Literature DB >> 32516310

ULK1-ATG13 and their mitotic phospho-regulation by CDK1 connect autophagy to cell cycle.

Zhiyuan Li1, Xiaofei Tian1, Xinmiao Ji1, Junjun Wang1, Hanxiao Chen1, Dongmei Wang1, Xin Zhang1,2.   

Abstract

Unc-51-like autophagy activating kinase 1 (ULK1)-autophagy-related 13 (ATG13) is the most upstream autophagy initiation complex that is phosphorylated by mammalian target-of-rapamycin complex 1 (mTORC1) and AMP-activated protein kinase (AMPK) to induce autophagy in asynchronous conditions. However, their phospho-regulation and functions in mitosis and cell cycle remain unknown. Here we show that ULK1-ATG13 complex is differentially regulated throughout the cell cycle, especially in mitosis, in which both ULK1 and ATG13 are highly phosphorylated by the key cell cycle machinery cyclin-dependent kinase 1 (CDK1)/cyclin B. Combining mass spectrometry and site-directed mutagenesis, we found that CDK1-induced ULK1-ATG13 phosphorylation promotes mitotic autophagy and cell cycle progression. Moreover, double knockout (DKO) of ULK1 and ATG13 could block cell cycle progression and significantly decrease cancer cell proliferation in cell line and mouse models. Our results not only bridge the mutual regulation between the core machinery of autophagy and mitosis but also illustrate the positive function of ULK1-ATG13 and their phosphorylation by CDK1 in mitotic autophagy regulation.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32516310      PMCID: PMC7282624          DOI: 10.1371/journal.pbio.3000288

Source DB:  PubMed          Journal:  PLoS Biol        ISSN: 1544-9173            Impact factor:   8.029


Introduction

Autophagy occurs at basal levels in most tissues to selectively eliminate unwanted cellular components and can also be induced in response to various physiological and pathological conditions. Evolutionarily conserved autophagy-related (ATG) proteins play essential roles in autophagy nucleation, elongation, autophagosome closure, and maturation [1-3]. Unc-51-like autophagy activating kinase 1 (ULK1)/ATG1, a mammalian serine/threonine protein kinase, plays a key role in autophagy initiation [1]. It forms a complex with ATG13 and FAK family-interacting protein of 200 kDa (FIP200), which enhance ULK1 kinase activity and are vital for its localization and stability, mediating mammalian target-of-rapamycin (mTOR) signaling to autophagy [4-6]. On the other hand, many ATG proteins have also been proven to have vital physiological roles in other cellular processes in higher eukaryotes [2]. For example, emerging data show that some ATG proteins, such as ATG7, FIP200, Beclin-1, and ATG5, function in cell cycle and mitosis regulation [7-10]. However, whether ULK1, as the most upstream member of autophagy initiation complex, also participates in cell cycle and mitosis regulation has not been investigated. Although autophagy has been extensively studied, currently established autophagy regulation mechanisms are mostly from asynchronous cells, in which only around 5% or less are in mitosis. However, recent studies suggest that autophagy is differentially regulated throughout the cell cycle [11-14], especially in mitosis [15,16]. Although the autophagosome number at a fixed time point is much reduced in mitotic cells compared with interphase cells [15], the autophagic flux is actually active [14,16,17]. Moreover, it has been reported that multiple kinases are involved in both autophagy and mitosis [11,13], indicating that these 2 cellular processes are intertwined. However, the mitotic autophagy regulation is still underexplored. The only work that has investigated the molecular mechanism of mitotic autophagy regulation so far is by Furuya and colleagues [15]. They reported reduced phosphatidylinositol-3-phosphate (PtdIns3P) in mitosis, which suggested decreased VPS34 complex activity. They further identified VPS34-Thr159 as the mitotic-specific phosphorylation site by CDK1 (the mammalian homolog of Cdc2 in yeast), which is one of the cyclin-dependent kinases (CDKs) that coordinate with their cyclin partners to regulate cell cycle progression. This work has provided very important insights into the mitotic regulation of autophagy machinery. However, whether other molecular mechanisms are also involved in mitotic autophagy regulation is still unknown, especially the one that is responsible for the active autophagy flux maintenance in mitosis. It is well known that ULK1-ATG13, the core machinery for the ULK1 autophagy initiation complex, was phospho-regulated primarily by mTOR and AMP-activated protein kinase (AMPK) to control autophagy induction in asynchronous cells [18-21]. However, its regulation mechanism and function in mitosis and cell cycle are still unknown. Here we found that ULK1-ATG13 not only plays essential roles in cell cycle progression but also is directly phosphorylated by CDK1/cyclin B in mitosis to regulate mitotic autophagy and cell cycle progression.

Results

The electrophoretic mobility shift of mitotic ULK1 is due to its phosphorylation

To dissect the underlying mechanism of ULK1-ATG13 regulation during cell cycle and mitosis, we synchronized HeLa cells (human cervical cancer cells) using double-thymidine and nocodazole, a microtubule destabilizing reagent. Surprisingly, both ULK1 and ATG13 underwent a significant electrophoretic mobility shift in mitosis, whereas other ATGs such as ATG5, Beclin-1, or ATG101 did not (Fig 1A). In addition, we also used thymidine and a specific CDK1 inhibitor RO-3306 [22] for synchronization. Cells were treated with RO-3306 for 10 hours after thymidine release for 2 hours. Then, RO-3306 was washed out so that the cells can sequentially enter specific phases of mitosis. We found that the ULK1 and ATG13 electrophoretic mobility shifts were closely correlated with mitotic progression (Fig 1B).
Fig 1

ULK1 undergoes electrophoretic mobility shift and is highly phosphorylated in mitosis.

(A) ULK1-ATG13 shows a mobility shift in mitosis. HeLa cells synchronized by double-thymidine release in the presence or absence of nocodazole were subjected to SDS-PAGE and western blot analysis. (B) ULK1-ATG13 undergoes band shift during mitotic progression. HeLa cells synchronized by double-thymidine and RO-3306 were released into mitosis for western blot analysis. (C) ULK1 is phosphorylated in nocodazole-arrested mitosis. The 293T cells overexpressing FLAG-tagged mULK1 or GFP were synchronized by single-thymidine and nocodazole. The immunoprecipitates using the FLAG antibody were subjected to Coomassie Brilliant Blue R-250 staining and western blot analysis. Statistical analysis for relative serine/threonine phosphorylated ULK1 was shown in Fig 1C, lower panel. n = 4, **p < 0.01. (D) The immunoprecipitates from Fig 1C were treated with or without λPP in the presence or absence of PPIs and then subjected to western blot analysis. (E) ULK1 undergoes mobility shift in both nocodazole- and STLC-arrested mitosis. HeLa cells synchronized with single-thymidine and nocodazole or STLC were analyzed by western blot analysis. The upper panel shows the immunoblotting and the lower panel shows the ratio of upshifted and nonshifted ULK1. One-way ANOVA followed by Tukey’s multiple comparison test was used for the analysis. n = 5, ***p < 0.001. (F) ULK1 undergoes phosphorylation-induced electrophoretic mobility shift in single-thymidine and nocodazole synchronized mitotic HCT 116 and RPE1 cells analyzed by western blot analysis. Numerical data underlying the figure panels are available in S1 Data. Asyn, asynchronous; ATG, autophagy-related; DT-R2h, double-thymidine block and release for 2 hours; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; IP, immunoprecipitation; mULK1, mouse ULK1; n.s., not significant; HCT 116, human colorectal cancer cells; PPI, phosphatase inhibitor; RPE1, human retinal pigmented epithelial cells; STLC, S-trityl-L-cysteine; ULK1, unc-51-like autophagy activating kinase 1; λPP, lambda phosphatase.

ULK1 undergoes electrophoretic mobility shift and is highly phosphorylated in mitosis.

(A) ULK1-ATG13 shows a mobility shift in mitosis. HeLa cells synchronized by double-thymidine release in the presence or absence of nocodazole were subjected to SDS-PAGE and western blot analysis. (B) ULK1-ATG13 undergoes band shift during mitotic progression. HeLa cells synchronized by double-thymidine and RO-3306 were released into mitosis for western blot analysis. (C) ULK1 is phosphorylated in nocodazole-arrested mitosis. The 293T cells overexpressing FLAG-tagged mULK1 or GFP were synchronized by single-thymidine and nocodazole. The immunoprecipitates using the FLAG antibody were subjected to Coomassie Brilliant Blue R-250 staining and western blot analysis. Statistical analysis for relative serine/threonine phosphorylated ULK1 was shown in Fig 1C, lower panel. n = 4, **p < 0.01. (D) The immunoprecipitates from Fig 1C were treated with or without λPP in the presence or absence of PPIs and then subjected to western blot analysis. (E) ULK1 undergoes mobility shift in both nocodazole- and STLC-arrested mitosis. HeLa cells synchronized with single-thymidine and nocodazole or STLC were analyzed by western blot analysis. The upper panel shows the immunoblotting and the lower panel shows the ratio of upshifted and nonshifted ULK1. One-way ANOVA followed by Tukey’s multiple comparison test was used for the analysis. n = 5, ***p < 0.001. (F) ULK1 undergoes phosphorylation-induced electrophoretic mobility shift in single-thymidine and nocodazole synchronized mitotic HCT 116 and RPE1 cells analyzed by western blot analysis. Numerical data underlying the figure panels are available in S1 Data. Asyn, asynchronous; ATG, autophagy-related; DT-R2h, double-thymidine block and release for 2 hours; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; IP, immunoprecipitation; mULK1, mouse ULK1; n.s., not significant; HCT 116, human colorectal cancer cells; PPI, phosphatase inhibitor; RPE1, human retinal pigmented epithelial cells; STLC, S-trityl-L-cysteine; ULK1, unc-51-like autophagy activating kinase 1; λPP, lambda phosphatase. We first examined ULK1 to see whether its electrophoretic mobility shift was due to its phosphorylation in mitosis by using immunoprecipitation from ULK1-expressing cell lines. Because mouse ULK1 (mULK1) has been validated in multiple studies in human cells [5,6,18,19,23], we constructed human embryonic kidney 293T (HEK-293T) cell lines overexpressing FLAG-tagged mULK1 (Q6PB82 in Uniprot, BC059835 in GenBank) or green fluorescent protein (GFP) control. The immunoprecipitated ULK1 shows an obvious band shift in mitosis both on the Coomassie brilliant blue–stained gel as well as on western blot (Fig 1C). Using a general anti-phosphoserine/threonine antibody [24,25], our results indicate that ULK1 is highly phosphorylated on serine/threonine in mitotic cells compared with asynchronous cells (Fig 1C). Then, we treated the ULK1 immunoprecipitation products with lambda phosphatase in the presence or absence of its inhibitors (Fig 1D). The FLAG-tagged mULK1 band was downshifted by lambda phosphatase treatment, which can be reversed by phosphatase inhibitors. The same pattern occurs with the phosphoserine/threonine antibody–detected band (Fig 1D). These results confirmed that the electrophoretic mobility upshift of ULK1 in mitosis is due to its phosphorylation. To rule out the possibility that the band shift was caused by nocodazole-induced microtubule disruption, but not mitosis per se, we used a specific Eg5 inhibitor STLC [26] to synchronize HeLa cells to mitosis. We found that STLC could induce ULK1 band shift similar to nocodazole treatment, although to a lesser extent (Fig 1E). The dramatic band shift phenomena were also verified for endogenous ULK1 in human colorectal cancer cells (HCT 116) and human retinal pigmented epithelial cells (RPE1) (Fig 1F), as well as endogenous ULK1 and exogenous mULK1 in HEK-293T and HeLa cells (S1A and S1B Fig). Therefore, ULK1 is highly phosphorylated in mitosis of multiple cell types. It should be mentioned that the original antibody we used for ULK1 (Cell signaling technology, #8054) did not detect the upshifted band but only showed decreased signal in mitosis (S1C Fig, the upper blot). However, it is interesting that when the polyvinylidene fluoride (PVDF) membrane was treated with lambda phosphatase to remove the phosphorylation, the upshifted band appeared (S1C Fig, the lower blot), which indicates that the mitotic ULK1 phosphorylation might interfere with the recognition of this specific antibody. Therefore, for all work other than indicated, we used another ULK1 antibody (Cell Signaling Technology, #4776) instead because it is consistent with the FLAG antibody recognition pattern (detecting the FLAG-tagged mULK1) as well as Coomassie staining in the FLAG-mULK1-expressing cells (Fig 1C).

ULK1-ATG13 can be recognized by CDK substrate phosphorylation antibodies

Because phosphorylation-induced mobility shift is often indicative of phosphorylation on serine/threonine-proline residues [27], we first used Scansite 3 (Michael B. Yaffe Laboratory—Koch Institute, MIT) (http://scansite3.mit.edu/) to predict the potential kinases with proline-directed serine/threonine motif preference (the minimal consensus motif S/T-P, the optimal sequence S/T-P-X-R/K) [28,29], which revealed CDK1, CDK5, and mitogen-activated protein kinase 1/3 (MAPK1/3) as potential candidates for ULK1. We also constructed ATG13-overexpressing (O75143-2 in Uniprot, BC002378 in GenBank) cell line and performed immunoprecipitation in synchronized 293T cells overexpressing FLAG-tagged mULK1, ATG13, or GFP control (Fig 2A and 2B). Then, we examined the ULK1 or ATG13 immunoprecipitation products using motif antibodies for phospho mitogen-activated protein kinase (p-MAPK)/CDK substrate (PXS*P or S*PXR/K), p-CDK substrate [(K/H)pSP], and phospho-threonine-proline [30-32]. In fact, both the ULK1/FLAG antibodies and the CDK or MAPK/CDK substrate-specific phosphorylation antibodies could recognize a significant amount of ULK1 or ATG13 in both upshifted and nonshifted bands in mitotic cells compared with cells in other phases, which further indicates that ULK1-ATG13 was differentially regulated at both protein and phosphorylation levels during cell cycle (Fig 2A and 2B).
Fig 2

ULK1-ATG13 can be recognized by CDK substrate phosphorylation antibodies.

(A-B) ULK1-ATG13 upshifted band in mitosis could be recognized by CDK substrate-specific antibodies. The 293T cells stably expressing FLAG-tagged mULK1 or ATG13 were synchronized by single-thymidine and released in the presence or absence of nocodazole. The coimmunoprecipitates and input were immunoblotted with specific antibodies. The phospho-signal was quantified relative to the FLAG antibody–detected bands (mULK1/ATG13-3FLAG) in IP; the IP signal of mULK1/ATG13-3FLAG was quantified relative to its input. Various cell cycle markers were detected to show the respective phases of cell cycle. ATG, autophagy-related; CDK, cyclin-dependent kinase; FIP200, FAK family-interacting protein of 200 kDa; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; IP, immunoprecipitation; mULK1, mouse ULK1; p-MAPK, phospho mitogen-activated protein kinase; ULK1, unc-51-like autophagy activating kinase 1.

ULK1-ATG13 can be recognized by CDK substrate phosphorylation antibodies.

(A-B) ULK1-ATG13 upshifted band in mitosis could be recognized by CDK substrate-specific antibodies. The 293T cells stably expressing FLAG-tagged mULK1 or ATG13 were synchronized by single-thymidine and released in the presence or absence of nocodazole. The coimmunoprecipitates and input were immunoblotted with specific antibodies. The phospho-signal was quantified relative to the FLAG antibody–detected bands (mULK1/ATG13-3FLAG) in IP; the IP signal of mULK1/ATG13-3FLAG was quantified relative to its input. Various cell cycle markers were detected to show the respective phases of cell cycle. ATG, autophagy-related; CDK, cyclin-dependent kinase; FIP200, FAK family-interacting protein of 200 kDa; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; IP, immunoprecipitation; mULK1, mouse ULK1; p-MAPK, phospho mitogen-activated protein kinase; ULK1, unc-51-like autophagy activating kinase 1.

ULK1 is a direct substrate of CDK1/cyclin B in mitosis

Because those aforementioned phospho-specific motif antibodies are not strictly specific, we hypothesized that the phospho-signal of ULK1 observed during thymidine release process is possibly due to the kinase activity of CDK1-cyclin B in mitosis and other CDKs or CDK1-cyclin A during S-G2 phase [33,34]. To find out the exact upstream kinase of ULK1 specifically in mitosis, we used various kinase inhibitors (Fig 3A), including multiple Aurora kinases inhibitors Hesperadin, GSK1070916, MLN8237, and AZD1152-HQPA [35-38]; mammalian-target-of rapamycin complex 1 (mTORC1) inhibitor rapamycin [39]; and CDKs inhibitors PHA793887, AZD5438, and RO-3306 [22,40,41], to examine their effects on mitotic ULK1 mobility shift (Fig 3B). Although none of the mTORC1, CDK2, CDK5, or CDK7 inhibitors could significantly reduce the ULK1 mobility shift, it was interesting that both CDK1 inhibitors AZD5438 and RO-3306 completely abolished the shift, whereas the CDK2/5/7 inhibitor PHA793887 did not (Fig 3B, the upper panel). In addition, although most Aurora kinases inhibitors have no effect, the Aurora A inhibitor MLN8237 moderately reduced ULK1 band shift. However, we found that the other 2 Aurora A inhibitors, MLN8054 and Aurora A inhibitor I, did not have such effect (S2A Fig). Moreover, because treating cells with Aurora or CDK1 inhibitors for 1.5 hours could induce loss of mitotic cells, which was shown by phospho histone H3 serine 10 [pH3(S10)], one of the most commonly used mitotic markers [42,43], or cyclin B1 reduction (Fig 3B and S2 Fig), the Aurora A inhibitor MLN8237-induced ULK1 mobility change is likely caused by cell cycle alteration. The fact that MLN8237 treatment for a shorter time (1 or 0.5 hours) did not cause ULK1 band shift change or cyclin B1 reduction (S2B Fig) further supports that Aurora A is less likely to be the upstream kinase for ULK1. However, when we treated the mitotic HeLa cells with RO-3306 for as short as 3 minutes, which did not reduce the pH3(S10) or cyclin B1 level (Fig 3B, the lower panel), we still observed the significant reduction of mitotic ULK1 mobility shift. Therefore, CDK1 is likely the major ULK1 upstream kinase that is responsible for its mobility shift in mitosis.
Fig 3

ULK1 is a substrate of CDK1/cyclin B in mitosis.

(A) Illustration of cell synchronization and kinase inhibitors treatment. HeLa cells were synchronized with single-thymidine and nocodazole. Kinase inhibitors were added for different timepoints, ranging from 3 minutes to 1.5 hours. (B) CDK1 inhibitors, but not Aurora kinase, mTORC1, and other CDK inhibitors, abolished the ULK1 band shift in mitosis. HeLa cells synchronized and treated as (A) were subjected to western blot analysis. (C-D) ULK1 coimmunoprecipitates with CDK1 and vice versa. 293T cells stably overexpressing FLAG-tagged mULK1 or CDK1 were synchronized with single-thymidine and nocodazole and the coimmunoprecipitates were subjected to western blot analysis. (E) ULK1 is upshifted and phosphorylated by purified CDK1/cyclin B complex in vitro. Purified CDK1/cyclin B complex as kinase and the ULK1 immunoprecipitates from asynchronous 293T cells overexpressing FLAG-tagged mULK1 as substrate with or without RO-3306 were subjected to in vitro kinase assay and western blot analysis. CDK, cyclin-dependent kinases; CST, Cell Signaling Technology; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; IP, immunoprecipitation; mTORC1, mammalian target-of-rapamycin complex 1; mULK1, mouse ULK1; PVDF, polyvinylidene fluoride; ULK1, unc-51-like autophagy activating kinase 1; λ-PP, lambda phosphatase.

ULK1 is a substrate of CDK1/cyclin B in mitosis.

(A) Illustration of cell synchronization and kinase inhibitors treatment. HeLa cells were synchronized with single-thymidine and nocodazole. Kinase inhibitors were added for different timepoints, ranging from 3 minutes to 1.5 hours. (B) CDK1 inhibitors, but not Aurora kinase, mTORC1, and other CDK inhibitors, abolished the ULK1 band shift in mitosis. HeLa cells synchronized and treated as (A) were subjected to western blot analysis. (C-D) ULK1 coimmunoprecipitates with CDK1 and vice versa. 293T cells stably overexpressing FLAG-tagged mULK1 or CDK1 were synchronized with single-thymidine and nocodazole and the coimmunoprecipitates were subjected to western blot analysis. (E) ULK1 is upshifted and phosphorylated by purified CDK1/cyclin B complex in vitro. Purified CDK1/cyclin B complex as kinase and the ULK1 immunoprecipitates from asynchronous 293T cells overexpressing FLAG-tagged mULK1 as substrate with or without RO-3306 were subjected to in vitro kinase assay and western blot analysis. CDK, cyclin-dependent kinases; CST, Cell Signaling Technology; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; IP, immunoprecipitation; mTORC1, mammalian target-of-rapamycin complex 1; mULK1, mouse ULK1; PVDF, polyvinylidene fluoride; ULK1, unc-51-like autophagy activating kinase 1; λ-PP, lambda phosphatase. Next, we examined the in vivo association between ULK1 and CDK1 to further confirm their kinase–substrate relationship. ULK1 immunoprecipitation revealed that CDK1 and its mitotic partner cyclin B1 can be coimmunoprecipitated by ULK1 (Fig 3C). Reciprocally, we also established a FLAG-tagged CDK1–overexpressing 293T cell line and found that ULK1 could also be coimmunoprecipitated by the FLAG-CDK1 (Fig 3D), which further confirmed that CDK1 interacts with ULK1. Importantly, we also performed in vitro kinase assay using purified CDK1/cyclin B kinase complex and immunoprecipitates using FLAG antibody from 293T ULK1-knockout (KO) cells reconstituted with FLAG-mULK1. We found that ULK1 could be highly phosphorylated and upshifted by CDK1/cyclin B complex, which could be antagonized by the CDK1 inhibitor RO-3306 (Fig 3E). All these results confirm that ULK1 is a direct substrate of CDK1. To further investigate ULK1 in mitosis, we constructed ULK1-KO HeLa and 293T cells using CRISPR/Cas9 (S3A and S3B Fig). Moreover, because ULK1 could be autophosphorylated, the kinase-dead ULK1-K46I mutant [19,44] was also investigated. Using HeLa ULK1-KO cells reconstituted with FLAG-ULK1-K46I, our results show that ULK1-K46I could undergo mobility shift and mitotic phosphorylation as well (S3C and S3D Fig). Consistent with the cellular experiments (S3C and S3D Fig), in vitro kinase assay also suggested that CDK1/cyclin B could phosphorylate ULK1-K46I and induce its band shift (S3E Fig). Therefore, the ULK1 phosphorylation in mitosis is independent of ULK1 kinase activity. Additionally, ULK2, a member of ULK1 kinase family, was also found to be phosphorylated in mitosis, which can be recognized by CDK substrate phosphorylation antibody and FLAG antibody (detecting FLAG-tagged mULK2, mULK2-3FLAG) (S4 Fig).

ATG13 is also a direct substrate of CDK1/cyclin B in mitosis

As mentioned earlier, ATG13 has the same electrophoretic mobility shift in mitosis as ULK1 does. However, another component of the ULK1 complex, the ULK1-interacting protein FIP200 [45], did not show mitotic mobility shift (Fig 4A). We also found that the upstream kinase of both ULK1 and ATG13 in interphase, AMPK, does not contribute to the mitotic mobility shift, as demonstrated by the results of an AMPK inhibitor Compound C [46] (Fig 4B). In contrast, similar to ULK1, ATG13 mobility shift in mitosis was decreased by the CDK1/cyclin B–specific inhibitor RO-3306 (Fig 4C and S5A Fig), which was further confirmed by coimmunoprecipitation (S5B Fig). These demonstrate that mitotic ATG13 is also phosphorylated by CDK1.
Fig 4

ATG13 is a substrate of CDK1/cyclin B in mitosis.

(A) Mitotic ATG13 undergoes mobility upshift in mitosis in electrophoresis. The 293T cells overexpressing FLAG-tagged mULK1 or GFP were synchronized by single-thymidine in the presence or absence of nocodazole and coimmunoprecipitated by the FLAG antibody followed by western blot analysis. Size of endogenous ATG and expressed FLAG-tagged ATG13 were not distinguishable in electrophoresis here. (B) The effect of AMPK inhibition on ULK1 and ATG13 mobility shift in mitosis. The AMPK inhibitor Compound C was used to evaluate the role of AMPK on ULK1 or ATG13 mobility shift as Fig 3B. Phospho-AMPKα-T172 and phospho-Acetyl-CoA Carboxylase (Ser79) were used to indicate AMPK inhibition. (C) CDK1 inhibitor RO-3306 decreases the ATG13 band shift in mitosis. HeLa cells synchronized and treated as Fig 3A were subjected to western blot analysis. (D) ATG13 is phosphorylated and interacts with CDK1/cyclin B1 in mitosis. The 293T cells overexpressing FLAG-tagged ATG13 were synchronized by single-thymidine in the presence or absence of nocodazole. The coimmunoprecipitates by FLAG antibody were subjected to western blot analysis. (E-F) ATG13 is directly phosphorylated by purified CDK1/cyclin B complex in vitro. The ATG13 immunoprecipitates from asynchronous 293T cells overexpressing FLAG-tagged ATG13 or ULK1 and purified CDK1/cyclin B complex were subjected to in vitro kinase assay with or without RO-3306 followed by western blot analysis. (E) shows representative western blot analysis of the ATG13 immunoprecipitates as substrate, and (F) shows the representative western blot analysis of the ULK1-WT coimmunoprecipitates as substrate. AMPK, AMP-activated protein kinase; ATG, autophagy-related; CDK, cyclin-dependent kinase; FIP200, FAK family-interacting protein of 200; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; IP, immunoprecipitation; mULK1, mouse ULK1; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type.

ATG13 is a substrate of CDK1/cyclin B in mitosis.

(A) Mitotic ATG13 undergoes mobility upshift in mitosis in electrophoresis. The 293T cells overexpressing FLAG-tagged mULK1 or GFP were synchronized by single-thymidine in the presence or absence of nocodazole and coimmunoprecipitated by the FLAG antibody followed by western blot analysis. Size of endogenous ATG and expressed FLAG-tagged ATG13 were not distinguishable in electrophoresis here. (B) The effect of AMPK inhibition on ULK1 and ATG13 mobility shift in mitosis. The AMPK inhibitor Compound C was used to evaluate the role of AMPK on ULK1 or ATG13 mobility shift as Fig 3B. Phospho-AMPKα-T172 and phospho-Acetyl-CoA Carboxylase (Ser79) were used to indicate AMPK inhibition. (C) CDK1 inhibitor RO-3306 decreases the ATG13 band shift in mitosis. HeLa cells synchronized and treated as Fig 3A were subjected to western blot analysis. (D) ATG13 is phosphorylated and interacts with CDK1/cyclin B1 in mitosis. The 293T cells overexpressing FLAG-tagged ATG13 were synchronized by single-thymidine in the presence or absence of nocodazole. The coimmunoprecipitates by FLAG antibody were subjected to western blot analysis. (E-F) ATG13 is directly phosphorylated by purified CDK1/cyclin B complex in vitro. The ATG13 immunoprecipitates from asynchronous 293T cells overexpressing FLAG-tagged ATG13 or ULK1 and purified CDK1/cyclin B complex were subjected to in vitro kinase assay with or without RO-3306 followed by western blot analysis. (E) shows representative western blot analysis of the ATG13 immunoprecipitates as substrate, and (F) shows the representative western blot analysis of the ULK1-WT coimmunoprecipitates as substrate. AMPK, AMP-activated protein kinase; ATG, autophagy-related; CDK, cyclin-dependent kinase; FIP200, FAK family-interacting protein of 200; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; IP, immunoprecipitation; mULK1, mouse ULK1; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. Next, we performed coimmunoprecipitation to examine the interaction between ATG13 and ULK1 or CDK1 in 293T cells overexpressing FLAG-ATG13. Phospho-antibodies of both proline -directed phosphoserine and threonine showed significant signal increase for the mitotic ATG13 (Fig 4D). The electrophoretic mobility shift was also apparent. Moreover, both CDK1 and cyclin B1 could be coimmunoprecipitated by ATG13 (Fig 4D), which confirmed the interactions among ATG13, ULK1, and CDK1/cyclin B1. Because ATG13 is a substrate of ULK1 [47], it is possible that ULK1 phosphorylates ATG13 to regulate its mobility shift in mitosis. However, ULK1 kinase activity is dispensable for ATG13 mitotic mobility shift according to the data from kinase-dead ULK1-K46I-expressing cells (S3D Fig, the input and IP for ATG13). It should be mentioned that in mitosis, the extent of ATG13 band shift is indistinguishable between ULK1-KO and ULK1-overexpression cell lines but is abrogated by RO-3306 (S5C Fig, ATG13 blot of lane 1/2 and lane 3/4). This indicates that ATG13 phosphorylation-associated electrophoretic mobility shift in mitosis is dependent on CDK1/cyclin B kinase activity but not its well-known kinase ULK1, which is consistent with the ULK1-K46I data (S3D Fig). However, cells with ULK1-KO had downshifted ATG13 compared with cells exogenously expressing ULK1 (S5D Fig, ATG13 blot of lane 1/2 and lane 3/4) because ULK1 phosphorylates ATG13 in asynchronous conditions [47]. In fact, in vitro kinase assay demonstrates that ATG13 could be directly phosphorylated and upshifted by purified CDK1/cyclin B kinase complex, which is confirmed by the upshifted/phosphorylated ATG13 band using both ATG13 immunoprecipitates and ULK1 coimmunoprecipitates as substrates (Fig 4E and 4F).

ULK1 and ATG13 phosphorylation sites in mitosis by CDK1/cyclin B

To identify the ULK1 phosphorylation sites in mitosis, we combined Scansite prediction and mass spectrometry analysis. We first selected 3 potential sites of mouse-derived ULK1, serine 622, threonine 635, and threonine 653, because they had high scores in Scansite prediction for proline-dependent serine/threonine kinase group (Pro_ST_kin), and their phosphorylation signals were also specifically identified in mitotic cells by mass spectrometry analysis (Fig 5A). Site-directed mutagenesis was used to mutate these sites from serine/threonine to unphosphorylatable alanine in FLAG-mULK1. Using 293T cells stably expressing FLAG-GFP as control, immunoprecipitation for FLAG-tagged mULK1-S622A/T635A/T653A mutants was conducted in both asynchronous and mitotic cells. Although none of the single mutations obviously disrupted ULK1 phosphorylation or band shift in mitosis (Fig 5B), S622A&T635A&T653A triple mutant significantly decreased the electrophoretic mobility shift compared with wild-type (WT) ULK1 (Fig 5C).
Fig 5

ULK1 and ATG13 phosphorylation sites in mitosis by CDK1/cyclin B.

(A) The mitotic-specific phosphorylated sites identified by MS in mitotic mULK1 compared with asynchronous mULK1. (B-C) S622/T635/T653 phosphorylation contributes to ULK1 mobility shift in mitosis. The 293T cells overexpressing FLAG-tagged mULK1-S622/T635/T653 mutants were synchronized with single-thymidine and nocodazole. Then immunoprecipitation for single mutant with FLAG antibody (B) or western blot analysis for double and triple mutant (C) was performed. (D-E) More sites contribute to ULK1 band shift. Based on triple 3A mutant, the other 8 Ser/Thr sites were mutated into Ala. The 293T cells expressing various mutants were synchronized into mitosis with thymidine and nocodazole for immunoprecipitation by FLAG antibody and western blot analysis. (F) ULK1-11A mutant was not upshifted or phosphorylated by CDK1/cyclin B kinase complex in vitro. The ULK1-11A mutant immunoprecipitates from asynchronous 293T cells overexpressing FLAG-tagged mULK1 and purified CDK1/cyclin B complex were tested in an in vitro kinase assay and western blot analysis. (G) The phosphorylated sites identified by MS in mitotic ATG13 compared with asynchronous ATG13. (H-I) ATG13-T342/T332/S44/S224 phosphorylation contributes to ATG13 mobility shift in mitosis. HeLa-ATG13 KO cells (H) or 293T cells (I) overexpressing FLAG-tagged ATG13-T342/T332/S44/S224 mutants were synchronized with single-thymidine and nocodazole. Then western blot analysis for 4-site mutant (H) or immunoprecipitation and input for mutants with FLAG antibody (I) was performed. 3A, S622/T635/T653A; 5A, 3A-S479&S543A; 7A, 5A-S411&S413A; 9A, 5A-S413&T401&S403&S405A; 10A, 9A-T282A; 11A, 10A-T502A; ATG, autophagy-related; CDK, cyclin-dependent kinase; GFP, green fluorescent protein; IP, immunoprecipitation; MS, mass spectrometry; mULK1, mouse ULK1; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type.

ULK1 and ATG13 phosphorylation sites in mitosis by CDK1/cyclin B.

(A) The mitotic-specific phosphorylated sites identified by MS in mitotic mULK1 compared with asynchronous mULK1. (B-C) S622/T635/T653 phosphorylation contributes to ULK1 mobility shift in mitosis. The 293T cells overexpressing FLAG-tagged mULK1-S622/T635/T653 mutants were synchronized with single-thymidine and nocodazole. Then immunoprecipitation for single mutant with FLAG antibody (B) or western blot analysis for double and triple mutant (C) was performed. (D-E) More sites contribute to ULK1 band shift. Based on triple 3A mutant, the other 8 Ser/Thr sites were mutated into Ala. The 293T cells expressing various mutants were synchronized into mitosis with thymidine and nocodazole for immunoprecipitation by FLAG antibody and western blot analysis. (F) ULK1-11A mutant was not upshifted or phosphorylated by CDK1/cyclin B kinase complex in vitro. The ULK1-11A mutant immunoprecipitates from asynchronous 293T cells overexpressing FLAG-tagged mULK1 and purified CDK1/cyclin B complex were tested in an in vitro kinase assay and western blot analysis. (G) The phosphorylated sites identified by MS in mitotic ATG13 compared with asynchronous ATG13. (H-I) ATG13-T342/T332/S44/S224 phosphorylation contributes to ATG13 mobility shift in mitosis. HeLa-ATG13 KO cells (H) or 293T cells (I) overexpressing FLAG-tagged ATG13-T342/T332/S44/S224 mutants were synchronized with single-thymidine and nocodazole. Then western blot analysis for 4-site mutant (H) or immunoprecipitation and input for mutants with FLAG antibody (I) was performed. 3A, S622/T635/T653A; 5A, 3A-S479&S543A; 7A, 5A-S411&S413A; 9A, 5A-S413&T401&S403&S405A; 10A, 9A-T282A; 11A, 10A-T502A; ATG, autophagy-related; CDK, cyclin-dependent kinase; GFP, green fluorescent protein; IP, immunoprecipitation; MS, mass spectrometry; mULK1, mouse ULK1; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. Because even the triple mutant did not completely abolish the band shift, we further mutated more predicted sites in the triple mutant (S622/T635/T653A [3A]) background. It shows that the 11A (S622&T635&T653&S479&S543&S413&T401&S403&S405&T282&T502A) mutant collapsed the electrophoretic mobility shift and abolished ULK1 phosphorylation (as indicated by the p-Thr-Pro signal in Fig 5E) in mitosis, whereas the other mutants, including the 3A-S479&S543A (5A), 5A-S411&S413A (7A), 5A-S413&T401&S403&S405A (9A), and 9A-T282A (10A), still have detectable phosphorylation signals and upshift in mitosis (Fig 5D and 5E). Importantly, in vitro kinase assay using purified CDK1/cyclin B proteins also showed that the extent of upshift for ULK1-11A is much less compared with ULK1-WT (Fig 5F). Therefore, besides the 3 major sites (S622A/T635A/T653A), CDK1/cyclin B phosphorylates multiple other sites of ULK1 in mitosis. In addition, using mass spectrometry and site-directed mutagenesis, specific phosphorylation sites of mouse ULK2 in mitosis were also preliminarily identified (S6A–S6C Fig). As for ATG13, we also combined Scansite prediction and mass spectrometry analysis, which identified 4 sites, ATG13-T342/T332/S44/S224 (Fig 5G). To confirm the ATG13 phosphorylation sites in mitosis, we constructed their alanine mutants in ATG13-KO HeLa cell line (Fig 5H and S7 Fig). Site-directed mutagenesis, western blot analysis, and immunoprecipitation were combined for site verification (Fig 5H and 5I), and we found that the 4-site mutant significantly decreased the electrophoretic mobility shift and the phosphoserine/threonine-proline signals compared with WT ATG13 (Fig 5I). It should be noted that the phosphorylation sites we identified in both ULK1 and ATG13 are conserved between different isoforms (S8A and S8B Fig). Moreover, because it is well established that mTOR and AMPK regulate autophagy through ULK1/ATG13 in asynchronous cells [18,19], we summarize the known phosphorylation sites of ULK1 and ATG13 (S9 Fig) and further examined whether their known fundamental sites of mTOR and AMPK [18-21] contributed to ULK1/ATG13 band shifts in mitosis. Our results show that ULK1-S757/S637/S555 did not obviously contribute to ULK1 band shift (S10A Fig). For ATG13, we observed some mobility shift changes caused by S224 mutation because S224 is a common site for both CDK1 and AMPK (S10B Fig).

CDK1 phosphorylates ULK1-ATG13 to increase mitotic autophagy

Although ULK1-ATG13 complex is a key autophagy regulator, its function has only been investigated in asynchronous cells. To unravel the function of these phosphorylation events that occur specifically in mitosis, we constructed ULK1 and ATG13 double WT or mutant cell line in HeLa ULK1&ATG13 double knockout (DKO) parental cell line (S11 Fig). We found that ULK1 or ATG13 was diffusely distributed in mitotic cells, which were not affected by ULK1/ATG13 alanine mutations (Fig 6A). Given that ATG13-Ser355 phosphorylation was used to evaluate ULK1 kinase activity [47], which is verified by the lack of phospho-signal in cells expressing kinase-dead K46I ULK1 (Fig 6B, lane 1), we found that the 11A mutation did not affect ULK1 kinase activity (Fig 6B, lanes 2 and 3).
Fig 6

ULK1-ATG13 phosphorylation in mitosis promotes mitotic autophagy.

(A) The localization of mutant ULK1-11A and ATG13-4A in mitosis. Cells released from thymidine block for 10 hours were fixed with 3.7% formaldehyde for 20 minutes at room temperature and then for blocking and FLAG antibody, Alexa-488 conjugated secondary antibody, DAPI staining. Scale bar, 10 μm. (B) The ULK1 kinase activity is not affected by the 11A mutation. ATG13-Ser355 is the substrate of ULK1, which corresponds to Ser318 of ATG13 isoform 2. ULK1-KO 293T cells reconstituted with ULK1-WT, ULK1-11A, or ULK1-K46I were plated and lysed with M-PER. The western blot for ATG13-Ser355 indicated that ULK1 activity was not affected by 11A mutation. n = 3. (C) Autophagy activity was examined in ULK1&ATG13 double WT or mutant (“Mut”) cells expressing GFP-LC3-RFP by flow cytometry. ULK1&ATG13 double WT or mutant cells, HeLa, or HeLa- ULK1&ATG13 DKO cells stably expressing GFP-LC3-RFP were established by infection of retrovirus packaged by pMRX-IP-GFP-LC3-RFP and helper plasmids Vsvg and pMLV. Mitotic cells were collected by shake-off from thymidine and nocodazole synchronized cells for flow cytometry detection. The GFP/RFP ratio inversely correlated with autophagy activity. n = 4, ***p < 0.001, ****p < 0.0001. (D) The autophagic flux of HeLa-DKO cells stably overexpressing double WT or mutant FLAG-tagged mULK1 and ATG13. Cells synchronized to mitosis with thymidine and nocodazole were shaken off and treated with or without autophagy inhibitor 25 μM CQ for 1 hour. The left panel is a representative western blot, and the right panel is the statistical result for LC3B-II and p62. n = 3, *p < 0.05, **p < 0.01. (E) LC3B puncta number was counted, and the micrographs were captured by Zeiss LSM710 confocal microscope. Scale bar, 10 μm. n = 43, **p < 0.01. Numerical data underlying the figure panels are available in S1 Data. 4A, T342/T332/S44/S224A; 11A, S622&T635&T653&S479&S543&S413&T401&S403&S405&T282&T502A; ATG, autophagy-related; CQ, chloroquine; Ctrl, control; DAPI, 4 DAPdiamidino-2-phenylindole; DKO, double knockout; GFP, green fluorescent protein; KO, knockout; M-PER, Mammalian Protein Extraction Reagent; mULK1, mouse ULK1; n.s., not significant; RFP, red fluorescent protein; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type.

ULK1-ATG13 phosphorylation in mitosis promotes mitotic autophagy.

(A) The localization of mutant ULK1-11A and ATG13-4A in mitosis. Cells released from thymidine block for 10 hours were fixed with 3.7% formaldehyde for 20 minutes at room temperature and then for blocking and FLAG antibody, Alexa-488 conjugated secondary antibody, DAPI staining. Scale bar, 10 μm. (B) The ULK1 kinase activity is not affected by the 11A mutation. ATG13-Ser355 is the substrate of ULK1, which corresponds to Ser318 of ATG13 isoform 2. ULK1-KO 293T cells reconstituted with ULK1-WT, ULK1-11A, or ULK1-K46I were plated and lysed with M-PER. The western blot for ATG13-Ser355 indicated that ULK1 activity was not affected by 11A mutation. n = 3. (C) Autophagy activity was examined in ULK1&ATG13 double WT or mutant (“Mut”) cells expressing GFP-LC3-RFP by flow cytometry. ULK1&ATG13 double WT or mutant cells, HeLa, or HeLa- ULK1&ATG13 DKO cells stably expressing GFP-LC3-RFP were established by infection of retrovirus packaged by pMRX-IP-GFP-LC3-RFP and helper plasmids Vsvg and pMLV. Mitotic cells were collected by shake-off from thymidine and nocodazole synchronized cells for flow cytometry detection. The GFP/RFP ratio inversely correlated with autophagy activity. n = 4, ***p < 0.001, ****p < 0.0001. (D) The autophagic flux of HeLa-DKO cells stably overexpressing double WT or mutant FLAG-tagged mULK1 and ATG13. Cells synchronized to mitosis with thymidine and nocodazole were shaken off and treated with or without autophagy inhibitor 25 μM CQ for 1 hour. The left panel is a representative western blot, and the right panel is the statistical result for LC3B-II and p62. n = 3, *p < 0.05, **p < 0.01. (E) LC3B puncta number was counted, and the micrographs were captured by Zeiss LSM710 confocal microscope. Scale bar, 10 μm. n = 43, **p < 0.01. Numerical data underlying the figure panels are available in S1 Data. 4A, T342/T332/S44/S224A; 11A, S622&T635&T653&S479&S543&S413&T401&S403&S405&T282&T502A; ATG, autophagy-related; CQ, chloroquine; Ctrl, control; DAPI, 4 DAPdiamidino-2-phenylindole; DKO, double knockout; GFP, green fluorescent protein; KO, knockout; M-PER, Mammalian Protein Extraction Reagent; mULK1, mouse ULK1; n.s., not significant; RFP, red fluorescent protein; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. Next, we examined the effects of these alanine mutations on autophagy. First, we constructed GFP-LC3-red fluorescent protein (RFP) stable cell lines in which the GFP/RFP signal ratio reciprocally correlates with autophagic activity [48]. According to both the relative GFP/RFP ratio and LC3-II turnover [3], the autophagy inhibition was confirmed for K46I kinase-dead mULK1 and ULK1-KO (S12A and S12B Fig), which is consistent with the known function of ULK1. Furthermore, we found that the autophagy activity was decreased in both ULK1&ATG13 double mutant cells and DKO cells (Fig 6C and S12C Fig). However, for ULK1 or ATG13 alone, the autophagy level was not affected in ULK1-11A mutant cells or only slightly decreased in ATG13-T342/T332/S44/S224A (4A) mutant cells (S12D and S12E Fig). Furthermore, we used autophagic flux to examine the amount of autophagic degradation to indicate autophagy activity. Autophagic flux inhibitors such as chloroquine (CQ) could cause autophagy marker LC3-II accumulation because of blocked LC3-II degradation [3]. We found that LC3B-II accumulation induced by CQ was decreased and p62 level was increased in ULK1&ATG13 mutant cell lines compared with the WT (Fig 6D). To get complementary information, LC3B puncta number was also counted by microscopy, which also showed that autophagy was decreased in ULK1&ATG13 mutant cells (Fig 6E). These results indicate that these alanine mutations of ULK1&ATG13 decreased mitotic autophagy activity. We also observed that CDK1 inhibition by RO-3306 induced higher autophagic activity in both asynchronous and mitotic cells (S12F Fig). This is probably due to the fact that CDK1 has multiple substrates, and the RO-3306 inhibition results reflected the integrated effects of dephosphorylation of all the substrates on autophagy. For example, VPS34, AMPK, p62, and Raptor are all substrates of CDK1 [15,27,49,50] and also key autophagy regulators. Inhibition of CDK1 will release its inhibition on VPS34, which led to increased mitotic autophagic activity in a VPS34-dependent way [15]. In addition, RO-3306 could also inhibit other targets, including protein kinase C-delta (PKCδ) and serum/glucocorticoid-induced kinase (SGK), that inhibit autophagy [22,51,52], which could also lead to increased autophagic activity.

ULK1-ATG13 is required for cell cycle progression

Although ULK1-KO cells had similar cell cycle distribution compared with WT HeLa cells in asynchronized cellular experiments (S13A Fig), the S/G2 transition in ULK1-KO cells was slightly delayed in synchronized experiment (S13B Fig). Given that the G2 and M phases are not distinguishable by propidium iodide (PI) staining alone, we further used pH3(S10) to examine whether ULK1 functions in G2/M transition. Although no differences were detected for the G2/M percentage in asynchronous WT and ULK1-KO cells, the mitotic progression is significantly inhibited in ULK1-KO cells synchronized with thymidine and nocodazole. It was shown by the percentage of pH3(S10) positive cells using flow cytometry (S14A Fig) or western blot analysis for cell cycle markers (S14B Fig). The antibody for p-CDK Substrate Motif [30] recognizes the substrate of CDK, whose phosphorylation level reflects the CDK activity and is used as a mitotic marker. Besides, either the upshifted band of myelin transcription factor 1 (Myt1) or the lower phosphorylation level of Cdc2-Y15 in mitosis [53] could also be used as cell cycle progression markers. Given that ULK1 is a serine/threonine protein kinase, the contribution of ULK1 kinase activity to mitotic entry was examined in cell lines expressing WT ULK1 or kinase-dead ULK1-K46I mutant. Our results show that the ULK1 kinase activity has little effect on mitotic entry (S14C Fig). To further confirm the role of autophagy in cell cycle, ATG7-KO or ATG9A-KO cells were also constructed by CRISPR/Cas9. The mitotic entry delay was also detected in ATG7-KO or ATG9A-KO cells, which indicates that such effect is related to ATG7/ATG9A/ULK1-dependent autophagy but not ULK1 kinase activity–dependent autophagy (S14D and S14E Fig). ATG13 was reported to function in mitotic catastrophe [54]. Cell cycle analysis indicated that ATG13-KO inhibited G2/M transition and decreased the mitotic index (S15A and S15B Fig), indicating that ATG13 is involved in cell cycle regulation. Although it has been reported that ATG13 is required for the kinase activity of ULK1 [6], but the ULK1 kinase activity is not necessary for mitotic progression (S14C Fig). Therefore, the phenotype of the ATG13-KO cells is likely due to the lack of ATG13 rather than the ULK1 kinase activity impairment. To further investigate the role of ATG13 and ULK1 in cell cycle regulation, we combined ULK1-KO with ATG13 guide RNA (gRNA) transient transfection and found that the cell cycle progression was inhibited (S15C and S15D Fig). Further, ULK1&ATG13-DKO cell line showed significant delays in cell cycle progression (Fig 7A and S15E Fig) compared with ULK1 or ATG13 KO alone (S14A and S15A Figs). The immunoblotting of cell cycle markers verified the mitotic index and cell cycle distribution data (Fig 7B). To rule out the off-target effect, rescue assays were performed in KO cells with exogenously expressed ULK1-ATG13 for mitotic entry and cell doubling time measurement, which confirmed the specificity of ULK1 and ATG13 KO (S16A and S16B Fig). Furthermore, DKO interfered with cyclin B1 and pH3(S10) decrease more significantly than ULK1 or ATG13 single KO (Fig 7C), and the growth rate of HeLa-DKO cells was significantly slowed down compared with HeLa cells (Fig 7D), which indicates that ULK1-ATG13 work together as a complex to regulate cell cycle.
Fig 7

ULK1-ATG13 and their mitotic phospho-regulation by CDK1 are required for cell cycle progression.

(A) ULK1-ATG13 DKO inhibits S/G2 and G2/M transitions. HeLa WT or ULK1&ATG13-DKO cells synchronized into mitosis were subjected to PI and pH3(S10) co-staining for cell cycle and mitotic index analysis by flow cytometry. n = 3, *p < 0.05, **p < 0.01. (B) Representative western blot analysis suggests that ULK1&ATG13 DKO inhibits mitotic entry, which is shown by mitotic markers and CDK1 substrate phosphorylation. (C) Mitotic exit of ULK1, ATG13, or ULK1&ATG13 KO cells. Cells were synchronized into mitosis with thymidine and NOC and released into NOC-free complete DMEM medium for different timepoints and then subjected to either PI and pH3(S10) co-staining or cyclin B1 staining for cell cycle, mitotic index, and cyclin B1 level analysis by flow cytometry. n = 3, *p < 0.05, **p < 0.01. (D) ULK1&ATG13 DKO inhibits cell proliferation. HeLa WT or ULK1&ATG13 DKO cells were plated at 1 × 105 cells/mL and cultured for 1, 2, or 3 days. The cell number was counted by flow cytometry and the doubling time was calculated. TD indicates the average cell doubling time and is calculated as: TD = t*[lg2/(lgNt − lgN0)], where t is the culture time, Nt is the cell number after culturing, and N0 is the original cell number plated. n = 3, *p < 0.05, ***p < 0.001. (E-G) The role of ULK1-ATG13 phosphorylation in cell cycle progression and cell proliferation. ULK1&ATG13-DKO cells reconstituted with WT mULK1-3FLAG and ATG13-3FLAG or mutant (“Mut”) mULK1-11A and ATG13-4A, HeLa, or ULK1&ATG13-DKO cells were treated as (A)/(B) and (D). The mitotic exit (G1%) is the percentage of cells in G1 phase when released for indicated time. n = 3, **p < 0.01, ***p < 0.001. (H) The relative tumor volume growth curve of nude mice bearing different tumors with or without SBI-0206965. The nude mice were injected with cells (1 × 107) in 100 μL PBS/Matrigel Matrix (1:1). Seven days postimplantation, 5 mice in each group were injected with 0.5% (M/V) methyl cellulose or SBI-0206965 in 0.5% methyl cellulose (20 mg/kg/d) every day for 33 days. Tumor growth was evaluated every day and tumor volume was calculated as: volume = 1/2 (length × width2). (I) Tumor growth in nude mice bearing WT or KO cells with or without ULK1 kinase inhibitor SBI-0206965. The protocols were indicated as Fig 7H and the mice were sacrificed, and tumors were harvested and weighed up at the end of the experiment. n = 5, *p < 0.05, ***p < 0.001. Numerical data underlying the figure panels are available in S1 Data. 4A, T342/T332/S44/S224A; 11A, S622&T635&T653&S479&S543&S413&T401&S403&S405&T282&T502A; ATG, autophagy-related; CDK, cyclin-dependent kinase; DKO, double knockout; DMEM, Dulbecco’s Modified Eagle Medium; KO, knockout; mULK1, mouse ULK1; Myt1, myelin transcription factor 1; NOC, nocodazole; n.s., not significant; pH3(S10), phospho histone H3 serine 10; PI, propidium iodide; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type.

ULK1-ATG13 and their mitotic phospho-regulation by CDK1 are required for cell cycle progression.

(A) ULK1-ATG13 DKO inhibits S/G2 and G2/M transitions. HeLa WT or ULK1&ATG13-DKO cells synchronized into mitosis were subjected to PI and pH3(S10) co-staining for cell cycle and mitotic index analysis by flow cytometry. n = 3, *p < 0.05, **p < 0.01. (B) Representative western blot analysis suggests that ULK1&ATG13 DKO inhibits mitotic entry, which is shown by mitotic markers and CDK1 substrate phosphorylation. (C) Mitotic exit of ULK1, ATG13, or ULK1&ATG13 KO cells. Cells were synchronized into mitosis with thymidine and NOC and released into NOC-free complete DMEM medium for different timepoints and then subjected to either PI and pH3(S10) co-staining or cyclin B1 staining for cell cycle, mitotic index, and cyclin B1 level analysis by flow cytometry. n = 3, *p < 0.05, **p < 0.01. (D) ULK1&ATG13 DKO inhibits cell proliferation. HeLa WT or ULK1&ATG13 DKO cells were plated at 1 × 105 cells/mL and cultured for 1, 2, or 3 days. The cell number was counted by flow cytometry and the doubling time was calculated. TD indicates the average cell doubling time and is calculated as: TD = t*[lg2/(lgNt − lgN0)], where t is the culture time, Nt is the cell number after culturing, and N0 is the original cell number plated. n = 3, *p < 0.05, ***p < 0.001. (E-G) The role of ULK1-ATG13 phosphorylation in cell cycle progression and cell proliferation. ULK1&ATG13-DKO cells reconstituted with WT mULK1-3FLAG and ATG13-3FLAG or mutant (“Mut”) mULK1-11A and ATG13-4A, HeLa, or ULK1&ATG13-DKO cells were treated as (A)/(B) and (D). The mitotic exit (G1%) is the percentage of cells in G1 phase when released for indicated time. n = 3, **p < 0.01, ***p < 0.001. (H) The relative tumor volume growth curve of nude mice bearing different tumors with or without SBI-0206965. The nude mice were injected with cells (1 × 107) in 100 μL PBS/Matrigel Matrix (1:1). Seven days postimplantation, 5 mice in each group were injected with 0.5% (M/V) methyl cellulose or SBI-0206965 in 0.5% methyl cellulose (20 mg/kg/d) every day for 33 days. Tumor growth was evaluated every day and tumor volume was calculated as: volume = 1/2 (length × width2). (I) Tumor growth in nude mice bearing WT or KO cells with or without ULK1 kinase inhibitor SBI-0206965. The protocols were indicated as Fig 7H and the mice were sacrificed, and tumors were harvested and weighed up at the end of the experiment. n = 5, *p < 0.05, ***p < 0.001. Numerical data underlying the figure panels are available in S1 Data. 4A, T342/T332/S44/S224A; 11A, S622&T635&T653&S479&S543&S413&T401&S403&S405&T282&T502A; ATG, autophagy-related; CDK, cyclin-dependent kinase; DKO, double knockout; DMEM, Dulbecco’s Modified Eagle Medium; KO, knockout; mULK1, mouse ULK1; Myt1, myelin transcription factor 1; NOC, nocodazole; n.s., not significant; pH3(S10), phospho histone H3 serine 10; PI, propidium iodide; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. Next, we investigated the role of ULK1-ATG13 phosphorylation in cell cycle progression. Although ULK1 and/or ATG13 mutant did not affect cell cycle distribution, the mitotic entry was delayed (Fig 7E, S17A and S17D Fig). Although ULK1 or ATG13 mutant alone did not obviously affect mitotic exit (S17B and S17E Fig), ULK1-ATG13 double mutant could significantly decrease mitotic exit (Fig 7F). The cell proliferation was decreased by ULK1-ATG13 double mutant but not ULK1 or ATG13 mutant alone (Fig 7G, S17C and S17F Fig). These data also indicate that phosphorylated ULK1-ATG13 works together as a complex. To further test the effect of ULK1-ATG13 in vivo, nude mice bearing ULK1 and ATG13 single or double KO cells were established (S18A and S18B Fig). The tumor weight and volume of DKO group were significantly lower than all the other groups (Fig 7H and 7I). In contrast, ULK1 inhibitor SBI-0206965 [55] and/or ATG13-KO alone were not strong enough to inhibit tumor growth as efficiently as DKO (Fig 7H and 7I), indicating that targeting ULK1 and ATG13 together might be a potential anticancer strategy.

Discussion

ULK1-ATG13 complex is mainly phosphorylated by AMPK and mTORC1 in asynchronous conditions [18-21], but little was known about its regulation in mitosis. Here we found that the master cell cycle kinase CDK1 phosphorylates ULK1-ATG13 complex to regulate its function in autophagy and cell cycle. Besides their known function in autophagy, we also found that ULK1 and ATG13 coordinate to orchestrate cell cycle progression in both cell line and mouse models.

Kinases involved in both autophagy and mitosis

Recent literature indicates that there are some kinases that are involved in both autophagy and mitosis, which could bridge the autophagy and cell cycle regulation. Cell cycle kinases such as CDK1, Aurora A, and PLK-1 were found to regulate autophagy, whereas kinases originally found in autophagy control were shown to regulate mitosis as well, such as mTORC1 and AMPK [11,13]. In addition, increasing evidence shows that some other autophagic proteins such as Beclin-1, sequestosome 1 (SQSTM1)/p62, and gamma-aminobutyric acid receptor-associated protein (GABARAP) are related to mitotic events [10,50,56,57]. Although it has been reported that ULK3 (a member of ULK1 kinase family) could regulate cytokinesis and ATG13 could regulate colchicinamide-induced mitotic catastrophe [54,58], the roles of autophagy kinase complex ULK1-ATG13 in mitotic regulation were still unclear. Although previous reports implicated possible links between ULK1 and CDK1 [59,60], our study here is the first report that demonstrates CDK1 phosphorylates ULK1-ATG13 to promote mitotic autophagy and cell cycle progression. Although our results show that ULK1 and ATG13 function downstream of CDK1 as kinase and substrates, the data about ULK1-ATG13 DKO affecting cell cycle progression and the signal changes of “p-CDK substrate motif” in ULK1-ATG13 DKO cells raised the possibility that ULK1 and ATG13 might function upstream of CDK1. However, we found that the kinase-dead mutant of ULK1-K46I did not affect cell cycle, which indicates that ULK1 kinase activity is unlikely to affect CDK1 to influence cell cycle. The signal change of “p-CDK substrate motif” in ULK1-ATG13 DKO cells is possibly due to the cell cycle change, which has been confirmed by various mitotic markers such as pH3(S10), p-CDK substrate motif recognition, upshifted band of Myt1, and phosphorylation level of Cdc2-Y15. But we cannot exclude the possibility that ULK1-ATG13 could function upstream of CDK1 in a kinase activity–independent way, which remains to be investigated.

VPS34- and ULK1-ATG13 complex-dependent mitotic autophagy regulation

Although increasing evidence indicates that autophagy remains active in mitosis, the regulation mechanism was still unclear. Yuan’s group showed that activated CDK1 phosphorylates VPS34-Thr159 to inhibit VPS34-dependent autophagy in mitosis [15]. Our finding here demonstrates that CDK1 phosphorylates ULK1-ATG13 in mitosis to promote ULK1-ATG13-dependent autophagy, which at least partially contributed to the active autophagy state in mitosis, as reported in our previous study [14]. Therefore, it is likely that multiple autophagy regulators, not limited to the VPS34 complex and ULK1-ATG13 complex, contribute to the mitotic autophagy regulation, which certainly needs further investigations. In addition, by using ATG7- and ATG9A-KO cells, we found that autophagy is important for cell cycle progression in general. However, our data also show that ULK1-kinase activity–dependent autophagy is not essential for such effects, which implicates the dual roles of mammalian ULK1 as its homolog in Saccharomyces cerevisiae. Atg1 (the ULK1 homolog in S. cerevisiae) has kinase-dependent and kinase-independent dual roles in autophagy [61,62]. On the one hand, Atg1 protein itself plays a structural role in recruiting Atg proteins to the pre-autophagosomal structure (PAS), which does not require its kinase activity. On the other hand, Atg1 kinase activity is responsible for dissociation of Atg proteins from the PAS during autophagosome formation. The mammalian ULK1 may also have kinase activity–dependent and kinase activity–independent roles in autophagy. However, although ULK1 protein itself and its kinase activity are both important for autophagy, which are confirmed by decreased autophagic flux in ULK1-KO and ULK1-K46I cells using western blot and relative GFP/RFP level in GFP-LC3-RFP-expressing cells (S12A and S12B Fig), our cell cycle analysis indicates that the ULK1 kinase activity–dependent autophagy is dispensable for cell cycle regulation, whereas the structural role of ULK1 in autophagy is likely not.

ULK1/ATG13 phosphorylation by mTOR, AMPK, and CDK1

We found that the fundamental sites of mTOR and AMPK (S9 Fig) did not significantly contribute to ULK1/ATG13 band shifts in mitosis except S224 of ATG13, which is a common site of AMPK and CDK1. Although ATG13-S259 does not influence the extent of ATG13 band shift in mitosis, it affects ATG13 electrophoretic mobility in asynchronous cells, indicating that S259 is an important site of ATG13 in asynchronous cells, which is consistent with the previous report [20]. Although it is well known that mTOR and AMPK phosphorylate ULK1/ATG13 in asynchronous cells [18,19], we found that mTOR or AMPK inhibition did not affect ULK1/ATG13 band shift in mitosis. In fact, it should be mentioned that although our preprint manuscript (BioRxiv on May 2019) was in revision in this journal, Odle and colleagues published a work also showing that CDK1 could phosphorylate ULK1 and ATG13 in mitosis [63]. They performed in vitro assays and identified phosphorylation sites using a short truncation of ULK1 or ATG13 and proposed that CDK1 could substitute mTOR to phosphorylate ULK1/ATG13. However, our data show that those phosphorylation sites did not contribute to the mitotic band shifts of ULK1/ATG13, and their physiological functions are worth investigation in the future. In conclusion, we have revealed that CDK1/cyclin B could phosphorylate ULK1/ATG13 on multiple sites to cause a significant electrophoretic shift in mitosis. ULK1/ATG13 works as a complex to regulate mitotic autophagy and cell cycle progression, which provides molecular mechanisms not only for maintaining mitotic autophagy but also for linking autophagy to cell cycle regulation.

Materials and methods

Antibodies and reagents

The autophagy antibody sampler kit (#4445), ULK1 Antibody Sampler Kit (#8359), Autophagy Induction (ULK1 Complex) Antibody Sampler Kit (#46486), the cell cycle regulation antibody sampler kit II (#9870), Phospho-(Ser) Kinase Substrate Antibody Sampler Kit (#9615), Phospho-Threonine-Proline Mouse mAb (P-Thr-Pro-101) (#9391), anti-ULK1 (#4776) antibody, AMPK and ACC Antibody Sampler Kit (#9957), anti-p62 (#5114) antibody, anti-ATG13(S355) (#26839) antibody, anti-ATG7 (#8558) antibody, anti-ATG9A (#13509) antibody, the HRP-linked anti-rabbit, and anti-mouse IgG antibodies were all from Cell Signaling Technology. The anti-FLAG (F3165) antibody was acquired from Sigma and anti-β-Tubulin, anti-GAPDH, and anti-β-Actin antibodies from Beijing TransGen Biotech (Beijing, China). The plasmid pMRX-IP-GFP-LC3-RFP (#84573) was purchased from Addgene. The GlutaMAX supplement and puromycin dihydrochloride were from Gibco. The secondary fluorescently conjugated antibodies and anti-fade prolong Gold with DAPI were from Molecular Probes. Prestained Protein Ladder (26616) and M-PER buffer were from Thermo Pierce. RO-3306 and Thymidine were from Sigma. Compound C, Aurora A inhibitor I, nocodazole, and SBI-0206965 were from Selleckchem. MLN8054 was from MedChemExpress. Methyl cellulose (#69016260) was from Sinopharm Chemical Reagent Co. Matrigel Matrix (#354234) was from BD. Protease inhibitor and phosphatase inhibitor cocktails were from Roche and the PVDF membrane from Millipore.

Cell culture and stable cell lines establishment

HeLa, HCT 116, RPE1, and HEK-293T cells were all cultured in DMEM medium (without L-Glutamine) supplemented with 10% FBS, 2 mM GlutaMAX, and 1% penicillin/streptomycin (P/S). The plasmid for pBobi-FLAG-mULK1 contains 1 FLAG tag, and the affinity for FLAG antibody was lower than ULK1 antibody. Therefore, in order to enhance its affinity to FLAG antibody, 3×FLAG was added to mULK1 C-terminus [5]. Stable cell lines were constructed as described previously [64]. HEK-293T or HeLa cells stably expressing mULK1-3×FLAG were maintained in DMEM complete medium containing 1 μg/mL puromycin.

Autophagic probe GFP-LC3-RFP for autophagy activity detection

The GFP-LC3-RFP is inserted into the pMRX-IP vector [48] for retrovirus package with the helper plasmid Vsvg and pMLV. Cells were infected with retrovirus for stable cell line establishment as previously described [14]. For flow cytometry, cells were collected with trypsin treatment and placed on ice before GFP and RFP fluorescence intensity analysis. The relative GFP/RFP ratio is reciprocally correlated to the autophagy activity [48].

Immunofluorescence

The procedure was performed as described before [14]. HeLa ULK1-KO cells stably expressing FLAG-tagged mutant ULK1-11A and HeLa ATG13-KO cells stably expressing FLAG-tagged mutant ATG13-4A were grown on coverslips and released from thymidine block for 11 hours. Then cells were fixed with 3.7% formaldehyde at room temperature for 20 minutes and subsequently subjected to immunofluorescence using FLAG antibody and Alexa-488 conjugated anti-mouse IgG. HeLa-DKO cells stably expressing WT or mutant ULK1-ATG13 were released from thymidine block for 11 hours and treated with 25 μM CQ for another 1 hour. Then cells were fixed with −20 °C methanol for 5 minutes and subsequently subjected to immunofluorescence using LC3B antibody and Alexa-488 conjugated anti-rabbit IgG. Finally, cells were stained with 300 nM DAPI at room temperature for 2 minutes and then mounted with anti-fade prolong Gold for microscopy. Images were taken using the Zeiss confocal microscope LSM710, and representative micrographs are shown.

CRISPR/Cas9 technology

The gRNA targeted to human ULK1/ATG13 was designed with CRISPR Design (http://crispr.mit.edu), and the gRNA targeted to human ATG7/ATG9A was designed according to the literature [65,66]. The sequence (human ULK1: 5’-GCCCTTGAAGACCACCGCGA-3′; human ATG13: 5’-CACATGGACCTCCCGACTGC-3′; human ATG9A: 5’-CCGTTTCCAGAACTACATGG-3′; human ATG7: GCTGCCAGCTCGCTTAACAT) was selected and subcloned into PX458 vector. HeLa and HEK-293T cells were transiently transfected with PX458-ULK1/ATG13-gRNA with Fugene 6. The cells were diluted into 0.5 cell/100 μL at 96-well plate after 12 hours of transfection. Single cell in 96-well-plate was cultured in DMEM complete medium to form single-cell clone that was cultured in 24-well plate and subjected to immunoblotting analysis using ULK1-, ATG13-, ATG7-, or ATG9A-specific antibody. One single-cell clone that could not be detected with ULK1/ATG13/ATG7/ATG9A antibody was selected as ULK1/ATG13/ATG7/ATG9A-KO cell. ULK1 and ATG13 DKO cells were established based on ULK1-KO cells using PX458- ATG13-gRNA.

Immunoprecipitation and western blot analysis

The procedure was instructed as previously [64]. Most immunoprecipitation experiments were conducted in HEK-293T-derived cell lines because of a higher expression level for the exogenous protein. Briefly, HEK-293T cells stably expressing GFP-3FLAG or mULK1-3FLAG were lysed with M-PER supplemented with protease inhibitors and phosphatase inhibitors and centrifuged at 4 °C 14,000g for 10 minutes. The supernatant mixed with preincubated Protein G Dynabeads and FLAG antibody at 4 °C for 12 hours and washed 3 times with lysis buffer. Then the immunoprecipitate was denatured in 1×SDS-PAGE buffer at 95 °C for 7 minutes and subjected to SDS-PAGE and immunoblotting or Coomassie brilliant blue staining.

Cell cycle synchronization

Various cell synchronization methods are used in this paper, which have been used previously. Briefly, a double-thymidine (2.5 μM) block arrested cells in G1/S border and cells progress through S, G2, and M phase after release. A double-thymidine or single-thymidine block in combination with nocodazole (100 ng/mL) or STLC (5 μM) treatment arrested cells in prometaphase or prophase. A double-thymidine block in combination with RO-3306 (10 μM) treatment arrested cells in late G2 phase and progressed into mitosis after RO-3306 washout 3 times with prewarmed PBS.

Cell cycle analysis by flow cytometry/FACS

Cells for cell cycle analysis were trypsinized with 0.25% Trypsin/EDTA. After washing with ice-cold PBS twice, cells were fixed with −20 °C 75% ethanol overnight and then stained with PI/RNase staining buffer (BD Pharmingen) for 15 minutes at room temperature and analyzed with flow cytometry (Beckman Coulter, Cytoflex). Alternatively, for mitotic index analysis, cells fixed were stained with phospho-Histone H3 (S10) at 1:1,600 for 2 hours at room temperature and washed twice before Alexa-488 conjugated anti-rabbit IgG staining. After washing twice, PI/RNase staining was conducted as described previously before flow cytometry analysis. The data were analyzed by ModFit LT 4.1 and Flow Jo 7.6 software.

Lambda phosphatase treatment

IP products from mULK1-3FLAG-overexpressing HEK-293T cells were aliquoted and treated with reaction buffer, reaction buffer containing 1 μL (400 units) lambda phosphatase (P0753S, NEB), or reaction buffer containing 1 μL lambda phosphatase plus 1×phosphatase inhibitors cocktail (Roche) at 30 °C for 30 minutes with gentle shaking. Then the reaction products were denatured at 95 °C for 7 minutes and subjected to immunoblotting with FLAG or Serine/Threonine-specific antibody.

Mass spectrometry

For mass spectrometry assays, immunoprecipitates using FLAG antibody from asynchronous or mitotic 293T cells expressing FLAG-tagged mULK1/ATG13/mULK2 were separated by SDS-PAGE, the gel was stained with Coomassie brilliant blue, and the FLAG-tagged mULK1/ATG13/mULK2 band in each lane was excised. Samples were subjected to mass spectrometry analysis for mULK1/ATG13/mULK2 phosphorylation by Core Facility Center for Life Sciences, University of Science and Technology of China, School of Life Science and Technology, ShanghaiTech University. The identified phosphorylation sites specific in mitotic cells or with higher intensity were selected as the candidates for ULK1/ATG13/mULK2 phosphorylation sites in mitosis.

In vitro kinase assay

Anti-FLAG immunoprecipitates from asynchronous 293T cells overexpressing FLAG-tagged mULK1 (WT or K46I kinase-dead) or ATG13 were washed 3 times with M-PER and then resuspended in ice-cold kinase buffer (50 mM Tris-HCl [pH 7.5] at 25 °C, 10 mM MgCl2, 0.1 mM EDTA, 2 mM DTT, 0.01% Brij 35). The immunoprecipitates were then incubated with or without 270 ng purified CDK1/cyclin B (Life technologies, Part Number: PV3292, Lot Number: 1816161K) in 20-μL reaction mix (kinase buffer and 20 μM ATP) pretreated with or without 10 μM CDK1 inhibitor RO-3306 at 30 °C with constant shaking for 30 minutes. The reaction was quenched by mixing with 5 μL 5×SDS-sample buffer and boiling at 95 °C for 7 minutes.

Mouse model

Four-week-old female BALB/c nude mice were purchased from Nanjing Biomedical Research Institute of Nanjing University (Nanjing, China). All mice were kept in an animal room under the specific-pathogen-free (SPF) condition. The mice were fed with sterilized food and autoclaved tap water freely. The protocol involving animals was approved by the ethical and humane committee of Hefei Institutes of Physical Science, Chinese Academy of Sciences and carried out strictly in accordance with the related regulations (Hefei, China). After 1 week, HeLa/HeLa-ATG13-KO/HeLa-ULK1&ATG13-DKO cells (1 × 107) suspended in 100 μL PBS/Matrigel Matrix (1:1) were injected into the subcutaneous space on the right flank of BALB/c nude mice. The mice bearing HeLa/HeLa-ATG13-KO cells were randomly divided into 2 groups of 5 mice each 7 days postimplantation. Mice were intraperitoneally injected with 0.5% (M/V) methyl cellulose used as the vehicle solution or SBI-0206965 in 0.5% methyl cellulose (20 mg/kg/d) every day for 33 days. Tumor growth was evaluated every day and tumor volume was calculated as: volume = 1/2 (length × width2). At the end of the experiment, the mice were killed by cervical dislocation, and tumors were harvested and weighed up.

Quantification and statistical analysis

ImageJ software was used to quantify the relative protein value for western blot band, and Graphpad prism 6 was used to analyze the data using Student t test for 2 groups. All data are shown as mean ± SEM. p-values < 0.05 were considered as statistically significant.

In separate sheets, the excel spreadsheet contains the numerical data and statistical analysis for Figs 1C, 1E, 6B, 6C, 6D, 6E, 7A, 7C, 7D, 7E, 7F, 7G, 7H and 7I; S12A, S12B, S12D, S12E, S12F, S13A, S13B, S14A, S14C, S14E, S15A, S15C, S15E, S16A, S16B, S17A, S17B, S17C, S17D, S17E, S17F and S18B Figs.

(XLSX) Click here for additional data file.

All the original western blot images.

(PDF) Click here for additional data file.

ULK1 is phosphorylated and upshifted in mitosis.

(A-B) Both endogenous human and exogenous mouse ULK1 are upshifted in thymidine and nocodazole-arrested mitosis. 293T and HeLa cells with or without FLAG-tagged mULK1 overexpression were synchronized into mitosis by single-thymidine and nocodazole for western blot analysis. (C) ULK1 phosphorylation in mitosis interferes with ULK1 antibody recognition. The ULK1 antibody (Cell Signaling Technology, #8054) could not recognize the upshifted band for mitotic ULK1 but could recognize when the PVDF membrane was treated with lambda phosphatase for 1 hour. PVDF, polyvinylidene fluoride; ULK1, unc-51-like autophagy activating kinase 1. (TIF) Click here for additional data file.

Aurora A is less likely to be responsible for ULK1 band shift in mitosis.

(A-B) HeLa cells synchronized and treated as Fig 3A were subjected to western blot analysis. However, we found that the other 2 Aurora A inhibitors, MLN8054 and Aurora A inhibitor I, did not affect ULK1 band shift (A). In addition, MLN8237 treatment for a shorter time (1 hour or 0.5 hours) did not cause ULK1 band shift change as 1.5-hour treatment (B). MLN8237, MLN8054, and Aurora A inhibitor I were Aurora A inhibitor. CDK, cyclin-dependent kinase; ULK1, unc-51-like autophagy activating kinase 1. (TIF) Click here for additional data file.

CDK1 regulates ULK1 phosphorylation independent of ULK1 kinase activity.

(A-B) ULK1-KO cells were established. HeLa and 293T cells transiently transfected with the CRISPR/Cas9 plasmid subcloned gRNA for human ULK1 were screened by western blot analysis and the ULK1-KO clones were identified. The red circles indicate the ULK1-KO clones for the following assay. (C-D) K46I kinase-dead ULK1 also underwent significant electrophoretic mobility shift and phosphorylation in mitosis as WT ULK1. HeLa ULK1-KO cells reconstituted with FLAG-tagged mULK1-K46I were treated as Figs 1C and 3B (the lower panel) and then analyzed by western blot analysis and immunoprecipitation, respectively. (E) In vitro kinase assay indicated that purified CDK1/cyclin B could induce K46I kinase-dead ULK1 to undergo significant electrophoretic mobility shift and phosphorylation. CDK, cyclin-dependent kinase; gRNA, guide RNA; KO, knockout; mULK1, mouse ULK1; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. (TIF) Click here for additional data file.

ULK2 is also phosphorylated and upshifted in mitosis.

The 293T cells transiently transfected with FLAG-tagged mULK2 treated as Fig 3A were analyzed by western blot analysis and immunoprecipitation. mULK2, mouse ULK2; ULK2, unc-51-like autophagy activating kinase 2. (TIF) Click here for additional data file.

ATG13 is upshifted in mitosis.

(A) HeLa cells were treated as Fig 4C for ATG13 mobility shift analysis. (B) ATG13 mobility shift in mitosis is decreased by CDK1 inhibitor RO-3306, similarly to ULK1, although to a lesser extent. The 293T cells overexpressing FLAG-tagged mULK1 were synchronized by single-thymidine in the presence or absence of nocodazole, treated with 10 μM RO-3306 for 5 or 30 minutes. The coimmunoprecipitate by FLAG antibody was subjected to immunoblotting with ATG13, FIP200 antibodies. (C-D) ULK1 expression level does not affect ATG13 mobility shift in mitosis. HeLa ULK1-KO cells with or without FLAG-tagged mULK1 expression synchronized into mitosis with thymidine and nocodazole (C) or in asynchronous condition (D) were treated with 10 μM RO-3306 for 30 minutes for western blot analysis. ATG, autophagy-related; CDK, cyclin-dependent kinase; FIP200, FAK family-interacting protein of 200 kDa; KO, knockout; mULK1, mouse ULK1; ULK1, unc-51-like autophagy activating kinase 1. (TIF) Click here for additional data file.

Identification of ULK2 phosphorylation sites in mitosis.

(A-B) The preliminary identification of ULK2 phosphorylation sites in mitosis. The immunoprecipitate with FLAG antibody in asynchronous or mitotic 293T cells transfected with mULK2-3FLAG was subjected to SDS-PAGE and Coomassie brilliant blue staining (A) and mass spectrometry analysis of phosphorylation sites for mitotic mULK2 compared with asynchronous mULK2 (B). (C) The contribution of the potential residues to mitotic ULK2 band shift. HeLa cells were transfected with the mutant mULK2-3FLAG plasmid in indicated sites and analyzed by cell cycle synchronization and western blot. mULK2, mouse ULK2; ULK2, unc-51-like autophagy activating kinase 2. (TIF) Click here for additional data file.

ATG13-KO cells establishment.

HeLa cells were transiently transfected with the CRISPR/Cas9 plasmid that subcloned gRNA for human ATG13. The ATG13-KO clones were screened by western blot and identified. The red circle indicates the ATG13-KO clones for the following assay. ATG, autophagy-related; gRNA, guide RNA; KO, knockout. (TIF) Click here for additional data file.

The phosphorylation sites we identified in both ULK1 and ATG13 are conserved between different isoforms.

(A) The difference between the construct we used in this paper (Q6PB82 in Uniprot, BC059835 in GenBank) with the ULK1 used in some other studies (O70405 in Uniprot) is that there are 6 additional amino acids at position 507–512 (ATLFLP) of Q6PB82 and a conversion from S to T at position 469 of Q6PB82. (B) The human ATG13 cloned from the cDNA of HeLa cells, isofom2 (O75143-2 in Uniprot, BC002378 in GenBank), is used in this paper. It differs from O75143 (isoform 1) used in other studies with the missing region in the amino acids at position 263–299. The phosphorylation sites we identified in both ULK1 and ATG13 are conserved between different isoforms (A-B), which were aligned in Uniprot. ATG, autophagy-related; ULK1, unc-51-like autophagy activating kinase 1. (TIF) Click here for additional data file.

ULK1/ATG13 identified phosphorylation sites by kinases are shown as human/mouse.

The identified phosphorylated residues of the mouse ULK1 and human ATG13 from “current study” and literature [18,20,21,47,63,67-70] are summarized. ATG, autophagy-related; ULK1, unc-51-like autophagy activating kinase 1. (TIF) Click here for additional data file.

The effects of ULK1-ATG13 sites at mTOR and AMPK on mitotic mobility shift.

(A-B) The alanine mutants of ULK1 and ATG13 at fundamental mTOR/AMPK phosphorylation sites were constructed in ATG13-KO or ULK1-KO cells and examined their contribution to mitotic ULK1 (A) or ATG13 (B) band shift in mitosis. AMPK, AMP-activated protein kinase; KO, knockout; mTOR, mammalian target-of-rapamycin; ULK1, unc-51-like autophagy activating kinase 1. (TIF) Click here for additional data file.

Establishment of ULK1 and ATG13 DKO, double WT or mutant cell line.

(A) ULK1 and ATG13 DKO cells establishment. HeLa ULK1-KO cells were transiently transfected with the CRISPR/Cas9 plasmid that subcloned gRNA for human ATG13. The ATG13-KO clones were screened by western blot analysis and identified as ULK1 and ATG13 DKO cells. The red circles indicate the ULK1 and ATG13 DKO clones for the following assays. (B-C) The ULK1 and ATG13 double WT or mutant cell lines were established by ATG13-WT/4A MSCV infection based on HeLa-DKO cell reconstituted with FLAG-tagged WT or 11A mutant mULK1. (D) The expression of ATG13 in ULK1 and ATG13 double WT or mutant cell lines and HeLa cells. 11A, S622&T635&T653&S479&S543&S413&T401&S403&S405&T282&T502A; ATG, autophagy-related; DKO, double knockout; gRNA, guide RNA; KO, knockout; MSCV, murine stem cell virus; mULK1, mouse ULK1; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. (TIF) Click here for additional data file.

The effects of ATG13 or ULK1 mutant, ULK1-ATG13 DKO, CDK1 inhibition on autophagy.

(A-B) The autophagy inhibition was compared between FLAG-tagged wild-type and K46I kinase dead mULK1, HeLa and HeLa ULK1-KO, respectively. Cells were treated with EBSS starvation for 1.5 hours with or without Baf A1 and examined by western blot. GFP-LC3-RFP was stably expressed in indicated cell lines. The autophagy activity was detected by flow cytometry for GFP and RFP fluorescence intensity. (C) The autophagic activity of HeLa and HeLa-DKO cells in mitosis. Cells were synchronized into mitosis by thymidine release and nocodazole arrest. Mitotic cells were collected by shake-off and treated by 25 μM CQ for 1 hour. (D-E) The mitotic autophagy activity in ULK1-11A mutant or ATG13-4A mutant cells was determined by relative GFP/RFP ratio. Cells were treated as Fig 6C. (F) The effect of CDK1 inhibition by RO-3306 on autophagy. HeLa cells stably expressing GFP-LC3-RFP were treated by 10 μM RO-3306 for 4 hours in asynchronous condition and 20 minutes in mitotic condition synchronized by thymidine release and nocodazole arrest. Cells in (D, E, and F) were collected by flow cytometry for the relative GFP/RFP ratio. n = 3, *p < 0.05, **p < 0.01. Numerical data underlying the figure panels are available in S1 Data. 11A, S622&T635&T653&S479&S543&S413&T401&S403&S405&T282&T502A; ATG, autophagy-related; Baf A1, bafilomycin A1; CDK, cyclin-dependent kinase; CQ, chloroquine; DKO, double knockout; EBSS, Earle’s balanced salt solution; GFP, green fluorescent protein; mULK1, mouse ULK1; n.s., not significant; RFP, red fluorescent protein; ULK1, unc-51-like autophagy activating kinase 1. (TIF) Click here for additional data file.

ULK1-KO slightly delays S/G2 transition.

(A) ULK1-KO does not affect cell cycle distribution in HeLa and 293T cells. Cell cycle distribution was analyzed by flow cytometry in asynchronous WT and ULK1-KO HeLa or 293T cells. (B) ULK1-KO slightly delays S/G2 transition. HeLa WT or ULK1-KO cells synchronized with double-thymidine and nocodazole were subjected to cell cycle analysis by flow cytometry. Numerical data underlying the figure panels are available in S1 Data. KO, knockout; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. (TIF) Click here for additional data file.

Mitotic entry was delayed in ULK1-KO, ATG7/ATG9A-KO but not K46I kinase-dead ULK1 cell lines.

(A-B) Mitotic index is decreased in ULK1-KO cells synchronized by single-thymidine and nocodazole. HeLa WT or ULK1-KO cells synchronized into mitosis released from thymidine for 5 hours and nocodazole for another 7 hours were subjected to either PI and pH3(S10) co-staining for cell cycle and mitotic index analysis by flow cytometry (A) or western blot analysis for cell cycle markers (B). (C) Mitotic progression was not affected by K46I kinase-dead ULK1. HeLa ULK1-KO cells reconstituted with FLAG-tagged WT or K46I kinase-dead mULK1 were synchronized into mitosis and subjected to pH3(S10) staining for mitotic index analysis by flow cytometry. (D-E) The effect of ATG7/ATG9A-KO on mitotic entry. HeLa cells with ATG7 or ATG9A-KO were established by CRISPR/Cas9 (D) and treated as above for the detection of mitotic index analyzed by 1-way ANOVA followed by Tukey’s multiple comparison test (E). n = 3, *p < 0.05, ***p < 0.001, ****p < 0.0001. Numerical data underlying the figure panels are available in S1 Data. ATG, autophagy-related; KO, knockout; mULK1, mouse ULK1; n.s., not significant; PI, propidium iodide; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. (TIF) Click here for additional data file.

ULK1 and ATG13 coordinate to regulate cell cycle progression.

(A-B) Mitotic index was decreased in ATG13-KO cells synchronized by single-thymidine and nocodazole. HeLa WT or ATG13-KO cells synchronized into mitosis were subjected to PI and pH3(S10) co-staining for cell cycle and mitotic index analysis by flow cytometry (A) or western blot analysis for cell cycle markers (B). (C) ULK1-KO combined with ATG13 “knockdown” inhibits S/G2 transition. HeLa ULK1-KO cells transiently transfected with the CRISPR/Cas9 vector control or plasmid subcloned gRNA for human ATG13 were synchronized with thymidine and nocodazole for cell cycle analysis by flow cytometry. (D) The cell lysate collected from (C) was subjected to western blot analysis by indicated antibodies. (E) ULK1 and ATG13 DKO decreases mitotic index. HeLa WT or ULK1&ATG13-DKO cells were subjected to pH3(S10) staining for mitotic index analysis by flow cytometry. n = 3, *p < 0.05, **p < 0.01. Numerical data underlying the figure panels are available in S1 Data. ATG, autophagy-related; DKO, double knockout; gRNA, guide RNA; KO, knockout; n.s., not significant; PI, propidium iodide; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. (TIF) Click here for additional data file.

Rescue efficiency determined by relative mitotic index and doubling time.

(A) Cells synchronized by thymidine and nocodazole were subjected to PI and pH3(S10) co-staining for cell cycle and mitotic index analysis by flow cytometry. (B) Doubling time of various cell lines. The statistical analysis (1-way ANOVA followed by Tukey’s multiple comparison test) was done by comparing indicated cells to HeLa cells. The doubling time is calculated as Fig 7D. n = 3, *p < 0.05, **p < 0.01, ****p < 0.0001. Numerical data underlying the figure panels are available in S1 Data. n.s., not significant; PI, propidium iodide. (TIF) Click here for additional data file.

The role of ULK1-11A/ATG13-4A unphosphorylatable mutant in cell cycle progression.

(A, D) The cell cycle distribution and mitotic entry of HeLa ULK1-KO cells stably overexpressing WT or mutant 11A FLAG-tagged mULK1 and HeLa ATG13-KO cells stably overexpressing WT or mutant 4A FLAG-tagged ATG13. Cells released from thymidine for 11 hours were subjected to PI and pH3(S10) co-staining for cell cycle and mitotic index analysis by flow cytometry. (B, E) Mitotic exit of ULK1 or ATG13 WT or mutant cells. Cells were synchronized into mitosis with thymidine and nocodazole and released into nocodazole-free complete DMEM medium for different time points and then subjected to either PI or cyclin B1 staining for cell cycle, and cyclin B1 level analysis by flow cytometry. (C, F) ULK1 or ATG13 WT or mutant does not affect cell proliferation. Cells were plated at 1 × 105 cells/mL and cultured for 1, 2, or 3 days. The cell number was counted by flow cytometry, and the doubling time was calculated. TD indicates the average cell doubling time and is calculated as: TD = t*[lg2/(lgNt − lgN0)], where t is the culture time, Nt is the cell number after culturing, and N0 is the original cell number plated. n = 3, *p < 0.05, **p < 0.01. Numerical data underlying the figure panels are available in S1 Data. 11A, S622&T635&T653&S479&S543&S413&T401&S403&S405&T282&T502A; ATG, autophagy-related; DMEM, Dulbecco’s Modified Eagle Medium; KO, knockout; mULK1, mouse ULK1; n.s., not significant; PI, propidium iodide; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. (TIF) Click here for additional data file.

Mouse model.

(A) The mouse model in nude mice bearing WT or KO cells treated with or without ULK1 kinase inhibitor SBI-0206965 was established. (B) Time course of the body weight for nude mice in (A). Numerical data underlying the figure panels are available in S1 Data. KO, knockout; ULK1, unc-51-like autophagy activating kinase 1; WT, wild type. (TIF) Click here for additional data file.
  69 in total

1.  Beclin 1 is dispensable for chromosome congression and proper outer kinetochore assembly.

Authors:  Luca L Fava; Johannes Rainer; Manuel D Haschka; Stephan Geley; Andreas Villunger
Journal:  EMBO Rep       Date:  2015-08-20       Impact factor: 8.807

2.  Cul3-KLHL20 Ubiquitin Ligase Governs the Turnover of ULK1 and VPS34 Complexes to Control Autophagy Termination.

Authors:  Chin-Chih Liu; Yu-Ching Lin; Yu-Hsuan Chen; Chun-Ming Chen; Liang-Yu Pang; Hsuan-An Chen; Pei-Rung Wu; Mei-Yao Lin; Si-Tse Jiang; Ting-Fen Tsai; Ruey-Hwa Chen
Journal:  Mol Cell       Date:  2015-12-10       Impact factor: 17.970

3.  Nutrient-dependent mTORC1 association with the ULK1-Atg13-FIP200 complex required for autophagy.

Authors:  Nao Hosokawa; Taichi Hara; Takeshi Kaizuka; Chieko Kishi; Akito Takamura; Yutaka Miura; Shun-ichiro Iemura; Tohru Natsume; Kenji Takehana; Naoyuki Yamada; Jun-Lin Guan; Noriko Oshiro; Noboru Mizushima
Journal:  Mol Biol Cell       Date:  2009-02-11       Impact factor: 4.138

Review 4.  Biological Functions of Autophagy Genes: A Disease Perspective.

Authors:  Beth Levine; Guido Kroemer
Journal:  Cell       Date:  2019-01-10       Impact factor: 41.582

5.  S-trityl-L-cysteine is a reversible, tight binding inhibitor of the human kinesin Eg5 that specifically blocks mitotic progression.

Authors:  Dimitrios A Skoufias; Salvatore DeBonis; Yasmina Saoudi; Luc Lebeau; Isabelle Crevel; Robert Cross; Richard H Wade; David Hackney; Frank Kozielski
Journal:  J Biol Chem       Date:  2006-02-28       Impact factor: 5.157

6.  Hsp90-Cdc37 chaperone complex regulates Ulk1- and Atg13-mediated mitophagy.

Authors:  Joung Hyuck Joo; Frank C Dorsey; Aashish Joshi; Kristin M Hennessy-Walters; Kristie L Rose; Kelly McCastlain; Ji Zhang; Rekha Iyengar; Chang Hwa Jung; Der-Fen Suen; Meredith A Steeves; Chia-Ying Yang; Stephanie M Prater; Do-Hyung Kim; Craig B Thompson; Richard J Youle; Paul A Ney; John L Cleveland; Mondira Kundu
Journal:  Mol Cell       Date:  2011-08-19       Impact factor: 17.970

7.  Organization of the pre-autophagosomal structure responsible for autophagosome formation.

Authors:  Tomoko Kawamata; Yoshiaki Kamada; Yukiko Kabeya; Takayuki Sekito; Yoshinori Ohsumi
Journal:  Mol Biol Cell       Date:  2008-02-20       Impact factor: 4.138

8.  Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy.

Authors:  Daniel F Egan; David B Shackelford; Maria M Mihaylova; Sara Gelino; Rebecca A Kohnz; William Mair; Debbie S Vasquez; Aashish Joshi; Dana M Gwinn; Rebecca Taylor; John M Asara; James Fitzpatrick; Andrew Dillin; Benoit Viollet; Mondira Kundu; Malene Hansen; Reuben J Shaw
Journal:  Science       Date:  2010-12-23       Impact factor: 47.728

9.  Erk regulation of actin capping and bundling by Eps8 promotes cortex tension and leader bleb-based migration.

Authors:  Jeremy S Logue; Alexander X Cartagena-Rivera; Michelle A Baird; Michael W Davidson; Richard S Chadwick; Clare M Waterman
Journal:  Elife       Date:  2015-07-11       Impact factor: 8.140

10.  Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition).

Authors:  Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier
Journal:  Autophagy       Date:  2016       Impact factor: 16.016

View more
  16 in total

1.  Autophagy inhibition by TSSC4 (tumor suppressing subtransferable candidate 4) contributes to sustainable cancer cell growth.

Authors:  Yongqiang Chen; Zhaoying Zhang; Elizabeth S Henson; Andrew Cuddihy; Katharina Haigh; Ruobing Wang; Jody J Haigh; Spencer B Gibson
Journal:  Autophagy       Date:  2021-09-17       Impact factor: 13.391

2.  Cdc14 spatiotemporally dephosphorylates Atg13 to activate autophagy during meiotic divisions.

Authors:  Wenzhi Feng; Orlando Argüello-Miranda; Suhong Qian; Fei Wang
Journal:  J Cell Biol       Date:  2022-03-03       Impact factor: 8.077

Review 3.  Advances in the role of autophagy in the development of retinoblastoma.

Authors:  Teng Wan; Mingyuan Fu; Zhuan Wu; Xue Gao; Shouhong Zhou
Journal:  Oncol Lett       Date:  2021-07-01       Impact factor: 2.967

4.  Phospho-regulation and function of ULK1-ATG13 during the cell cycle.

Authors:  Zhiyuan Li; Xin Zhang
Journal:  Autophagy       Date:  2021-03-17       Impact factor: 16.016

5.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

Review 6.  The Intricate Interplay between Cell Cycle Regulators and Autophagy in Cancer.

Authors:  Dorian V Ziegler; Katharina Huber; Lluis Fajas
Journal:  Cancers (Basel)       Date:  2021-12-29       Impact factor: 6.639

Review 7.  Crosstalk between autophagy inhibitors and endosome-related secretory pathways: a challenge for autophagy-based treatment of solid cancers.

Authors:  Martina Raudenska; Jan Balvan; Michal Masarik
Journal:  Mol Cancer       Date:  2021-10-27       Impact factor: 27.401

8.  Interleukin-27 promotes autophagy in human serum-induced primary macrophages via an mTOR- and LC3-independent pathway.

Authors:  Sylvain Laverdure; Ziqiu Wang; Jun Yang; Takuya Yamamoto; Tima Thomas; Toyotaka Sato; Kunio Nagashima; Tomozumi Imamichi
Journal:  Sci Rep       Date:  2021-07-21       Impact factor: 4.996

Review 9.  Pyroptosis: A New Regulating Mechanism in Cardiovascular Disease.

Authors:  Nan Ji; Zhongwen Qi; Yueyao Wang; Xiaoya Yang; Zhipeng Yan; Meng Li; Qihui Ge; Junping Zhang
Journal:  J Inflamm Res       Date:  2021-06-22

10.  ULK1 inhibitor induces spindle microtubule disorganization and inhibits phosphorylation of Ser10 of histone H3.

Authors:  Xinmiao Ji; Xin Zhang; Zhiyuan Li
Journal:  FEBS Open Bio       Date:  2020-10-26       Impact factor: 2.792

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.