, including four pathway databases (KEGG PATHWAY, BioCyc, Reactome, and PANTHER) and two human disease databases (OMIM and KEGG DISEASE). Enriched pathways in KOBAS were detected using a hypergeometric test. Enriched Gene Ontology (GO) terms and KEGG DISEASE categories were evaluated using Fisher’s exact test.

Survival analysis

Kaplan-Meier curves were plotted using the R survival package [47] and the log-rank test was used to evaluate statistical differences in survival between groups. All statistical analyses were performed using R Statistical Software (version 3.6.2) (https://www.r-project.org/).

Validated tRFs

Experimentally validated tRFs with roles in cancer were manually curated from PubMed using keyword searches such as ‘transfer RNA-derived RNA fragments cancer’, ‘tRNA-derived RNA fragments cancer’, ‘transfer RNA-derived RNA fragments tumor’, ‘tRNA-derived RNA fragments tumor’, ‘tRF cancer’, and ‘tRF tumor’.

Click here for additional data file.