UltraPrep is a scalable, cost-effective, bead-based method for purifying cell-free DNA.

UltraPrep is an open-source, two-step method for purification of cell-free DNA that entails extraction of total DNA followed by size-selective enrichment of the smaller fragments that are characteristic of DNA originating from fragmentation between nucleosome. The advantages of the two related protocols that are described are that they can easily accommodate a wide range of sample input volumes, they rely on simple, magnetic bead-based technology, the yields of cfDNA are directly comparable to the most popular methods for cfDNA purification, and they dramatically reduce the cost of cfDNA isolation relative to currently available commercial methods. We provide a framework for physical and molecular quality analysis of purified cfDNA and demonstrate that the cfDNA generated by UltraPrep meets or exceeds the quality metrics of the most commonly used procedure. In addition, our method removes high molecular weight genomic DNA (hmwgDNA) that can interfere with downstream assay results, thereby addressing one of the primary concerns for preanalytical collection of blood samples.

Introduction

Circulating cell-free DNA (cfDNA) has shown tremendous utility as an analyte in prenatal genetic analysis and in precision medicine approaches to diagnosed cancers. It holds promise to contribute to early detection of solid tumors [1,2]. This analyte has also shown potential for the rapid detection of infectious microbes [3]. Early detection tests that use cfDNA must be both highly sensitive and specific. Straightforward probability and statistics considerations indicate that this requires high input levels of cfDNA and subsequent genomic analysis that covers several thousand independent cfDNA “genome equivalents” [4,5]. In addition to individual patient testing, there is a largely unmet need for large, well-characterized, single-donor lots of normal human cfDNA that can be used for diagnostic test research, assay development, and routine proficiency qualification in clinical laboratory environments.

Plasmapheresis is a method that can be used to safely collect hundreds of milliliters of plasma from human subjects. Plasma is most often collected into vessels containing sodium citrate, a molecule that chelates divalent cations required by DNAse enzymes and thereby stabilizes extracellular DNA. Plasmapheresis samples contain significant quantities of cfDNA, and these can be used in the contexts described in the previous paragraph. At present, it is difficult to realize the potential of this cfDNA source owing to a lack of cost-effective methods for high volume cfDNA extraction and purification.

We were inspired by a recent publication promoting magnetic bead-based laboratory methods [6] to pursue an open-source approach to high-volume, reduced-cost purification of cfDNA. This proved to be a significant challenge. The most formidable obstacle was to achieve near-quantitative recovery of cfDNA fragments. Specifically, DNA binding to silica surfaces has been used as a purification method for decades [7,8], but a significant fraction of DNA is bound irreversibly [9,10]. Conditions for robust and reversible binding of cfDNA are reported here. In addition, preanalytical collection conditions often result in plasma that contains a mixture of hmwgDNA and cfDNA. By cfDNA, we mean a set of DNA fragments derived from cleavage between adjacent nucleosomes [11,12]. Since a single nucleosomal subunit is about 165 bp and cleavage between subunits can be incomplete, this results in a “ladder” of DNA fragments that are nucleosomal monomers, dimers, trimers, etc. [13]. This collection of “nucleosomal fragments” is thought to be generated by apoptosis that occurs among the cells in both normal and cancerous tissues. In contrast, hmwgDNA that is observed in some plasma samples is thought to be largely contributed by nucleated blood cells that burst. When present in quantities exceeding a few percent of the total cfDNA sample that is analyzed, excess hmwgDNA can result in underestimation of minor allele frequencies for somatic DNA variants, especially when using techniques such as quantitative digital PCR or amplicon-based DNA sequencing. In the case of cancer diagnostics, these minor allele frequencies translate directly into quantitative estimates of circulating tumor DNA burden, and these in turn may be used for treatment decisions in the clinic. Hence, there has been considerable effort invested in preanalytical collection methods that prevent cell lysis. Here we provide an alternative approach in which hmwgDNA can be removed from nucleosomal fragments by bead-based partitioning.

Materials and methods

Ethics statement

The ethics committees of Ripple Biosolutions and of Plasma Lab International reviewed and approved of the research presented here. Written consent was obtained from healthy donors prior to sample collection, processing and characterization.

Materials

Plasma samples were collected at PlasmaLab International (Everett, WA) using automated plasmapheresis collection into sodium citrate containing collection vessels. The samples used for protocol development and described in S1 Table were stored at -20°C for as long as 10 years. The K2EDTA samples were derived from whole blood collected in standard vacutainer tubes that was spun immediately at 1500 g for 10 min. The top plasma fraction was transferred to a separate container and frozen at -20°C prior to the cfDNA preparation. Lyophilized proteinase K (cat. P-480-5) was purchased from Gold Biotechnology (St. Louis, MO), guanidinium isothiocyanate (GITC) from Chem Impex (Wood Dale, IL), silica coated superparamagnetic beads (400–690 nm, cat. no. SIM-05-10H) from Spherotech (Lake Forest, IL), 1 M Tris pH 8.0 and 0.5 M EDTA from Quality Biologicals (Gaithersburg, MD), and isopropanol from Swan (Smyrna, TN). All other reagents for DNA purification were purchased from RPI Chemicals (Mount Prospect, IL). Magnetic rack bead separators were purchased from EBay (https://www.ebay.com/usr/pochekailov). We have not tested the performance of alternative 50 mL magnetic racks, but they appear to be widely available. Reagents for DNA quantitation, DNA gel staining (Gel Green), and qPCR were from Biotium (Fremont, CA). Oligonucleotides were obtained from IDT (Coralville, IA). Molecular biology reagents for post-purification quality assessment were from New England Biolabs (Ipswich, MA). Fluorescent quantitation of DNA was measured on a Qubit instrument (ThermoFisher, Waltham, MA). DNA gels were run using the electrophoresis apparatus from EmbiTech (San Diego, CA) and illuminated using a blue LED from IO Rodeo (Pasadena, CA). The optical filter for visualization of Gel Green stained gels was a 540 nm rapid edge filter from Omega optics (Austin, TX). Quantitative PCR was performed on a single channel open PCR machine from Chai (Santa Clara, CA).

Methods

Two approaches were used to obtain the exact same chemical environments favorable for purification of cfDNA. Table 1 (“liquid-based method”) describes the reagents used in a solution-based approach that is convenient for small sample sizes. Magnetic beads are one of the most expensive components in the process and we found they are most effective when added in amounts proportional to volume. Therefore, to minimize costs for large volume purifications, we also devised a method in which pure and highly concentrated chemical constituents are added directly to plasma (Table 2; “solid-based method”).

Table 1

Liquid-based method for isolation of total DNA.

Component	Composition	Relative volumes	10 mL plasma prep	Cumulative volume	Notes
Plasma			10 mL	10 mL	Perform in 50 mL screw cap tube
Proteinase K, 20 mg/mL solution	20 mg/mL Proteinase K, 50 mM Tris pH 8.0, 3 mM CaCl2, 50% glycerol v/v	Combine at a ratio of 1 volume Proteinase K solution per 100 volumes of plasma	100 ul	10.1 mL	Mix prior to adding digestion buffer
Digestion buffer	5 M GITC, 25% Tween 20, 50 mM Tris pH 8.0, 25 mM EDTA	Combine at a ratio of ~2 volumes of digestion buffer per 3 volumes of plasma/Proteinase K	6.5 mL	16.6 mL	Heat to 56 C for ~ 1 hour
Binding buffer	3.5 M GITC, 45% isopropanol, 2.5% Tween 20, 10 mM Tris pH 8.0, 1 mM EDTA	Combine at a ratio of ~2 volumes of binding buffer to 1 volume of Plasma/Prot K/Digestion buffer	33 mL	49.6 mL	Mix prior to adding beads
400 nm Silica beads	supplied as a 2.5 mg/mL solution	Combine at a ratio of 1 volume beads to 125 volumes of digested plasma in binding buffer	400 ul	50.0 mL	Mix during addition of beads. Incubate 10 min at RT
Wash solution #1	3 M GITC, 30% isopropanol, 5% Tween 20, 40 mM Bis-Tris pH 6.0, 2 mM EDTA	For every 50 mL tube	5 mL		Perform in 5 mL tube
Wash solution #2	50 mM Tris pH 8.0, 0.5 mM EDTA, 80% EtOH v/v	For every 50 mL tube	5 mL		Perform in 5 mL tube
100% ethanol		For every 50 mL tube	1 mL		Transfer to 1.5 mL tube. Aspirate and dry at 37 C
TE buffer	10 mM Tris pH 8.0, 0.1 mM EDTA	For every 1.5 mL tube, elute with 100 ul then 60 ul	100 ul, then 60 ul		Anticipate volume of ~150 ul of DNA

Table 2

Solid-based method for isolation of total DNA.

Component	Amount per 100 mL of plasma	Cumulative volume	Notes
Plasma	100 mL	100 mL	Perform in a plastic container with the capacity to hold > 250 mL
Proteinase K, 20 mg/mL solution	1 mL	101 mL	20 mg/mL Proteinase K in 50 mM Tris pH 8.0, 3 mM CaCl2, 50% glycerol v/v. Mix with plasma prior to adding digestion reagents
1 M Tris pH 8.0	2.8 mL	140 mL	Add liquid and solid ingredients directly to the plasma/proteinase K. Heat to 56°C. Incubate for one hour at 56°C
0.5 M EDTA	2.8 mL
Solid GITC	33 g
Tween 20	14 g
GITC	56 g	~250 mL	Add the GITC and isopropanol directly to the digested plasma and mix to dissolve. Then add beads, mix, and dispense into 50 mL aliquots. Incubate 10 min, pull aside beads and discard supernatant
isopropanol	75 mL
400 nm Silica beads	2.5 mL
Wash solution #1	25 mL of 3 M GITC, 30% isopropanol, 5% Tween 20, 40 mM Bis-Tris pH 6.0, 2 mM EDTA	5 mL per 50 mL tube	Resuspend pellet in each tube in 5 mL Wash #1. Pool 5 x 5 mL wash volumes = 25 mL into fresh 50 mL tube. Pull aside beads and discard supernatant
Wash solution #2	25 mL of 50 mM Tris pH 8.0, 0.5 mM EDTA, 80% EtOH v/v		Resuspend pellet in 25 mL of Wash #2. Pull aside beads and discard supernatant
100% ethanol	5 mL		Resuspend pellet in 5 mL 100% ethanol. Transfer to 5 mL tube. Pull aside beads, discard supernant, aspirate residual solvent and dry
TE buffer	10 mM Tris pH 8.0, 0.1 mM EDTA	Elute with 1000 ul, then 600 ul	Resuspend dried pellet in 1000 ul TE, pull aside beads, and transfer supernatant into fresh 1.5 mL tube. Perform second elution of beads with 600 ul of TE and pool. Expect to recover~1500 ul of eluate

Both methods were performed in plastic containers and not glass; glass is itself a silica surface that can bind DNA and drastically reduce yields. The first step was to combine proteinase K (formulated at 20 mg/mL in 50 mM Tris pH 8.0, 3 mM CaCl2 and 50% glycerol (v/v); store at 4°C) and plasma. Digestion buffer reagents were then added. Reagents were dissolved by stirring and the reaction was brought to 56°C for approximately one hour. Binding reagents were then combined followed by the addition of beads. This slurry was brought to room temperature for about 5 min and then aliquoted into 50 mL conical centrifuge tubes. The tubes were placed in a magnetic separation rack. Once the beads were aggregated into a pellet, the supernatant was poured into a bio-hazard waste vessel. The beads were then washed with wash buffer #1, wash buffer #2, and 100% ethanol and dried completely. The total DNA was eluted with 15 ul of TE (10 mM Tris pH 8.0, 0.1 mM EDTA) per 1 mL of initial plasma input.

For double-sided solid phase reversible immobilization (SPRI) DNA fragment size selection [14-16], 2 volumes of total DNA were combined with one volume of DNA purification bead solution [17,18]. These were incubated for 10 min at room temperature (RT), the beads were pulled aside, and the 3 volumes of supernatant were transferred to a vessel containing 2 additional volumes of DNA purification beads. The resulting solution was incubated for 10 min, the beads were pulled down (with bound cfDNA nucleosomal fragments), and the bead pellet was washed twice with 1 mL of 70% ethanol/water (v/v), and resuspend in 1 ul per 1 mL of plasma (the yield in ng/ul is also the original quantity in plasma in ng/mL).

For quality analysis, total DNA was purified using both the UltraPrep method and the QIAamp Circulating Nucleic Acid kit from Qiagen/Thermofisher (Hilden, Germany) as instructed by the manufacturer. RNAse A (Qiagen) treatment of QIAamp total DNA was performed by adding the enzyme directly to the total DNA (in elution buffer) to a final concentration of 10 ng/ul followed by incubation at 37°C for 30 min. The yield of total and size-fractionated DNA was measured using a Qubit fluorometer and AccuGreenTM reagents from Biotium. DNA gels were performed in 2% agarose with TBE buffer and stained with Gel Green dye (Biotium). The molecular size standards were the PCR marker from New England Biolabs which are 766, 500, 300, 150 and 50 bp. Alu quantitative PCR (qPCR) was performed with primers GAGGCTGAGGCAGGAGAATCG and GTCGCCCAGGCTGGAGTG [19] with OneTaq hot start (New England Biolabs) and EvaGreenTM dye (Biotium). The Cq values are converted into yield-of-Alu-sequences using the equation Alu yield = power(10,-0.3*Cq+6) in Microsoft Excel. This number was divided by 0.5 ng of input DNA to calculate yield-per-ng. Library construction is evaluated by monitoring the attachment of adapters containing standard Illumina P5 and P7 sequences to cfDNA using a proprietary library construction technology (Ripple Biosolutions, Seattle, WA). The attachment efficiency is evaluated using PCR primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (Illumina-specific) and GAGGCTGAGGCAGGAGAATCG (Alu-specific) and qPCR conditions as described above. The results are quantified using a standard curve of premade cfDNA library material. For determination of the amount of DNA recovered, this same library reference material was spiked into plasma at a concentration of 1 ng/mL prior to extraction or into total DNA at a concentration of 5 ng/mL prior to size selection. The percent recovery relative was determined by comparison to the starting material using the qPCR methods described above.

Results

cfDNA extraction and enrichment

The UltraPrep cfDNA purification method described here is a two-step process. The first step is extraction of total DNA from plasma with an emphasis on near-complete recovery of DNA present in the sample (Fig 1). The second step is size-based separation of nucleosomal-sized cfDNA fragments from hmwgDNA. While the extraction technique described here is superficially similar to many other DNA extraction technologies, our method has several distinctive features. First, proteinase K is often the most expensive reagent used in DNA extraction procedures. To minimize cost, the conditions of the initial digestion step were configured to maximize proteinase activity and thereby allow reduced amounts of the enzyme to be used. This is described in more detail in S1 Fig. Second, several studies have shown that while DNA readily binds to silica surfaces in a variety of chemical conditions, a substantial fraction does so irreversibly [9,10]. Here, the chemistry favors reversible association of DNA with silica beads and therefore robust recovery (~84%) of total DNA (S2 Fig). Third, the DNA purification method is completely passive and therefore mechanical devices such as vacuum pumps or centrifuges are not required. Fourth, the method is scalable, meaning the yield of extracted DNA per milliliter of input is consistent across a broad range of sample input volumes.

Fig 1

UltraPrep procedure for purification of total DNA from plasma using the liquid-based method.

We developed two related approaches for DNA extraction. For smaller sample volumes, a liquid-based protocol that utilizes additions of premade buffers is outlined in Table 1. This is the method illustrated schematically in Fig 1. For larger samples, we developed a method that involves additions of concentrated materials directly to plasma in amounts that recapitulate the chemical environment most favorable for high yield recovery of DNA (Table 2). The former approach is convenient while the latter strategy minimizes cumulative sample volume and therefore the amount of somewhat costly silica beads needed to fully recover total DNA (S3 Fig). Both methods produce comparable yields of cfDNA (S1 Table).

Total DNA extracted from plasma is most often a mixture of nucleosomal fragments and hmwgDNA. These two species can be partitioned into separate fractions using double-sided SPRI [14-16]. The exact proportions of DNA and DNA purification bead solution used in this study are shown in Fig 2. The polyethylene glycol (PEG) and to a lesser extent the salt, that is present in DNA purification bead solutions [17,18], drive binding of DNA onto the surface of carboxyl-coated magnetic beads. The core principle behind double-sided size separation is that there is an inverse relationship between the concentration of PEG and the size of bound DNA fragments. In the first step a more dilute concentration of PEG favors binding of high molecular weight DNA. The supernatant is then added to additional PEG (and SPRI beads) in the second step to recover the nucleosomal cfDNA fragments. The overall recovery of DNA from this enrichment step was about 80% (S4 Fig). This generates an estimate that about 2/3 of the nucleosomal cfDNA fraction (84% from step1 x 80% from step 2 = 67% overall) was recovered in the UltraPrep process. Coincidentally, in the plasmapheresis samples we have worked with, about 1/3 of the total DNA is high molecular weight and 2/3 is nucleosomal cfDNA (for example, see Fig 2).

Fig 2

Double-sided SPRI bead enrichment of nucleosomal cfDNA fragments.

(A) Two volumes of total DNA from the first stage of the UltraPrep procedure are (B) combined with one volume of DNA purification bead solution [17,18]. The numbers to the left of the gel image refer to the sizes of the molecular weight markers in bp. (C) After a 10 min incubation at RT, (D) the beads are pulled aside and the (F) three volumes of supernatant are transferred to (G) two additional volumes of DNA purification beads. (H) The blended mixture is incubated for 5 min and (I) the beads with bound cfDNA are pulled aside, washed with 70% ethanol/water, dried and (J) the DNA is eluted with TE.

Performance

With an eye toward both research applications and clinical utilization of the cfDNA purified using the UltraPrep method, we established four independent assays and a comparison with the industry-standard method to evaluate UltraPrep purified material (Fig 3). First, we measured the yield of double-stranded DNA (dsDNA) using dsDNA-specific fluorescent dyes and a Qubit fluorometer. The typical yield of purified, nucleosomal-sized cfDNA from healthy donor plasmas collected by automated plasmapheresis into sodium citrate was 3–4 ng per mL of plasma (S1 Table). Second, we used agarose gel electrophoresis to determine size distribution of purified material. Acceptable samples exhibited a fragmentation pattern consistent with DNAse cleavage in the linker region between adjacent nucleosomes. An example is shown in Fig 4. Third, several downstream analytical techniques (e.g. ddPCR, targeted amplicon sequencing, BEAMing, etc.) require that the input cfDNA is a robust amplification template devoid of inhibitors. We created an assay to detect PCR inhibition by monitoring the amplification efficiency of human Alu sequences using qPCR at a fixed input amount of purified DNA (0.5 ng/25 ul qPCR reaction). The resulting Cq values generated by the qPCR instrument are converted into yield of Alu amplicons per ng of input DNA using a simple formula (Methods). There is, of course, no “gold standard”, inhibitor-free, human cfDNA sample that we could use to calibrate performance and instead we benchmarked the assay performance across several purified lots of cfDNA; the typical values in units of Alu yield/ng cfDNA were approximately 100 ± 20 (see, for example, Fig 4). Fourth, several quantitative NGS methods for cfDNA analysis rely on the attachment of adapter sequences as a prerequisite for creating genomic cfDNA libraries. The percentage of cfDNA ends that become ligated an adapter is often referred to as the “conversion rate”, and high conversion rates are critical to the success of these methods. We measured percent conversion efficiency using qPCR with a primer pair where one primer was specific for standard Illumina NGS sequences present in the adapter sequence and the other was specific for the human Alu repeat. Using standard curve analysis with a fully adapted cfDNA library control, the assay measured the amount of adapter-modified cfDNA ends per total input amount of cfDNA ends. The ratio between these two values was expressed as the percent conversion efficiency. A proprietary adapter ligation method was used for these measurements (Methods). Typical values across multiple cfDNA preparations was approximately 40 ± 5% (e.g. Fig 4). Finally, most published studies cite the QIAamp Circulating Nucleic Acid kit from Qiagen as the method used for initial purification of cfDNA; in other words, this is the established purification technology by which other methods should be benchmarked. We routinely compared the assay performance metrics for cfDNA purified from the same plasma using the QIAamp procedure and the UltraPrep method.

Fig 3

Four quality assays and one comparison used to evaluate purified cfDNA.

(A) The Qubit fluorometer was used to quantify the amount of double-strand-DNA-specific dye bound to DNA. (B) Agarose gel electrophoresis was used to assess the fragmentation pattern of purified cfDNA. The numbers to the right of the gel image refer to the sizes of the molecular weight markers in bp. (C) Alu sequence-specific qPCR with primers directed to the human Alu sequence [19] were used to measure potential PCR inhibition in purified preparations of cfDNA with a readout of Alu yield detected/ng of DNA. (D) Library construction efficiency was determined by qPCR as the percentage of cfDNA ends attached to an adapter that contains standard Illumina NGS sequences. (E) An aliquot of the plasma samples used in large scale preparations was purified using the industry standard QIAamp technology, and the resulting DNA from both methods was compared using the quality assays described in (A) through (D).

Fig 4

Quality analysis of nucleosomal sized DNA purified from a QIAamp prep and from UltraPrep total DNA.

(A) Total yield of cfDNA fragments. The values for each sample were determined by a single measurement using a Qubit fluorometer. (B) Size distribution of the purified cfDNA. The sizes of the fragments in PCR marker standard are indicated in units of bp. (C) Comparison of Alu yields per ng of cfDNA. (D) Comparison of percent adapter attachment conversion efficiencies.

The comparisons with QIAamp purified cfDNA merit further consideration (Fig 4). Our initial observation was that QIAamp-purified cfDNA had less specific activity for Alu content and lower rates of adapter attachment than cfDNA purified by the UltraPrep method described here. As a specific example of a direct evaluation of methods using the same plasma sample (19359), the Alu yield/ng for QIAamp material was 64 ± 11 versus 107 ± 17 for UltraPrep material (eight replicate determinations for each sample). Similarly, the adapter attachment conversion efficiencies were 19 ± 2% for QIAamp prepared cfDNA versus 39 ± 3% for UltraPrep prepared cfDNA (three replicate measurements of each sample). Further investigation revealed two reasons for this. First, the QIAamp kit is a total DNA isolation method that collects both hmwgDNA and cfDNA fragments. High molecular weight DNA, present to some extent in many plasma samples, performs poorly in the library construction assay, thereby accounting for some of the discrepancy. Second, we found that the carrier RNA routinely added during QIAamp purification is a significant interfering substance. It falsely elevates Qubit readings, resulting in overestimation of DNA concentrations by as much as 50%. In the example shown in Fig 4, the initial total DNA Qubit reading for the QIAamp extracted sample indicated a yield of 12.2 ng/mL plasma. After RNAse A treatment (see Methods), this value dropped to 8.3 ng/mL plasma. Using the same lot of plasma, the total DNA yield from the UltraPrep protocol that does not use carrier RNA was a comparable value of 9.3 ng/mL plasma. After size selection, the yield of nucleosomal fragments from the two methods was essentially the same (Fig 4A). Similarly, the size distribution, Alu PCR and library construction results were more or less identical for both sets of samples.

The UltraPrep method was also successfully applied to whole blood samples collected in lavender-top K2EDTA vacutainer tubes (S1 Table). The yield of nucleosomal-sized cfDNA was rather high in these samples, which, based on equivalent yields from QIAamp and on previous studies [13], we believe to be a characteristic of the sample and not the collection method. The method was also applied to unspun urine that was collected in EDTA-containing vessels. Most of the resulting DNA was high molecular weight, with a broad smear present in the low molecular size fraction (data not shown).

Discussion

The UltraPrep open-source method for purification of cfDNA represents a significant advance in the ability to access this vital diagnostic analyte. It represents a very significant reduction in cost from currently used methods. The cost of cfDNA isolation from human plasma using the current industry standard QiaAmp technology is approximately five dollars per mL of plasma processed. The total cost of reagents and consumables using the UltraPrep process is approximately 50 cents per mL of plasma processed. The yield (ng per mL plasma) of purified nucleosomal fragments from the two methods is indistinguishable. The UltraPrep protocol scales easily from a few mL of plasma to hundreds of mL of plasma with little change in the time and effort required for cfDNA purification. Small- and large-scale purifications can easily be completed in a single day. The resulting purified material performs exceptionally well in downstream analytical assays. The size selection step addresses a major sample collection preanalytical concern by substantially reducing the amount of hmwgDNA that may be present. This is significant since excess hmwgDNA can cause a significant underestimation of the minor allele frequency of rare tumor markers. In our view, size selection is preferable to using fixative-containing blood collection tubes to stabilize blood cells. The same reagents that mitigate cell breakage can potentially cross-link DNA and thereby confound test results.

The UltraPrep method makes purification of microgram quantities of cfDNA from single-donor plasmapheresis collections feasible. This in turn opens new opportunities. For instance, the same cfDNA sample can conceivably be used for diagnostic research, assay development, and testing implementation. A panel of donor samples can be used time and again to calibrate the background noise in newly developed genomic assays. This is particularly important in the case of next-generation sequencing applications where systematic error can generate false positive signals. Moreover, there is an acute need for “truth samples”, comprised of bona fide cfDNA, that can be used for proficiency testing. The current paradigm of comparing cancer patient cfDNA with matched DNA extracted from tumor biopsies invariably generates discrepancies that are most often explained away as biological phenomenon [20]. Similarly, “synthetic cfDNA” spiked with known markers is an uncertain approximation of genuine, physiologically generated DNA [13]. Rather we propose that proficiency testing can feasibly be accomplished by monitoring common genetic polymorphisms in systematically blended cfDNA samples from two unrelated donors [5]. Lastly, our overarching goal is to see tests for early detection of cancer that are conducted during routine wellness exams. Most asymptomatic individuals are capable of donating the quantities of whole blood that will be needed for deep genomic coverage detection tests. UltraPrep technology has the scale to accommodate these higher volume plasma samples.

Yield of total DNA as a function of proteinase K addition.

Identical 10 mL aliquots of several different donor samples were processed using concentrations of proteinase K shown. The quantity of 200 ug/mL plasma (10 ul of a standard 20 mg/mL solution of enzyme added per mL of plasma) that was chosen for the protocol is highlighted in green. This amount of enzyme corresponds to four cents per mL of processed plasma, which is less than 10% of the overall cost. While there were significant yields of DNA in the no-added-enzyme control samples, these samples were “sticky” and extremely difficult to process.

(PPTX)

Click here for additional data file.

Recovery of spiked-in DNA from four replicates of UltraPrep.

The spike-in DNA was a completed cfDNA library with Illumina adapter sequences. This DNA can be specifically detected in a qPCR reaction by using an Illumina P5-specific primer coupled with a human Alu primer (see Methods). One ng per mL of plasma was added. The amount of library in the preprocessed control and four replicates was determined by qPCR using the Illumina + Alu primer pair. The average recovery from the four samples was 84%.

(PPTX)

Click here for additional data file.

Yield of total DNA as a function of silica bead concentration.

Identical 10 mL aliquots of plasma were processed using the microliters of beads/prep volume shown. The yield of total DNA after the initial purification step and of high molecular weight versus nucleosomal-sized DNA is after the size selection step are shown as a function of added bead volume (2.5 mg/mL beads). The prep volume per mL of input plasma is larger for the liquid-based prep than for the solid-based prep by a factor of two-fold. In consideration of this, the quantity of 8 ul/mL prep volume was chosen for the liquid-based prep and 10 ul/mL prep volume for the solid-based prep.

(PPTX)

Click here for additional data file.

Recovery of spiked-in DNA after size fractionation.

The spike-in material was completed cfDNA library with Illumina adapter sequences. Five ng per mL of total DNA was added. The amount of material eluted from the first and second bead pellets was determined by qPCR using the Illumina + Alu primer pair. “Total” recovery is the sum of the two elutions. Percentages were determined by comparison to the starting material.

(PPTX)

Click here for additional data file.

Yields of cfDNA across time and samples.

(XLSX)

Click here for additional data file.

(PDF)

Click here for additional data file.

28 Apr 2020

PONE-D-20-09370

UltraPrep is a scalable, cost-effective, bead-based method for purifying cell-free DNA

PLOS ONE

Dear Dr. Raymond,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Jun 12 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Ruslan Kalendar, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.  PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. Thank you for stating the following in the Competing Interests section:

'The authors that contributed to this study are affiliated with either Ripple Biosolutions (CR and FR) or PlasmaLab International (KH) as employees. In addition, the authors have an ownership stake in these entities. This affiliation does not alter our adherence to PLOS ONE policies on sharing data and materials.'

We note that one or more of the authors are employed by a commercial company: Ripple Biosolutions and PlasmaLab International

Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form.

Please also include the following statement within your amended Funding Statement.

“The funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.”

If your commercial affiliation did play a role in your study, please state and explain this role within your updated Funding Statement.

2. Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.

Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests) . If this adherence statement is not accurate and  there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include both an updated Funding Statement and Competing Interests Statement in your cover letter. We will change the online submission form on your behalf.

Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: No

Reviewer #2: Partly

Reviewer #3: Yes

Reviewer #4: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: N/A

Reviewer #3: N/A

Reviewer #4: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Review Comments to the Author

Reviewer #1:

Title of Reviewed Manuscript: UltraPrep is a scalable, cost-effective, bead-based method for purifying cell-free DNA

Detection of cell free DNA (cfDNA) in plasma currently termed “liquid biopsy” is a growing field with high importance in cancer diagnostics as well as prenatal diagnostics. The author’s approach is to use magnetic beads to separate the full amount of nucleic acid in the sample, then size select for the smaller freely circulating DNA by binding the longer DNA and using the remaining liquid with shorter fragments to bind with new beads by changing the binding conditions. This type of size selection has been demonstrated previously and is not a new innovation to the field. There is no discussion of other enrichment approaches previously reported in the literature and how this approach is different or adds value to the field.

The novelty of this method is the use of dry reagents added directly to plasma for large volume extraction of cfDNA. However, I would not call this approach innovative, it could be useful to those interested in extracting large volumes of plasma.

There are many concerns throughout the text with verb tense and tone, and lack of detail needed for other scientists to replicate the work. Because of this, the recommendation is to require major revisions to the manuscript.

Below are specific concerns of note:

• The size separation approach has been demonstrated before in several forms and should be properly cited by the author. The dry method is interesting and perhaps useful for larger volumes of plasma. This aspect of the study is not mentioned in the abstract.

• The author states that there is a “largely unmet need for large, well-characterized, single-donor lots of normal human cfDNA that can be used for diagnostic test research, assay development, and routine proficiency qualification in clinical laboratory environments.” However, it’s not clear how pre-size selected cFDNA would be helpful in these applications, unless this extraction method is used as the upfront processing for these downstream applications.

• Materials section:

“This seller offers an array of magnetic racks for various tube sizes that are, in our experience, the best available, and they are at a remarkably modest price point.” – Commentary is inappropriate for publication.

• Methods section:

o “Digestion reagents are then added.” Only proteinase K is mentioned in previous sentence, are there more digestion reagents?

o Paragraph reads as an SOP, but wrong tense for manuscript: “For size selection, combine 2 volumes of total DNA with one volume of DNA purification beads [13].

Incubate for 10 min at RTo C, pull aside beads, and transfer the 3 volumes of supernatant to a vessel containing 2 additional volumes of DNA purification beads. Incubate for 10 min, pull down beads (with

bound cfDNA nucleosomal fragments), wash the bead pellet twice with an appropriate volume of 70%

ethanol/water (v/v), and resuspend in 1 ul per 1 mL of plasma (the yield in ng/ul is also the original

quantity in plasma in ng/mL).”

• It is assumed that 100% high molecular weight DNA is removed, but only analyzed by gel electrophoresis, which has much worse sensitivity as compared to PCR. There could be some remaining and contributing to the PCR amplification signals that is just not visible by gel electrophoresis. This is a major concern.

• No indication of number of replicates, error bars in any of the figures.

• All of the actual data is in supplemental figure/tables. Some of these should be in the main text, especially S1 Table. However, S1 table needs more replicates and more rigorous statistical analysis.

• There is PEG mentioned in the text, but not in any of the method details or Tables. Unclear when and how this method was used in the study.

• The reviewer was unable to find these measurements of “amplifiability” and “clonability”reported later in the text.

“We used qPCR measurement of human Alu sequences to establish that the specific “amplifiability” per picogram of purified cfDNA was consistent between purified lots of material and similar to cfDNA purified using the industry standard (QIAamp). Fourth, quantitative NGS methods for cfDNA analysis rely on the attachment of adapter sequences as a prerequisite for creating genomic cfDNA libraries. We monitored the “clonability” of purified cfDNA by measuring the attachment efficiency of adapters containing standard Illumina sequences to cfDNA.”

Reviewer #2:

The paper describes a new open-source, two-step method for purification of cell-free DNA. There is a high demand in non-expensive efficient alternative approaches for cell-free DNA isolation for research purposes, and a publication may attract particular interest in this regard.

Given that reproducibility of the method suggested is the main value of the publication, the 'Materials' section could be enforced by more specific information about the items used (like Cat# or type of silica-coated superparamagnetic beads). For non-standardized items from unknown sellers (like pochekailov), quality alternatives from recognized sellers could be suggested.

Plasma separation and storage conditions may play a key role in quality cfDNA extraction, so authors are suggested to add this information about conditions used in their experiments.

Although some comparison with the leader on a market has been performed, the manuscript will certainly benefit if authors are following one of the formal standardized frameworks for validation of the molecular tests (like https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3002854/, but more could be available).

I am not aware of Research Ethics procedures in commercial organizations and cannot comment on this topic.

Reviewer #3:

Raymond and co-workers authors describe a method for purification of cfDNA that includes selective enrichment of smaller fragments thought to derive from cleavage of human DNA between nucleosomes of apoptotic cells.

Two protocols have been described, for smaller and larger input plasma volumes. The authors compared the performance of the UltraPrep metrics for cfDNA purified from the same plasma using the QIAamp procedure. The cfDNA obtained by the two methods generated similar quality metrics but with 10 times lower cost for UltraPrep.

Here below are my comments:

Page 2

Another potential domain of application of cfDNA is detection of bacterial pathogens (bacteraemia, sepsis). This may be mentioned in the introduction.

“… preanalytical collection conditions often result in plasma that is a mixture of high molecular weight genomic DNA and cfDNA”. This sentence is slightly unclear.

“This seller offers an array of magnetic racks for various tube sizes that are, in our experience, the best available, and they are at a remarkably modest price point. “ I would remove this sentence (looks like an advertisement).

Page 5, Table 1

Please check if 400 nM (nanomolar) Silica beads is correct (also in Table 2). Or you meant 400-nm diameter?

Is proteinase K at 1/50 plasma volume? Or 1/100?

Silica beads are at 1/100 or 1/125 volume?

Remove “.” in “TE Buffer”/“Notes” cell; add the degree symbol where required; if you capitalise the first letter of “isopropanol” than apply the same for “glycerol”.

Page 6, Table 2

The text should be revised.

In “Plasma”/”Notes” delete “cf DNA purification”.

“Digestion step”/“Notes” may be clarified. For instance, If I correctly understood: “Mix the 4 components and heat in a hot water bath at XXX °C to dissolve GITC and Tween 20. Cool to 56 °C, mix with plasma/proteinase K and incubate at 56 °C for 1 hour. (“Monitor temperature and do not exceed 56 C.” may be deleted). Clarify if the components are mixed together prior to adding to plasma/proteinase K or they are added sequentially. If mixed, merge the 4 cells “Cumulative volume” for the 4 digestion reagents (140 mL).

In “TE Buffer”/”Notes” add “eluate” after “DNA”.

grams ---> g

Do 50-mL-tubes accommodate 50 mL + 5 mL (Wash 1) + 5 mL (Wash 2) + 1 mL (ethanol) volume?

Page 9, Caption Fig 4.

“Comparison of Alu units per pg “. “Please indicate what is measured in pg (e.g. ”pg of XXX”).

Page 10, Discussion

In addition to cfDNA purification, plasmapheresis and downstream sequencing or ddPCR generate costs. What percentage of the overall cost is due to cfDNA purification with Qiagen and UltraPrep approaches?

What does UltraPure correspond to?

Figure 2

The figure would be easier to read if you indicate the content of tubes A, B and G directly in the figure.

Typos

“comnparison” on page 8

RT° C ---> room temperature (RT)

Use mL (or ml) but not both

mLs ---> mL

In tables and figures, add space before “M“ (molar) or “mM”

Reviewer #4:

The authors attempt to describe a novel method for purifying small sized nucleic acids from blood and plasma samples. While this is an interesting proposition, the manuscript is not written in a manner consistent with a scientific level publication. Namely, key data from experiments simply is not presented. As such I am unable to fully assess its scientific merits. I want to underscore that any and all data need to presented - key data should be in the manuscript itself and any additional data in the supplemental material. I have highlighted this, along with other points below. One note, please check the supplemental material files - my Powerpoint told me the files are corrupted.

Summary:

RESULTS

1. “First, proteinase K is often the most expensive reagent used in DNA extraction procedures”

a. S1 Fig shows that the lowest concentration was already giving the best results. Why not try lower doses?

b. Others have reported that Proteinase K may not even be needed: http://pubmed.gov/28923054. The main difference here may be the use of a final conc of 2% Triton. If cost is really a concern, it may be worth doing a quick experiment to see if Prot K can be left out. This may have the tangential benefit of preserving the small nuc acids which may degrade during Prot K treatment and reducing the length of the protocol.

2. “Fourth, the method is scalable, meaning the yield of extracted DNA per milliliter of input is consistent across a broad range of sample input volumes.”

a. Was this shown experimentally?

3. “Coincidentally, in the plasmapheresis samples we have worked with, about 1/3 of the total DNA is high molecular weight and 2/3 is nucleosomal cfDNA (for example, see Fig 2).”

a. Show the data that backs up this statement

4. Fig 3:

a. Where’s the data?

5. “First, the QIAamp kit is a total DNA isolation method that collects both high molecular weight genomic DNA and cfDNA fragments”

a. This data should be shown.

6. “Second, we found that the carrier RNA routinely added during QIAamp purification is a significant interfering substance”

a. The Qiagen handbook states that “carrier RNA present in the extracted nucleic acids is likely to dominate UV absorbance readings”, so this is already known. But this shouldn’t be a factor because as stated in the methods section, eluted samples are treated with RNAse and the dye used for Qubit is “dsDNA-specific”. Please explain.

7. Performance section:

a. Please present the data

METHODS

1. Two additional Supplemental files should be provided:

a. 1) A Word document that outlines each protocol in detail (ie step by step)

b. 2) A Excel table that lists the reagents and equipment used for the protocols (along with corresponding catalogue #)

2. A suitable replacement from a commercial vendor needs to be given for the item from Ebay as labs in some countries may not be able to procure from Ebay

3. Please explain in more detail regarding your spike-in libraries. I could not fully understand how you carried out these experiments and how you made the comparisons for percent recovery.

OTHER:

1. “comnparison” – typo

2. Show DNA ladder sizes on your figures

3. Show proper statistics, including standard deviations (I’m assuming experiments were done in replicates and at least 2 independent times)

4. What are you staining you gels with? Is it a ds-DNA specific stain or does it also stain RNA?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Reviewer #4: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

1 May 2020

Not sure what to enter here. I

Submitted filename: 29 April 2020 Rebuttal letter.docx

Click here for additional data file.

14 May 2020

PONE-D-20-09370R1

UltraPrep is a scalable, cost-effective, bead-based method for purifying cell-free DNA

PLOS ONE

Dear Dr. Raymond,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Authors need to prepare responses to the comments of reviewer # 4, including his previous comments. And prepare the manuscript in accordance with these comments.

We would appreciate receiving your revised manuscript by Jun 28 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Ruslan Kalendar, PhD

Academic Editor

PLOS ONE

Reviewers' comments:

Comments to the Author

Reviewer #4: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #4: Partly

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #4: No

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #4: No

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #4: Yes

**********

6. Review Comments to the Author

Reviewer #4:

Authors have not sufficiently addressed my concerns. I cannot in good faith recommend this article for publication. (The authors should know that even though the files were deemed corrupted by my Powerpoint, I was able to open them as google docs and was able to assess their quality.)

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

15 May 2020

Editor Kalendar, We provided a cover letter (the same file was attached as "response to reviewers") describing our response. The second set of comments from Reviewer #4 were not specific and therefore not actionable. As such, we did not revise the revision #1 manuscript in any way. Please help us comply with the requirements of the journal (I included a cell phone #). We believe this paper has merit and will generate a favorable response from your readership. All the best, Chris Raymond

Submitted filename: 14 May 2020 Response to reviewer #4.docx

Click here for additional data file.

18 May 2020

UltraPrep is a scalable, cost-effective, bead-based method for purifying cell-free DNA

PONE-D-20-09370R2

Dear Dr. Raymond,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Ruslan Kalendar, PhD

Academic Editor

PLOS ONE

21 May 2020

PONE-D-20-09370R2

UltraPrep is a scalable, cost-effective, bead-based method for purifying cell-free DNA

Dear Dr. Raymond:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Ruslan Kalendar

Academic Editor

PLOS ONE