| Literature DB >> 32493269 |
Elena O Vidyagina1, Natalia M Subbotina1, Vladimir A Belyi2, Vadim G Lebedev1, Konstantin V Krutovsky3,4,5,6,7, Konstantin A Shestibratov1.
Abstract
<Entities:
Keywords: Aspen; Gene expression level; Penicillium canescens; Populus tremula; Transgenic; Xyloglucanase
Year: 2020 PMID: 32493269 PMCID: PMC7268456 DOI: 10.1186/s12870-020-02469-2
Source DB: PubMed Journal: BMC Plant Biol ISSN: 1471-2229 Impact factor: 4.215
Fig. 1RT-PCR analysis of the sp-Xeg gene expression in transgenic aspen plants (expected amplicon size 762 bp). M - standard molecular marker 1 Kb (SibEnzyme Ltd., Russia), Н2О - negative reaction control, pBI-Xeg - plasmid DNA (positive control), Pt - non-transgenic control line, Gus-1-5a - transgenic control line. Full-length gel is presented in Supplementary Figure S1
Results of the RT-qPCR analysis of the relative sp-Xeg gene expression level in the transgenic and control aspen lines
| Line | Ct Actin | Ct Ubiquitin | Ct Xeg | ∆ Ct | ∆∆ Ct | Relative |
|---|---|---|---|---|---|---|
| Pt (control) | 29.2 ± 0.39 | 27.5 ± 0.85 | 30.5 ± 1.78 | 2.2 ± 2.10 | – | – |
| Xeg-1-1a | 30.1 ± 1.45 | 27.5 ± 0.77 | 19.1 ± 0.89 | −9.7 ± 1.04 | −1.4 | 2.6 |
| Xeg-1-1b | 29.9 ± 0.48 | 25.2 ± 0.33 | 18.2 ± 0.20 | −9.4 ± 0.33 | −1.1 | 2.1 |
| Xeg-1-1c | 30.6 ± 1.53 | 27.5 ± 0.85 | 18.5 ± 0.95 | − 10.6 ± 1.11 | −2.2 | 4.7 |
| Xeg-2-1b | 31.1 ± 0.68 | 27.9 ± 0.48 | 18.4 ± 0.06 | − 11.1 ± 0.40 | −2.7 | 6.7 |
| Xeg-2-3b | 28.1 ± 0.43 | 25.7 ± 0.38 | 17.3 ± 0.22 | − 9.6 ± 0.34 | −1.3 | 2.4 |
| Xeg-2-5a | 27.7 ± 0.22 | 24.4 ± 0.18 | 17.8 ± 0.30 | −8.3 ± 0.23 | 0 | 1 |
Fig. 2Western blot analysis of protein extracts of transgenic aspens carrying the recombinant gene sp-Xeg. M - standard protein molecular marker, Xeg - fungal extract, Pt - non-transgenic control, Gus-1-5a - transgenic negative control, Xeg-1-1a, Xeg-1-1b, Xeg-1-1c, Xeg-2-1b, Xeg-2-3b, and Xeg-2-5a are transgenic lines. Full-length blot is presented in Supplementary Figure S2
Growth rate indicators, number of leaves, and cellulose content (± SD) in the 18-month-old aspen transgenic and control lines in semi-natural conditions
| Line | Height, | Stem diameter, | Volume, cm3 | Number of leaves | Cellulose content, |
|---|---|---|---|---|---|
| Pt (control) | 59.4 ± 1.97 | 6.6 ± 0.22 | 25.8 ± 0.95 | 24.2 ± 0.84 | 383.2 ± 10.97 |
| Xeg-1-1a | 61.1 ± 2.14 | 6.5 ± 0.15 | 25.8 ± 0.78 | 26.2 ± 1.05 | 381.2 ± 12.33 |
| Xeg-1-1b | 53.3 ± 1.91 | 6.2 ± 0.23 | 20.5 ± 1.00 | 25.3 ± 0.88 | 397.6 ± 11.52 |
| Xeg-1-1c | 59.3 ± 2.34 | 6.9 ± 0.20 | 28.2 ± 0.93 | 25.1 ± 0.90 | 426.4 ± 12.39* |
| Xeg-2-1b | 69.6 ± 2.67* | 7.9 ± 0.23* | 43.4 ± 1.04* | 29.4 ± 0.99* | 411.3 ± 11.57* |
| Xeg-2-3b | 51.2 ± 1.85 | 6.5 ± 0.16 | 21.63 ± 0.87 | 25.2 ± 0.82 | 388.7 ± 11.44 |
| Xeg-2-5a | 60.5 ± 2.02 | 6.1 ± 0.22 | 22.51 ± 0.98 | 25.0 ± 1.07 | 379.6 ± 10.86 |
*significantly different from Pt at P ≤ 0.05 based on ANOVA
Fig. 3Plant samples of the 18-month-old transgenic and non-transformed control (Pt) lines in semi-natural conditions
Fig. 4Growth rate of the transgenic (Xeg-2-1b) and non-transgenic control (Pt) aspen lines
Leaf trait parameters (± SD) of the 18-month-old aspen lines
| Line | Area, | Circularity | Length, | Width, | Length to width |
|---|---|---|---|---|---|
| Pt (control) | 5776.3 ± 203.9 | 91.6 ± 1.79 | 96.3 ± 2.85 | 81.0 ± 2.51 | 1.20 ± 0.04 |
| Xeg-1-1a | 4921.6 ± 172.2 | 85.5 ± 1.91* | 100.1 ± 3.09 | 69.1 ± 2.03* | 1.47 ± 0.05* |
| Xeg-1-1b | 4176.3 ± 156.7* | 86.0 ± 1.85* | 89.9 ± 2.77 | 65.3 ± 2.59* | 1.39 ± 0.04* |
| Xeg-1-1c | 5526.3 ± 197.8 | 87.1 ± 1.09* | 102.4 ± 2.35 | 75.0 ± 2.77 | 1.38 ± 0.04* |
| Xeg-2-1b | 6020.8 ± 210.7 | 90.1 ± 2.14 | 105.1 ± 2.71 | 77.7 ± 2.56 | 1.37 ± 0.04* |
| Xeg-2-3b | 4784.6 ± 167.4* | 88.2 ± 1.15* | 95.5 ± 1.98 | 68.9 ± 2.09* | 1.39 ± 0.05* |
| Xeg-2-5a | 5901.5 ± 212.4 | 86.6 ± 1.55* | 108.8 ± 2.79* | 76.2 ± 2.45 | 1.45 ± 0.05* |
*significantly different from Pt at P ≤ 0.05 based on ANOVA
Fig. 5Aspen leaves under semi-natural conditions presenting transgenic and control (Pt) lines
The percentage of pentosans (± SD) in the wood of the 6- and 18-month-old aspen lines
| Line | 6-month-old | 18-month-old |
|---|---|---|
| Pt | 23.1 ± 0.57 | 18.8 ± 0.56 |
| Xeg-1-1a | 17.5 ± 0.53* | 17.8 ± 0.48 |
| Xeg-1-1b | 20.8 ± 0.46 | 20.7 ± 0.60 |
| Xeg-1-1c | 21.8 ± 0.94 | 20.3 ± 0.58 |
| Xeg-2-1b | 21.5 ± 0.53 | 17.9 ± 0.50 |
| Xeg-2-3b | 21.3 ± 0.76 | 19.8 ± 0.55 |
| Xeg-2-5a | 23.0 ± 0.61 | 22.2 ± 0.61 |
* significantly different from Pt at P ≤ 0.05 based on ANOVA
Fig. 6Monomeric sugars composition in wood of the 6- (a) and 18- (b) month-old transgenic and control (Pt) aspen lines. Fuc – fucose, Ara – arabinos, Rha – rhamnose, Man – mannose, Gal – galactose, Glc – glucose, Xyl – xylose
Mean diameter and length (± SD) of wood fiber in aspen lines
| Line | Mean diameter, | Mean length, |
|---|---|---|
| Pt (control) | 19.58 ± 1.84 | 488.9 ± 12.7 |
| Xeg-1-1a | 20.14 ± 1.80 | 506.7 ± 14.3* |
| Xeg-1-1b | 19.76 ± 1.61 | 487.6 ± 11.6 |
| Xeg-1-1c | 20.16 ± 1.27 | 461.8 ± 17.4 |
| Xeg-2-1b | 20.01 ± 1.93 | 512.0 ± 10.8* |
| Xeg-2-3b | 19.57 ± 1.54 | 524.3 ± 13.0* |
| Xeg-2-5a | 21.98 ± 1.93 | 487.8 ± 15.2 |
* significantly different from Pt at P ≤ 0.05 based on ANOVA
Fig. 7Micrograph of cell slices of plant xylem with different cell wall thickness of 1.16 ± 0.044 μm in the control line Pt (a) and 1.47 ± 0.045 and 1.80 ± 0.056 in the transgenic lines Xeg-1-1c (b) and Xeg-2-1b (c), respectively
Fig. 8Cumulative CO2 emissions during decomposition of stems and roots of transgenic (Xeg-1-1b and Xeg-2-3b) and control (Pt) aspens during the year; *statistically significantly different from Pt at P ≤ 0.05 based on ANOVA
Percentage of nitrogen and carbon (± SD) in the wood of the aspen lines
| Line | Stems | Roots | ||
|---|---|---|---|---|
| nitrogen | carbon | nitrogen | carbon | |
| Pt | 1.23 ± 0.12 | 45.8 ± 1.5 | 1.7 ± 0.3 | 45.5 ± 1.5 |
| Xeg-1-1b | 1.04 ± 0.19* | 46.1 ± 1.5 | 1.9 ± 0.4 | 45.5 ± 1.5 |
| Xeg−2-3b | 1.05 ± 0.18* | 45.9 ± 1.5 | 1.8 ± 0.3 | 44.9 ± 1.4 |
* significantly different from Pt at P ≤ 0.05 based on ANOVA
Primers used in the RT-PCR
| Name | Nucleotide sequence, 5′-3’ |
|---|---|
| XEG-1 | ACGGTGTTACCTGGAAGCTG |
| XEG-2 | GACCCTGGTTTTTGATGAGG |
| Act-1 | AAAGTGAAGATATTCAGCCTCTTGT |
| Act-2 | GCGACCCA AATGCTAGG |
| UBQ-1 | GGCAAGACCATAACTCTC |
| UBQ-2 | ATCTTCTAATTGTTTACCAG |