| Literature DB >> 32521270 |
Cuige Zhu1, Anna Rogers1, Karama Asleh2, Jennifer Won2, Dongxia Gao2, Samuel Leung2, Shan Li3, Kiran R Vij4, Jian Zhu5, Jason M Held6, Zhongsheng You3, Torsten O Nielsen2, Jieya Shao7.
Abstract
Spatiotemporal protein reorganization at DNA damage sites induced by genotoxic chemotherapies is crucial for DNA damage response (DDR), which influences treatment response by directing cancer cell fate. This process is orchestrated by valosin-containing protein (VCP), an AAA+ ATPase that extracts polyubiquinated chromatin proteins and facilitates their turnover. However, because of the essential and pleiotropic effects of VCP in global proteostasis, it remains challenging practically to understand and target its DDR-specific functions. We describe a DNA-damage-induced phosphorylation event (Ser784), which selectively enhances chromatin-associated protein degradation mediated by VCP and is required for DNA repair, signaling, and cell survival. These functional effects of Ser784 phosphorylation on DDR correlate with a decrease in VCP association with chromatin, cofactors NPL4/UFD1, and polyubiquitinated substrates. Clinically, high phospho-Ser784-VCP levels are significantly associated with poor outcome among chemotherapy-treated breast cancer patients. Thus, Ser784 phosphorylation is a DDR-specific enhancer of VCP function and a potential predictive biomarker for chemotherapy treatments.Entities:
Keywords: DNA damage response; K48-linked polyubiquitin; VCP; biomarker; cancer; chemotherapy; chromatin-associated degradation; nucleus; phosphorylation; proteostasis
Mesh:
Substances:
Year: 2020 PMID: 32521270 PMCID: PMC7282751 DOI: 10.1016/j.celrep.2020.107745
Source DB: PubMed Journal: Cell Rep Impact factor: 9.423
Figure 1Nuclear Antigen Recognized by the pSer137-Pfn1 Antibody Associates with Poor Survival Among Chemotherapy-Treated Breast Cancer Patients
(A) Representative images of the nuclear staining of human breast tumors by the pSer137-Pfn1 antibody. 20X magnification; scale bars, 100 μm.
(B–D) Univariate Kaplan-Meier analyses showing an inverse correlation between nuclear staining by the pSer137-Pfn1 antibody and patient survival in the SPECS series (B), UBC series (C), and the TNBC subset of the UBC series (D). OS, overall survival; RFS, relapse-free survival; BCSS, breast cancer-specific survival; TNBC, triple-negative breast cancer.
(E) Univariate Kaplan-Meier analysis of the BCCancer series showing the associations between nuclear staining by the pSer137-Pfn1 antibody and poor survival outcome (BCSS) of the chemotherapy-treated breast cancer patients. Log-rank and Wilcoxon tests were used. p < 0.05 was considered statistically significant. Unadjusted p values for the outcome in the chemotherapy-treated group of BCCancer series are displayed.
See also Figures S1–S3 and Tables S1–S9.
Figure 2pSer784-VCP Is the DNA-Damage-Induced Nuclear Antigen of the pSer137-Pfn1 Antibody
(A) HeLa cells were treated with DMSO, 200 nM of SN38, and 5 μM of etoposide for 6 h, followed by staining using the pSer137-Pfn1 antibody. DAPI was used to stain DNA.
(B) HeLa cells were treated with DMSO, 200 nM of SN38, and 1 μM of gemcitabine for 16 h, followed by western blot analysis using the pSer137-Pfn1 antibody. Red arrowhead indicates the DNA-damage-induced ~100-kDa protein.
(C) Nuclear extracts of DMSO- or SN38-treated (200 nM, 16 h) HeLa cells were immunoprecipitated by the pSer137-Pfn1 antibody, followed by SDS-PAGE analysis and silver staining. The drug-induced protein at ~100 kDa was excised and identified as VCP by mass spectrometry (Held et al., 2013).
(D) Pull-down samples from (C) were analyzed by western blot using a VCP-specific antibody.
(E) HeLa cells were infected with shLuc or two distinct shVCPs for 3 days, treated with 5 μM of etoposide for 6 h, and immunostained using the pSer137-Pfn1 antibody.
(F) HeLa cells were treated with 5 μM of etoposide for 6 h, extracted by the CSK buffer for 5 min, and stained by the pSer137-Pfn1 antibody.
(G) HEK293T cells were transfected with wild-type or mutant VCP-GFP, treated with 200 nM of SN38 for 16hr, and immunoprecipitated using the pSer137-Pfn1 antibody. Pull-down and input samples were analyzed by western blot using a GFP antibody.
(H) Input samples from (A) were analyzed by western blot using the pSer137-Pfn1 or VCP antibodies.
(I) HeLa cells were pre-treated for 30 min with DMSO, 10 mM of caffeine, or 10 μM of KU-55933, followed by 30 min of treatment with 50 μM of etoposide. They were lysed by RIPA (without SDS), and the soluble and insoluble fractions were analyzed by western blot. pSer784-VCP was detected by the pSer137-Pfn1 antibody.
All data, except (C), were independently confirmed two to three times. Scale bars, 20 μm (A) and (E) and 10 μm (F). See also Figures S4 and S5.
Figure 3Monoclonal pSer784-VCP Antibody Confirms the Nuclear Antigen of the pSer137-Pfn1 Antibody
(A) HeLa cells treated with DMSO or SN38 (200 nM, 16 h) were analyzed by western blot using the pSer137-Pfn1 or pSer784-VCP antibodies.
(B) HeLa cells treated with etoposide (50 μM, 1 h) were lysed, incubated at 37°C for 1 h with or without calf intestinal alkaline phosphatase, and analyzed by western blot using the pSer137-Pfn1, pSer784-VCP, or pan-VCP antibodies.
(C) HeLa cells treated with DMSO or etoposide (50 μM, 6 h) were subjected to immunoprecipitation by control immunoglobulin G (IgG) or pan-VCP antibody, followed by western blot using the pSer137-Pfn1, pSer784-VCP, and pan-VCP antibodies.
(D) HeLa cells treated with DMSO or SN38, as in (A), were subjected to immunoprecipitation using the pSer137-Pfn1 or pSer784-VCP antibodies, followed by western blot using a pan-VCP antibody.
(E) HeLa cells were treated with 200 nM of SN38 for 16 h and immunostained with the pSer784-VCP antibody.
(F) HeLa cells were treated with 50 μM of etoposide for 1 h, followed by double immunostaining using the pSer137-Pfn1 and pSer784-VCP antibodies.
(G and H) U2OS cells were treated with 50 μM of etoposide for 1 h, recovered for 90 min, and detergent-extracted before fixation and double staining by the pSer137-Pfn1 and 53BP1 antibodies (G) or pSer784-VCP and γH2AX (H) antibodies.
(I) Representative images in the SPECS TMA immunostained in parallel by the pSer137-Pfn1 and pSer784-VCP antibodies.
(J) Univariate Kaplan-Meier analysis of the SPECS TMA stained in (G). Nuclear Allred scores were binarized into low (0–4) versus high (5–8) groups. Two extra interpretable cases stained by the pSer137-Pfn1 antibody (n = 46) (but not by pSer784-VCP, n = 44) were included in the analysis. p values were based on Log-rank test.
More than 100 cells per experiment were analyzed for (D)–(F). Data in (A)–(H) have been independently confirmed 2-3 times. Scale bars, 20 μm (E), 4 μm (F–H), and 10 μm (I). See also Figure S5.
Figure 4Ser784 Phosphorylation Is a Late DNA-Damage-Induced Event
(A) BT549 cells were laser micro-irradiated (Chen et al., 2013) and double labeled at various time points by the pSer784-VCP/NBS1 or VCP/NBS1 antibody pairs (You et al., 2005). Experiment was independently performed twice with similar results.
(B) HeLa cells were treated continuously with 50 μM of etoposide, lysed by RIPA buffer (no SDS) at the indicated time points, and analyzed for soluble and insoluble fractions by western blot.
Band intensities were plotted over time for each indicated antibody. Data were independently confirmed three times. Scale bars, 10 μm. See also Figure S6.
Figure 5Ser784 Phosphorylation Increases VCP Activity Specifically in the Nucleus
(A) HeLa cells stably expressing GFP or RNAi-resistant VCP-GFP (WT or mutants) were infected with shLuc or shVCP1 and 2 combined. Cells were analyzed 4 days later by western blot using antibodies against VCP (detecting both endogenous VCP and exogenous VCP-GFP) or actin.
(B) Cells in (A) were treated with 50 μM of etoposide for 30 min, recovered for 1 h, lysed by RIPA buffer (no SDS), and analyzed for soluble and insoluble fractions by western blot using a K48-linkage-specific polyubiquitin antibody controlled by histone H3 or GAPDH.
(C) Etoposide-treated HeLa cells, as in (B), were subjected to subcellular fractionation (Méndez and Stillman, 2000), followed by western blot analysis of the resulting cytoplasmic, nucleoplasmic, and chromatin fractions using the K48-ubiquitin antibody controlled by GAPDH, actin, and histone H3. Densitometry was performed to quantify K48-polyubiquitin levels in (B) and (C), which were subsequently normalized over the internal controls.
(D) Chromatin fractions from (C) were analyzed by western blot for Ku70.
(E) VCP knockdown and rescue HeLa cells were treated with 50 μM of etoposide for 30 min, recovered for 2 h in the presence of 20 μM of MG-132, and lysed with RIPA buffer. Soluble and insoluble fractions were analyzed by western blot for HIF1α and K48-ubiquitin, with tubulin and H3 as loading controls.
See also Figure S7.
Figure 6Ser784 Phosphorylation Decreases VCP Association with Chromatin and Polyubiquitinated Proteins
(A) HeLa cells were treated with 5 μM of etoposide overnight, lysed with SDS-free RIPA, and immunoprecipitated first with the pSer784-VCP antibody; the supernatant of which was subsequently immunoprecipitated by the VCP pan-antibody.
(B) MDA-MB-231 cells stably expressing YFP-FLAG or VCP-FLAG (S784A versus S784D) were treated with 200 nM of SN38 overnight, and nucleoplasmic fractions were immunoprecipitated by the anti-FLAG antibody.
(C) HeLa cells expressing RNAi-resistant VCP-GFP were infected with combined shVCP1 and 2, treated with 50 μM of etoposide for 45 min, recovered for 1 h, lysed with SDS-free RIPA buffer, and analyzed by western blot.
(D) Similarly treated HeLa cells as in (C) were fractionated and analyzed by western blot using nucleoplasm and chromatin fractions. Data were independently confirmed two to three times.
See also Figures S7 and S8.
Figure 7Ser784 Phosphorylation of VCP Is Important for DNA-Damage Response and Cell Survival upon Genotoxic Stress
(A) shLuc- or shVCP-infected stable HeLa cells were treated with 50 μM of etoposide for 30 min, recovered for 1 h, lysed by RIPA, and analyzed by western blot.
(B) shLuc- or shVCP-infected stable U2OS cells were treated with vehicle or different drugs for 16 h, and subjected to colony formation assays for 10–14 days (Guzmán et al., 2014). Relative effects represent normalized drug/vehicle percentages. Shown are means ± SEM of three technical replicates of single biological experiments for each drug. p Values were based on unpaired t tests (S784A versus WT or S784D).
(C) shVCP2-infected U2OS stable cells were treated with 25 μM of etoposide for 30 min followed by 1 h of recovery or 1 mM HU for 16 h. Cells were subjected to the comet assay under the alkaline condition, and tail DNA percentages were calculated (Gyori et al., 2014). Shown are single biological experiments with 150–300 cells analyzed per condition. Error bars represent SEM. p Values were based on unpaired t tests. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. Results in (B) and (C) were confirmed by three biological replicates.
(D) Working model of enhanced substrate extraction from chromatin by VCP upon DNA-damage-induced Ser784 phosphorylation. In this model, Ser784 phosphorylation is a relatively late DDR event that occurs either in the nucleoplasm or on chromatin after VCP binding to polyubiquitinated substrates (both scenarios are depicted). Ser784 phosphorylation does not abolish chromatin recruitment of VCP but promotes substrate extraction and subsequent degradation at least partially because of its weakened interaction with cofactors NPL4 and UFD1, which directly bind substrates. Dissociated pSer784-VCP can regain access to chromatin and extract more substrates.
Scale bars, 40 μm. See also Figures S9 and S10.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Rabbit polyclonal anti-pSer137-Pfn1 | Previous Paper ( | N/A |
| Mouse monoclonal anti-pSer784-VCP, clone (3E4) | This Paper | N/A |
| Rabbit monoclonal anti-GFP | Cell Signaling Technology | Cat#2956; RRID: |
| Mouse monoclonal anti-VCP | Santa Cruz | Cat#sc-57492; RRID: |
| Cat#sc-136273; RRID: | ||
| Mouse monoclonal anti-actin | Santa Cruz | Cat#sc-47778; RRID: |
| Mouse monoclonal anti-GAPDH | Santa Cruz | Cat#sc-365062; RRID: |
| Rabbit monoclonal anti-Histone H3 | Cell Signaling Technology | Cat#4499; RRID: |
| Rabbit monoclonal anti-γH2AX | Cell Signaling Technology | Cat#9718; RRID: |
| Mouse monoclonal anti-Ku70 | Santa Cruz | Cat#sc-17789; RRID: |
| Mouse monoclonal anti-ATM | Santa Cruz | Cat#sc-377293 |
| Rabbit monoclonal anti-pSer1981-ATM | Cell Signaling Technology | Cat#5883; RRID: |
| Rabbit polyclonal anti-pSer428-ATR | Cell Signaling Technology | Cat#2853; RRID: |
| Mouse monoclonal anti-Chk2 | Cell Signaling Technology | Cat#3440; RRID: |
| Rabbit monoclonal anti-pThr68-Chk2 | Cell Signaling Technology | Cat#2197; RRID: |
| Rabbit monoclonal anti-pSer345-Chk1 | Cell Signaling Technology | Cat#2348; RRID: |
| Rabbit monoclonal anti-NBS1 | Cell Signaling Technology | Cat#14956; RRID: |
| Rabbit polyclonal anti-pSer343-NBS1 | Cell Signaling Technology | Cat#3001; RRID: |
| Rabbit polyclonal anti-K48-ubiquitin | Cell Signaling Technology | Cat#4289; RRID: |
| Rat monoclonal anti-FLAG tag | BioLegend | Cat#637301; RRID: |
| Rabbit polyclonal anti-NPL4 | Bethyl Laboratories | Cat#A304-102A; RRID: |
| Rabbit polyclonal anti-UFD1 | Bethyl Laboratories | Cat#A301-875A; RRID: |
| Mouse monoclonal anti-CHOP | Cell Signaling Technology | Cat#2895; RRID: |
| Rabbit monoclonal anti-BiP | Cell Signaling Technology | Cat#3177; RRID: |
| Rabbit monoclonal anti-phospho-ATM/ATR substrate motif | Cell Signaling Technology | Cat# 6966, RRID: |
| Rabbit monoclonal anti-Pfn1 | Cell Signaling Technology | Cat#3246; RRID: |
| Mouse monoclonal anti-BRCA1 | Santa Cruz | Cat#sc-6954; RRID: |
| Mouse monoclonal Anti-Human 53BP1(Clone19) | BD Biosciences | Cat#612522; RRID: |
| Mouse anti-tubulin | Sigma | Cat#T9026; RRID: |
| Rabbit polyclonal anti-PELP1 | Bethyl Laboratories | Cat# A300-180A |
| Rabbit monoclonal anti-ATR | Cell Signaling Technology | Cat# 13934; RRID: |
| Mouse monoclonal anti-HIF1 alpha | Cell Signaling Technology | Cat# 79233; RRID: |
| Rabbit monoclonal anti-K48-linked polyubiquitin | Cell Signaling Technology | Cat# 8081; RRID: |
| Mouse monoclonal anti-pSer1981-ATM | Rockland | Cat# 200-301-400; RRID: |
| Stbl2 competent cells | Thermo Fisher | Cat#: 10268019 |
| Stbl3 competent cells | Thermo Fisher | Cat#: C737303 |
| DH5 alpha competent cells | Thermo Fisher | Cat#: 18258012 |
| XL10-Gold ultracompetent cells | Agilent | Cat#: 200314 |
| Etoposide | Selleckchem | Cat#S1225; CAS:33419-42-0 |
| KU55933 | Selleckchem | Cat#S1092; CAS:587871-26-9 |
| Niraparib | Selleckchem | Cat#S7625; CAS:038915-73-9 |
| Olaparib | Selleckchem | Cat#S1060; CAS:763113-22-0 |
| Cisplatin | Selleckchem | Cat#S1166; CAS:15663-27-1 |
| Gemcitabine | Selleckchem | Cat#S1714; CAS:95058-81-4 |
| Hydroxyurea | Sigma | Cat#H8627; CAS:27-07-1 |
| 5-Fluoracil | Sigma | Cat#F6627; CAS:51-21-8 |
| SN38 | Sigma | Cat#H1065; CAS:86639-52-3 |
| NMS-873 | Selleckchem | Cat#S7285; CAS:1418013-75-8 |
| MG-132 | Selleckchem | Cat# S2619; CAS:133407-82-6 |
| ImmPACT DAB kit | Vectorlabs | Cat#SK-4105 |
| Single Cell Gel Electrophoresis Assay | Trevigen | Cat#4250-050-K |
| Human: T47D | ATCC | HTB-133 |
| Human: HCC1806 | ATCC | CRL-2335 |
| Human: HeLa | ATCC | CCL-2 |
| Human: HEK293T | ATCC | CRL-11268 |
| Human: U2OS | ATCC | HTB-96 |
| Human: MDA-MB-231 | ATCC | HTB-26 |
| Human: BT549 | ATCC | HTB-122 |
| shLuc: ATATCCGAGTGTAGTAAACATT | This Paper | N/A |
| shPfn1#1: GTGGTTTGATCAACAAGAA | ( | N/A |
| shPfn1#2: TACGTGAATGGGCTGACACTT | ( | N/A |
| The primers for VCP S784A: sense TGGAGCTGGCCCCGCTCAGGGCAGTGGA | This Paper | N/A |
| The primer for VCP S784D: sense TGGAGCTGGCCCCGATCAGGGCAGTGGA | This Paper | N/A |
| The primers for VCP S784A: antisense TCCACTGCCCTGAGCGGGGCCAGCTCCA | This Paper | N/A |
| The primer for VCP S784D: antisense TCCACTGCCCTGATCGGGGCCAGCTCCA | This Paper | N/A |
| shVCP#1: CCTGATGTGAAGTACGGCAAA | This Paper | N/A |
| shVCP#2: AGGGAGGTAGATATTGGAATT | This Paper | N/A |
| VCP(WT)-GFP (shVCP#1,Resistant) | This Paper | N/A |
| VCP(WT)-GFP (shVCP#2,Resistant) | This Paper | N/A |
| VCP(WT)-EGFP | Addgene | Cat#23971; RRID: Addgene_23971 |
| pEGFP-C1 | Clontech (discontinued) | |
| pFLRu-NYFP-FH | N/A | |
| VCP(WT)-FLAG | This Paper | N/A |
| VCP(S784A)-EGFP | This Paper | N/A |
| VCP(S784D)-EGFP | This Paper | N/A |
| VCP(S326A)-EGFP | This paper | N/A |
| VCP(S652A)-EGFP | This paper | N/A |
| VCP(S746A,S748A)-EGFP | This paper | N/A |
| pFLRu-FH vector | ( | N/A |
| VCP(S664A)-EGFP | This paper | N/A |
| VCP(S784A)-FLAG | This paper | N/A |
| VCP(S784D)-FLAG | This paper | N/A |
| VCP(S784A)-GFP (shVCP#1,Resistant) | This paper | N/A |
| VCP(S784A)-GFP (shVCP#2,Resistant) | This paper | N/A |
| VCP(S784D)-GFP (shVCP#1,Resistant) | This paper | N/A |
| VCP(S784D)-GFP (shVCP#2, Resistant) | This paper | N/A |
| R software | The R foundation | N/A |
| SPSS version 23 | IBM corporation | N/A |
| ImageJ with the OpenComet plugin | ( | |
| GraphPad Prism 7 | GraphPad software | N/A |
| Cellsens software | Olympus Lifescience | N/A |
| SignalStain Boost IHC Detection Reagent, mouse | Cell Signaling Technology | Cat#: 8125 |
| SignalStain Boost IHC Detection Reagent, rabbit | Cell Signaling Technology | Cat#: 8114 |
| RIPA lysis buffer | Cell Signaling Technology | Cat#: 9806 |
| HiTrap protein G column | GE healthcare | cat#: 17040403 |
| Mouse monoclonal anti-FLAG M2 affinity gel | Sigma | Cat#: A2220 |