Molecular identification of Salmonella Typhimurium from village chickens based on invA and spvC genes.

AIM: This study aimed to identify Salmonella enterica serovars by polymerase chain reaction (PCR) based on virulence genes invasion A (invA) and Salmonella plasmid virulence C (spvC).
MATERIALS AND METHODS: DNA extraction of eight bacteria isolates was done using the PowerSoil® DNA Isolation Kit. The amplification of invA and spvC genes was done using conventional PCR. The positive PCR products were purified using the GeneJET Purification Kit and then sequenced using ABI 3730 XL automated genetic analyzer. The sequences obtained were compared for similarities with other Salmonella serovars deposited on the NCBI GenBank using BLASTN.
RESULTS: Four out of eight samples were amplified by primers FS139/RS141 that target invA gene with products of about 284 bp, and three out of four of the same invA positive samples were also amplified by primers FSPV-1/RSPV-2 targeting spvC with a product of about 571 bp. One sample was not amplified by primers FSPV-1/RSPV-2 as it lacked virulence plasmid. Analysis of sequences indicated 100% homology with closely related serovars of S. enterica subspecies enterica serovar Typhimurium.
CONCLUSION: Salmonella Typhimurium that contained invA and spvC genes are pathogenic and virulent strains. Copyright: © Mkangara, et al.

Introduction

Salmonella enterica serovar Typhimurium (Salmonella Typhimurium) is a motile Gram-negative bacterium in family Enterobacteriaceae [1]. The bacterium is one among serovars with broad host range responsible for gastroenteritis in chickens but rarely induce systemic infection [2]. In young chickens, S. Typhimurium results in severe inflammation and intestinal pathology [3]. However, in some cases, the pathogen does not cause noticeable clinical symptoms in older chickens [4,5]. Under these circumstances, the older chickens become carriers of S. Typhimurium, which colonizes the gut with persistent shedding of bacteria that contaminate different environments [6-9]. The carrier chickens with salmonellosis are among sources of contaminated chicken products in the abattoirs with the significance of forming biofilm layers in equipment involved in the value chain [10]. The biofilm contributes to the persistence of Salmonella in different biotic and abiotic surfaces and protects the bacterium against antibiotics and disinfectants [11]. On the other side, salmonellosis is zoonotic; therefore, chicken products contaminated with S. Typhimurium increase number of gastroenteritis infections to humans who are the most affected than any other group worldwide [12].

There are different methods of identifying pathogenic microbes from clinical samples [13]. The best choices consider techniques which are cost-effective, accurate, rapid, and easier to use to improve diagnostic testing with the outcome of right treatments in a shorter time [14]. The conventional microbiological methods, including culture using selective medium, microscopy, Gram staining, and biochemical tests are labor-intensive, time-consuming with low specificity [15,16]. In contrary to these methods, the polymerase chain reaction (PCR) is the confident and rapid technique of detecting clinical samples with higher specificity and sensitivity [17,18]. Therefore, the PCR methods qualify for the identification of any number of pathogens using specific primers that amplify the minimal part of the genome. The invasion A (invA) is an invasion-related gene located in Salmonella pathogenicity island-1 [19]. The gene is responsible for the invasion of epithelial cells and the induction of macrophage apoptosis [20]. The invA gene is a conserved virulence gene in nearly all Salmonella species; therefore, the right candidate for the detection of Salmonella using different PCR methods [20]. The study also selected the Salmonella plasmid virulence C (spvC) gene, which is of virulence plasmid for detecting strains associated with non-typhoid bacteremia [21]. Salmonella has plasmids with a highly conserved locus known as spv operon. The operon consists of five genes spvRABCD essential for Salmonella virulence [22]. However, not all Salmonella serovars consist of spv genes [23].

Therefore, the present study used conventional PCR for the detection of virulence genes invA and spvC in Salmonella spp. isolated from fecal samples of chickens.

Materials and Methods

Ethical approval

This study got approval from Kibong’oto Infectious Diseases Hospital, Nelson Mandela African Institution of Science and Technology (NM AIST) and Centre for Educational Development in Health, Health Research Committee with approval number KNCHREC006.

Bacterial isolates

Eight bacterial isolates used in this study were among 54 bacteria isolates obtained from fecal samples of village chickens in Tengeru ward, Arusha, Tanzania in June 2019. Out of 54 isolates, 46 were biochemically identified to be Salmonella Gallinarum (in the other study). The remaining eight isolates were non-S. Gallinarum subjected to molecular identification using PCR.

DNA extraction

The DNA extraction was done using the PowerSoil® DNA Isolation kit (MO BIO Laboratories, Inc.) according to the manufacturer’s instruction. The quantity and purity of DNA were assessed using Nanodrop, and quality of DNA was checked on a gel of 1.5% (w/v) agarose and visualized using ultraviolet (UV)–visible spectrophotometer (Cole-Parmer UV Transilluminator). The DNA was stored at −20°C until use.

PCR

The PCR amplification was carried out with a 25 μL amplification mixture consisting of 12.5 μL master mix (OneTaq® Quick-Load® 2×MM w/Std. buffer, BioLabs, New England), 0.5 μL of 10 μM each primer (Table-1), [24,25] 8.5 μL of nuclease-free water, and 3.0 μL DNA template. Amplification was conducted in a thermocycler (C-1000 Touch™ thermocycler). The cycle conditions consisted an initial denaturation 94°C for 1 min followed by 35cycles of denaturation at 94°C for 60 s, annealing at 64°C for 30 s, and elongation at 72°C for 30 s with 7min final extension period at 72°C. The amplified products were separated by gel electrophoresis containing 1.5%w/v agarose (SRL, India) stained with ethidium bromide (0.5 μg/mL) and detected by gel documentation system (UVP, UK). The amplification cycles for spvC gene were similar to invA gene except the annealing temperature for spvC gene was 58°C instead of 64°C used for invA.

Table 1

Primer pair used to amplify Salmonella isolates.

Gene	Primers	Oligonucleotides (5’- 3’)	Annealing temperature	Length (bp)	Reference
invA	S139	GTG AAA TTA TCG CCA CGT TCG GGC AA	64°C	284	[24]
	S141	TCATCGCACCGTCAAAGGAACC
spvC	SPV-1	ACTCCTTGCACAACCAAATGCGGA	58°C	571	[25]
	SPV-2	TGTCTTCTGCATTTCGCCACCATCA

invA=Invasion A

Nucleotide sequencing of invA and spvC genes

The positive PCR products were purified using the GeneJET Purification Kit (Thermo Fisher Scientific, MA, USA); then, the pure products were sequenced using both forward and reverse primers (Table-1).

A gene in an ABI 3730 XL automated sequencer (Applied Biosystems, MA, USA) was in a custom sequencing facility of Mbeya Referral Hospital, Tanzania. The sequences obtained were analyzed, and homology searches were conducted using the BLAST algorithm (www.ncbi.nlm.nih.gov/BLAST).

Results

Four samples were amplified by invA gene. Three out of four of the same invA positive samples were also amplified by spvC gene (Table-1). The amplified samples were 100% similar with S. enterica serovar Typhimurium strain number 14028 with accession number CP034479.1 and S. enterica subspecies enterica serovar Typhimurium strain number 14028 with accession number CP034480.1

The positive PCR reactions in this study were observed by agarose jelly with ~ 284 and ~571bp products for invA and spvC genes, respectively (Figure-1). The nucleotide sequence of the invA gene of S. Typhimurium strain obtained in this study was analyzed and 284bp sequences deposited with NCBI under GenBank accession number MK204827.

Figure-1

The polymerase chain reaction amplification for invA (284bp) and spvC (571bp) virulence gene of Salmonella spp. Lis the molecular weight marker (1000bp), 1 is a negative control, 2, 3, 4, and 5 are samples, while 6 is positive control. The B, C, D, and E are samples and A is a positive control.

Discussion

In the present study, the detection of Salmonella spp. by conventional PCR was done using pair of primers (FS139-RS141) specific for the invA gene and FSPV-1 and RSPV-2 for the spvC gene. The selection of these genes was made based on those associated with virulence in Salmonella spp. [26]. The invA gene of Salmonella contains sequences unique to this genus and has been approved as a suitable PCR target with the potential diagnostic application [20]. This gene encodes a protein in the inner membrane of bacteria responsible for the invasion of the epithelial cells of the host [19]. On the other side, spvC gene targets invasive non-typhoidal Salmonella spp. that induces systemic infection to chickens [27,28].

In this study, out of four samples amplified for invA gene, three were positive with spvC. Following blasting of the sequences for invA positive, spvC positive, and spvC negative, it was revealed that all samples were S. enterica serovar Typhimurium. The lack of spvC gene to one sample of S. Typhimurium is an indication that the species is non-invasive compared to invasive non-typhoidal S. Typhimurium which possess spvC gene. In support of these findings, Guiney and Fierer [29] observed that three genes represent virulence phenotype in spv locus designated as spvRABCD are positive transcriptional regulator spvR and two structural genes spvB and spvC [30]. The spvBC are sufficient to replace all of the spv genes, as well as the entire virulence plasmid to enable systemic infection in mice after subcutaneous inoculation [31]. However, in the absence of spvC, spvB does not have a detectable virulence phenotype [21]. From these observations, it is suggested that spvC gene is the primary determinant of virulence in spv locus. However, the exact mechanisms by which spvB and spvC manage to enhance virulence are still unclear [31].

It is becoming clear that the virulence of S. Typhimurium identified from this study is attributed by the possession of both invA and spvC genes [32,33]. S. Typhimurium, which lacks spvC gene, eliminates the ability of plasmid to confer virulence to chickens [21,34].

Conclusion

InvA and spvC genes identified pathogenic and virulent strains of S. Typhimurium. The invA is a factor in the outer membrane of Salmonella spp., thus enables S. Typhimurium to initiate infection on the epithelial cell of chicken and induction of macrophage apoptosis. S. Typhimurium containing spvC gene is more virulent than those lacking this gene. This is because virulence plasmid with a structural gene spvC plays a role in the pathogenicity of S. Typhimurium. However, not all Salmonella serovars possess spvC gene responsible for virulence phenotype. Therefore, relying only on the spvC gene for the detection of Salmonella spp. may provide a high chance of false-positive results because some non-typhoidal Salmonella like S. Typhimurium possess spvC gene and others lack it.

Authors’ Contributions

MM planned the study, collected samples, analyzed data, and developed the manuscript. ERM analyzed data, edited, and proofread the manuscript; MC analyzed data and wrote the manuscript. All authors read and approved the final manuscript.