| Literature DB >> 32573327 |
Khosbayar Lkhagvadorj1,2,3, Karolin F Meyer1,2, Laura P Verweij1,2, Wierd Kooistra1,2, Marjan Reinders-Luinge1,2, Henk W Dijkhuizen4, Inge A M de Graaf5, Torsten Plösch6, Machteld N Hylkema1,2.
Abstract
Prenatal smoke exposure (PSE) is a risk factor for nicotine dependence. One susceptibility gene for nicotine dependence is Cytochrome P450 (CYP) 2A6, an enzyme responsible for the conversion of nicotine to cotinine and nicotine clearance in the liver. Higher activity of the CYP2A6 enzyme is associated with nicotine dependence, but no research has addressed the PSE effects on the CYP2A6 gene or its mouse homologue Cyp2a5. We hypothesized that PSE affects Cyp2a5 promoter methylation, Cyp2a5 mRNA levels, and nicotine metabolism in offspring. We used a smoke-exposed pregnant mouse model. RNA, DNA, and microsomal protein were isolated from liver tissue of foetal, neonatal, and adult offspring. Enzyme activity, Cyp2a5 mRNA levels, and Cyp2a5 methylation status of six CpG sites within the promoter region were analysed via HPLC, RT-PCR, and bisulphite pyrosequencing. Our data show that PSE induced higher cotinine levels in livers of male neonatal and adult offspring compared to controls. PSE-induced cotinine levels in neonates correlated with Cyp2a5 mRNA expression and promoter methylation at CpG-7 and CpG+45. PSE increased methylation in almost all CpG sites in foetal offspring, and this effect persisted at CpG-74 in male neonatal and adult offspring. Our results indicate that male offspring of mothers which were exposed to cigarette smoke during pregnancy have a higher hepatic nicotine metabolism, which could be regulated by DNA methylation. Given the detected persistence into adulthood, extrapolation to the human situation suggests that sons born from smoking mothers could be more susceptible to nicotine dependence later in life.Entities:
Keywords: CYP2A5; Prenatal smoke exposure; cotinine; epigenetics; mouse model; nicotine dependence; sex difference
Year: 2020 PMID: 32573327 PMCID: PMC7678918 DOI: 10.1080/15592294.2020.1782655
Source DB: PubMed Journal: Epigenetics ISSN: 1559-2294 Impact factor: 4.528
Figure 1.Cyp2a5 expression in liver of PSE and control in E17.5, D3 mice and adult offspring
Figure 2.Sex-dependent Cyp2a5 promoter methylation across three time points (E17.5, D3 mice and adult offspring). DNA was isolated from whole liver of foetuses (E17.5, a), neonatal offspring (D3, b) and adult offspring (c) in PSE (closed symbols) and control groups (open symbols). DNA was subjected to bisulphite sequencing-based methylation analysis of the Cyp2a5 promoter region and the percentage of DNA methylation was assessed. Data of the 6 targeted CpG-sites are presented per sex and exposure as individual values with median as a horizontal line. CpG-site annotations are relative to the ATG start codon. If not stated otherwise, the comparison of shown groups was not significant. *p ≤ 0.05, ** p ≤ 0.01, ***p ≤ 0.001 (Mann-Whitney U-test). Circle (○) symbol(s) = male, square (□) symbol(s) = female
Sequences of primers used in bisulphite-based methylation analysis
| Gene | Targeted CpG-sites | Sequence 5ʹ-3’ |
|---|---|---|
| CpG-614 to −542 | For: TTTGTGTTTGTTTTGAGTGTTGGGATTA | |
| CpG-74 to +45 | For: AGTGGATAGTTTGGAGGTGAAAT |
Correlations between Cyp2a5 mRNA expression and promoter methylation in foetal (E17.5), neonatal (D3) and adult offspring liver
| E17.5 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| correlation of / with | all | all male | all female | all control | all PSE | male control | male PSE | female control | female PSE | ||
| CpG-614 | r | -0.02 | -0.23 | 0.17 | 0.17 | -0.29 | -0.23 | -0.45 | -0.13 | ||
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | |||
| CpG-589 | r | 0.23 | 0.04 | 0.38 | 0.46 | 0,19 | 0.32 | -0.1 | 0,57 | 0.47 | |
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | ns | ||
| CpG-542 | r | 0.11 | -0.38 | 0.41 | 0.26 | 0.1 | -0.56 | -0.38 | 0.23 | ||
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | |||
| CpG-74 | r | 0.21 | 0.19 | 0.25 | 0.35 | 0.05 | -0.05 | 0.13 | 0.48 | 0.06 | |
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | ns | ||
| CpG-7 | r | 0.02 | -0.04 | 0.01 | 0.19 | -0.12 | 0.07 | -0.15 | 0.40 | -0.14 | |
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | ns | ||
| CpG+45 | r | 0.25 | 0.1 | 0.38 | 0.24 | 0.20 | -0.25 | 0.16 | 0.44 | 0.29 | |
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | ns | ||
*p ≤ 0.05, ** p ≤ 0.01, ***p ≤ 0.001. P-values were adjusted by the Bonferroni method.
Figure 3.Time points comparisons of sex-dependent Cyp2a5 promoter methylation status in PSE and control groups. The ANOVA test was used to do the comparison analysis among the foetal stage (E17.5), neonatal period (D3 means three days after birth) and adulthood (D140 means 140 days later after birth). P-values<0.0001 were detected by ANOVA test in all of CpG sites over three time points. Mann–Whitney U-test was used to test the comparisons between two time points in control (open symbols) and PSE (closed symbols) groups for 6 promoter methylation CpG sites. Data are represented as mean± SEM; CpG-site annotations are relative to the ATG start codon. *p ≤ 0.05, *** p ≤ 0.001 (Mann-Whitney U-test). Circle (○) symbol(s) = male, square (□) symbol(s) = female
Figure 4.Optimization and the cotinine formation levels of in vitro nicotine metabolism in E17.5, D3 mice and adult offspring. Cotinine formation of nicotine metabolism of foetuses (E17.5), three-day-old offspring (D3) and adult offspring in PSE and control groups. The nicotine metabolism was measured by HPLC-L as described in the material and methods section. The assay was optimized with respect to incubation time (a) and cytosolic protein concentration (b). Arrows at the X-axis indicate conditions used for actual experiments. C presents the HPLC chromatogram separation of a blank sample containing the standards nicotine and cotinine and the cotinine was produced in liver microsomes of PSE male neonatal offspring. D presents the cotinine analysis by LCMS. Cotinine, corresponding with m/z 177 was detected both in standard cotinine and in the microsome sample. The levels of cotinine formation were measured in foetal (e), three-day-old offspring (f) and adult offspring (g) of both groups. Circle (○) symbol(s) = male, square (□) symbol(s) = female. Data are shown as individual values. If not stated otherwise, the difference between groups was not significant. *p ≤ 0.05, ** p ≤ 0.01 (Mann-Whitney U-test). Open symbol(s) = control group, closed symbol(s) = PSE
Correlations between cotinine levels, Cyp2a5 mRNA expression and promoter methylation in foetal (E17.5), neonatal (D3) and adult offspring liver
| E17.5 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| correlation of / with | Cotinine formation (nmol/min/mg) | all | all male | all female | all control | all PSE | male control | male PSE | female control | female PSE | |
| r | 0.41 | 0.33 | 0.41 | 0.46 | 0.20 | ||||||
| p-value | ns | ns | ns | ns | ns | ||||||
| CpG-614 | r | -0.15 | -0,21 | -0.14 | 0.30 | -0.07 | -0.41 | 0.19 | 0.44 | -0.27 | |
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | ns | ||
| CpG-589 | r | -0.59 | 0.01 | -0.10 | 0.30 | -0.05 | 0.07 | 0.28 | 0.65 | -0.35 | |
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | ns | ||
| CpG-542 | r | 0.15 | 0.17 | 0.03 | 0.36 | -0.09 | 0.55 | -0.18 | -0.17 | ||
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | |||
| CpG-74 | r | 0.21 | 0.31 | 0.10 | 0.12 | 0.26 | 0.36 | 0.30 | -0.03 | 0.06 | |
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | ns | ||
| CpG-7 | r | 0.14 | 0.26 | 0.01 | -0.19 | 0.42 | 0.08 | 0.75 | -0.38 | ||
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | |||
| CpG+45 | r | 0.31 | 0.34 | 0.28 | 0.4 | 0.37 | 0.19 | 0.57 | 0.57 | 0.21 | |
| p-value | ns | ns | ns | ns | ns | ns | ns | ns | ns | ||
*p ≤ 0.05, ** p ≤ 0.01, ***p ≤ 0.001. P-values were adjusted by the Bonferroni method.