Yingxiao Cao1, Shiqi Kong1, Yuling Xin1, Yan Meng2, Shuling Shang2, Yanhui Qi3. 1. Department of Neurosurgery, Xingtai People's Hospital, Xingtai, China. 2. Department of Operating Room, Xingtai People's Hospital, Xingtai, China. 3. Department of Intensive Care Unit, Xingtai People's Hospital, Xingtai, China.
Abstract
Lestaurtinib, also called CEP-701, is an inhibitor of tyrosine kinase, causes haematological remission in patients with AML possessing FLT3-ITD (FLT3 gene) internal tandem duplication and strongly inhibits tyrosine kinase FLT3. Treatment with lestaurtinib modulates various signalling pathways and leads to cell growth arrest and programmed cell death in several tumour types. However, the effect of lestaurtinib on glioma remains unclear. In this study, we examined lestaurtinib and TRAIL interactions in glioma cells and observed their synergistic activity on glioma cell apoptosis. While U87 and U251 cells showed resistance to TRAIL single treatment, they were sensitized to apoptosis induced by TRAIL in the presence of lestaurtinib because of increased death receptor 5 (DR5) levels through CHOP-dependent manner. We also demonstrated using a xenograft model of mouse that the tumour growth was absolutely suppressed because of the combined treatment compared to TRAIL or lestaurtinib treatment carried out singly. Our findings reveal a potential new strategy to improve antitumour activity induced by TRAIL in glioma cells using lestaurtinib through a mechanism dependent on CHOP.
Lestaurtinib, also called CEP-701, is an inhibitor of tyrosine kinase, causes haematological remission in patients with AML possessing FLT3-ITD (FLT3 gene) internal tandem duplication and strongly inhibits tyrosine kinase FLT3. Treatment with lestaurtinib modulates various signalling pathways and leads to cell growth arrest and programmed cell death in several tumour types. However, the effect of lestaurtinib on glioma remains unclear. In this study, we examined lestaurtinib and TRAIL interactions in glioma cells and observed their synergistic activity on glioma cell apoptosis. While U87 and U251 cells showed resistance to TRAIL single treatment, they were sensitized to apoptosis induced by TRAIL in the presence of lestaurtinib because of increased death receptor 5 (DR5) levels through CHOP-dependent manner. We also demonstrated using a xenograft model of mouse that the tumour growth was absolutely suppressed because of the combined treatment compared to TRAIL or lestaurtinib treatment carried out singly. Our findings reveal a potential new strategy to improve antitumour activity induced by TRAIL in glioma cells using lestaurtinib through a mechanism dependent on CHOP.
In adults, glioma is the most damaging and common primary malignant\tumour occurring in the cranium.
For a newly diagnosed glioma, the current standard of care involves surgical resection and subsequent radiotherapy (RT) in addition to concomitant and adjuvant temozolomide (TMZ).
,
However, the prognosis still remains somewhat poor and after diagnosis, median progression‐free survival, median overall survival and a 5‐year survival rate of only 6.9 months, 14.6 months and 9.8%.
,
,
Moreover, often because of the lasting effects of radiation and surgery, the health of survivors is heavily compromised, thus, raising the urgent need for more potent treatment options.
,Induction of apoptosis is a significantly effective mode of action of anticancer agents as well as targeted therapies.
The initiators of the intrinsic apoptotic pathway are growth factor deprivation or DNA damage, and the regulators are the mitochondria and proteins of the Bcl‐2 family.
,
The activation of the extrinsic pathway occurs when death receptors including death receptor 4 (DR4) and DR5 come together, death‐inducing signalling complex (DISC) assembly and caspase‐8 processing.
,
The magnification of apoptotic signalling through the mitochondria is required to induce apoptosis, and for this, in few cells, Bid‐cleavage dependent on caspase‐8 is required.Tumour necrosis factor‐related apoptosis‐inducing ligand (TRAIL) belongs to the TNF family and rapidly initiates apoptosis in vivo and in vitro in several types of tumour cells, while not harming most of the cells that are healthy.
TRAIL interacts with DR4 and DR5 and induces apoptosis, causing the DISC formation after subsequent caspase‐8 binding.
,
As the caspase‐8 comes in contact with the DISC, its proteolytic properties are activated, inducing a proteas cascade including caspase‐3, and facilitating the cleavage of death substrates, ultimately leading to apoptosis.
,
TRAIL has the ability to induce cancer cell apoptosis, only mildly affects normal cells and, thus, is regarded as an anticancer agent with high potential.
However, the majority of tumours, including glioma, remain resistant to TRAIL‐mediated apoptosis.
There are several molecular changes that confer this resistance, such as enhanced levels of anti‐apoptotic molecules and differential expression of death receptors, including X‐linked inhibitors of apoptotic proteins (XIAPs), FLICE‐like inhibitory protein (FLIP) and Bcl‐2‐family proteins (anti‐apoptotic).
,
In fact, therapies combining other anticancer agents with recombinant TRAIL have shown in vitro and in vivo improved efficacy for cancer treatment by modulating TRAIL‐resistant mechanisms.
,
,Lestaurtinib (former name, CEP‐701) is a tyrosine kinase inhibitor, that is multi‐targeted and was involved at nanomolar concentrations in potently inhibiting FLT3 in pre‐clinical studies, leading to its development as a potential targeted agent in acute myeloid leukaemia.
,
Studies have recently shown that the inhibitory activity of lestaurtinib is not only directed towards FLT3 but can suppress STAT5/JAK2 signalling through specific JAK2 inhibition.Therefore, our study explored this antitumour function of lestaurtinib in combination with TRAIL on both xenograft mouse model and glioma cells, and also invested its possible mode of action.
MATERIALS AND METHODS
Cells culture and reagents
Glioma cell lines U87 and U251 were procured from the American Type Culture Collection (ATCC) and were maintained in RPMI 1640 (Gibco) along with foetal bovine serum (10% v/v, Sigma) and 1% streptomycin‐penicillin from Invitrogen at 37°C in a CO2 incubator at specific humidity. Lestaurtinib was obtained from Sigma‐Aldrich, and its solution was prepared in dimethyl sulfoxide (DMSO). Normal human astrocytes (NHAs) were procured from Lonza and cultured as per supplied instructions.
MTT assay
The MTT assay was carried out to assess the effects of TRAIL, lestaurtinib or their combination on cell proliferation. The seeding of cells was done in a 96‐well plate in their exponential growth phase at a density of 5 × 103 cells/well. After 24 hours, lestaurtinib, TRAIL or their combination was mixed into the medium and incubated at 37°C for one full day, and then, their viability was assessed by MTT [3‐(4, 5‐dimethylthiazol‐2‐yl)‐2, 5‐diphenyl‐2H‐tetrazolium bromide] assay colorimetrically at 570 nm on a TECAN Safire Fluorescence Absorbance and Luminescence Reader. The following formula was used to calculate cell viability: Cell viability (%) = average of A 570 nm of the treated group/average of A 570 nm of the control group × 100%. Each experiment was repeated at least thrice and performed in quadruplicate.
siRNA transfection
Cells were transfected with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Knockdown experiments were performed 24 hours prior to drugs treatment using 200 pmole of siRNA. The control scrambled siRNA and siRNA for humanCHOP (AAGACCCGCGCCGAGGUGAAG) and DR5 (AAGACCCUUGUGCUCGUUGUC) were from Dharmacon.
Chromatin immunoprecipitation (ChIP)
ChIP with CHOP antibody (Abcam) was performed using the Chromatin Immunoprecipitation Assay Kit (Millipore) according to the manufacturer's instructions. The precipitates were analysed by PCR using the primers 5ʹ‐AGGTTAGTTCCGGTCCCTTC‐3ʹ and 5ʹ‐CAACTGCAAATTCCACCACA‐3ʹ to amplify a DR5 promoter fragment containing CHOP binding sites.
Flow cytometry
The percentage of apoptotic cells was determined using the Annexin V‐FITC kit as per instructions from BD Biosciences. In brief, glioma cells were incubated for 24 hours with lestaurtinib, TRAIL or their combination. The collected treated cells were then trypsinized for 180‐300 s, given two‐time wash with cold PBS (phosphate‐buffered saline) and resuspended at 1 × 106 cells/mL in binding buffer. Post‐incubation, 100 μL of this was aliquoted to a culture tube of 5 mL capacity, and 5 μL each of Annexin V‐FITC and PI (20 μg/mL of each) was added. This tube was centrifuged gently at 112 g for 5 minutes and kept in the dark for 15 minutes at room temperature. At the end of 15 minutes, binding buffer (400 μL) was added and immediately analysed by flow cytometry (BD Biosciences).
Cell surface DR5 assay
To detect DR5 cell surface expression, indicated cells treated with lestaurtinib for 24 hours were incubated with anti‐DR5‐FITC and anti‐mouse IgG antibodies (Abcam) for 30 minutes at room temperature. The stained cells were analysed by the CellQuest Software with the FACSCalibur flow cytometer.
Assay for colony formation
This was performed as previously described.
,
In brief, indicated cells were plated in triplicates in tissue culture Petri dish (60 mm; Greiner) containing culture medium (3 mL) and grown at 37°C with CO2 (5%). After 48 hours, culture and adherence of cells to the plate, the fresh medium was added to rinse, and lestaurtinib, TRAIL or lestaurtinib+TRAIL was added to the medium for one 24 hours, given two‐time wash twice with PBS and then grown in medium free of drugs. Every 5 days, the medium was removed and fresh medium was added. After two weeks, each dish was washed three times with PBS after discarding the medium carefully. The cells were methanol‐fixed for 15 minutes and stained with Giemsa regent (1:10; Merck Biosciences) for 20 minutes. The cells were considered as a colony if they had 200 or more cells and visualized and counted under an inverted microscope from Zeiss at 40‐fold magnification. Triplicate plates were used to determine colony numbers. The growth of the colony was correlated to that of control value with no treatment.
Assay for caspase activity
Activities of caspase‐3 and caspase‐7 were assessed using activity assay kits for colorimetry from Chemicon International as per instructions. The principle of the assay is caspase‐3–mediated and caspase‐7–mediated cleavage of chromogenic substrates, DEVD‐pNA and LEHD‐pNA. Lysis of cells was done for 10 min in ice‐cold lysis buffer and centrifuged at 10 000 × g for 5 minutes. Then, the caspase substrate solution with a particular peptide substrate was mixed with the supernatant and incubated for 120 minutes at 37°C and absorbance was measured at 405 nm by an ELISA reader.
Western blotting
Western blotting was performed as previously studies.
,
Lestaurtinib and TRAIL were added singly or in combination with the cells for 24 hours, and then, RIPA buffer (Beyotime) was used to lyse cells with cocktail tablets (EDTA free; Sigma) containing protease inhibitor. After centrifugation (12 000 × g for 10 minutes), supernatants were collected and the estimation of protein amount was done by the protein assay kit from Bio‐Rad. The preparation of nuclear extracts was done as previously described. The standard protocol was used for Western blotting. For this, SDS‐PAGE was done to separate equal amounts of proteins and transferred onto membranes made of nitrocellulose, blocked with milk (non‐fat, 5%) prepared in TBST (TBS with 0.1% Tween‐20), and the addition of primary antibodies was done, followed by incubation. Secondary antibodies were goat anti‐rabbit or goat anti‐mouse and coupled to horseradish peroxidase (Cell Signaling Technology) which were then densitometrical visualized and measured using ECL and Western blot detection reagents from GE Healthcare. The intensity of signals was measured by Image J software from NIH (Bethesda). Each experiment was carried out in triplicate and assayed at least thrice independently. The primary antibodies used in this study are list as follows: cleaved PARP (#9548, Cell Signaling Technology), cleaved caspase 3 (#9661, Cell Signaling Technology), cleaved caspase 8 (#9748, Cell Signaling Technology), cleaved caspase 9 (#9509, Cell Signaling Technology), PUMA (#4976, Cell Signaling Technology), Bcl‐2 (#15071, Cell Signaling Technology), Bcl‐XL (#2762, Cell Signaling Technology), Mcl‐1 (#4572, Cell Signaling Technology), Bid (ab201754, Abcam), Bax (ab32503, Abcam), Bad (ab32445, Abcam), DR5 (ab8416, Abcam), DR4 (ab8414, Abcam), MZF1 (ab64866, Abcam), p‐p65 (ab76302, Abcam), p65 (ab32536, Abcam), CHOP (ab11419, Abcam), p‐eIF2α (ab32157, Abcam), p‐PERK (ab192591, Abcam) and β‐actin (#5441, Sigma).
DR5 knockout cell generation
DR5 knockout was generated using CRISPR/cas 9 system.
,
Short guide RNA sequences for DR5 were designed at website (http://crsipr,mit.edu), which provided by Feng Zhang Lab. U87 cells were transfected with pX458‐DR5 using Lipofectamine 3000 base on the manufacturer's instructions. 48 hours later, single GFP‐positive cells were sorted by flow cytometry and seeded in 96‐well plate. After 2 weeks, colonies were identified by Western blotting.
Real‐time PCR
Real‐time PCR was performed as previously studies.
,
Incubation of cells was done for one full day with TRAIL, lestaurtinib or their combination of two drugs for 24 hours. From the treated cells, total RNA was isolated using TRIzol reagent from Invitrogen (USA) as per instructions, and from it, cDNA was made using Takara's PrimeScript RT Reagent Kit. Quantitative real‐time PCR was carried out on a CFX96 Real‐Time System from Bio‐Rad Laboratories (USA) using with Supermix SsoFast EvaGreen. Analyses were done in triplicates, and all data were presented as the means of fold change, normalized with those of GAPDH. The primers used in this study are list as follows: DR5, F/R: 5’‐GGGAGCCGCTCATGAGGAAGTTGG‐3’/5’‐GGCAAGTCTCTCTCCCAGCGTCTC‐3’; DR4, F/R: 5’‐CTGAGCAACGCAGACTCGCTGTCCAC‐3’/5’‐CAAAGGACACGGCAGAGCCTGTGCCA‐3’; CHOP, F/R: 5’‐CAGAACCAGCAGAGGTCACA‐3’/5’‐AGCTGTGCCACTTTCCTTTC‐3’ and GAPDH, F/R: 5’‐TGGAAGGACTCATGACCACA‐3’/5’‐TTCAGCTCAGGGATGACCTT‐3’.
DAPI staining
Morphological evaluation of nuclei was done using DAPI staining.
Incubation of glioma cells was done with lestaurtinib, TRAIL or their combination for one full day. Rinsing of treated cells was done two times with cold PBS in the six‐well plate; then, DAPI solution (1 μg/mL) was used for 10 min to stain at 37°C in dark and then given twice wash with cold PBS. Finally, imaging of cells in the plate was done under an inverted fluorescence microscope CKX41 from Olympus (Japan). A minimum of 300 cells were counted and categorized based on the image of their condensed nuclei.
Animal tumour model experiment
The animal experiment was approved by the Animal Care and Use Committee of Xingtai People's Hospital. The Shanghai Laboratory Animal Center (China) provided the nude mice (athymic, 6‐8 weeks old), which were kept in germ‐free conditions. The mice were cared for as per Chinese legal requirements. The dorsal flanks of mice were subcutaneously injected with WT or DR5‐KO U87 cells (5 × 105 cells/100 μL). Every 2 days, tow longest perpendicular diameters of the tumour were measured using calipers to monitor tumour volumes. Random categorization of all mice bearing tumours was done into four groups, and when (on 8th day) tumour volume reached nearly 100 mm3, treatment was initiated. Intraperitoneal injections of lestaurtinib (10 mg/kg), TRAIL (100 μg/mouse) or their combination every two days was given to the mice for 21 days in total, whereas the control mice received PBS injection. inhibition of tumour growth was evaluated to determine the antitumour activity of treatments. The tumour volume was mimicked using the formula, tumour volume = length×width2 × 1/2. The tumours were weighed after collecting at the study end. In vivo toxicity of different treatments was evaluated by examining the bodyweight of the treated mice.In a simultaneous animal assay (four groups, six mice in each group), similar drug treatment and establishment of tumours were done as described above. These mice were killed on the 21st day, and tumours were collected, formaldehyde‐fixed (at 4%), paraffin‐embedded and made into sections for staining using TUNEL as per standard protocol. In tumour sections (two sections/mouse, a total of three mice), apoptotic cells were observed by the TUNEL technique as per instructions from Merck Biosciences.
Statistical analysis
The Prism IV software was utilized for all statistical analyses. Data were expressed as the mean ± standard deviations (SD). Two‐tailed Student's t test was carried out for analysing paired data. For comparing multiple factors, statistical analyses were carried out using ANOVA with a Tukey post‐test. Deemed significant value for all analyses was P < .05.
RESULTS
The effect of lestaurtinib combined with TRAIL on tumour cell growth
Prior to this evaluation, we first assessed through MTT assay the cytotoxicity of TRAIL monotherapy on U87 and U251glioma cell lines. We observed no significant antitumour effect on U87 and U251 cells, at 50 ng/mL or lower concentration of TRAIL, indicating that these cell lines were resistant to TRAIL monotherapy or had low sensitivity (Figure 1A,B). Further, to assess the effect of TRAIL combined with lestaurtinib on the proliferation of tumour cells, MTT assay was performed. The cell lines U87 and U251 were treated with a specific concentration of lestaurtinib and TRAIL for 72 hours. As shown in Figure 1C, we found strong synergistic effects of lestaurtinib and TRAIL in U87 and U251 cells. The combination index (CI) values of lestaurtinib and TRAIL are shown in Figure 1D. However, there was no cytotoxicity exhibiting synergism in NHAs cells (Figure 1E). The results indicate better TRAIL‐inhibited proliferation of tumour cells by lestaurtinib at concentration below toxicity without harming the normal cells. Here, even after using the highest concentration of lestaurtinib, it could not induce significant inhibition of proliferation. Hence, for subsequent assays, lestaurtinib at 200 nmol/L and TRAIL at 25 ng/mL were chosen for combined therapy.
Figure 1
Lestaurtinib enhances TRAIL‐induced cell proliferation inhibition of glioma cells. A, U87 cells were treated with TRAIL at indicated concentration, and cell viability was analysed by MTT. B, U251 cells were treated with TRAIL at indicated concentration, and cell viability was analysed by MTT. C, U87 and U251 cells were treated with TRAIL+Lestaurtinib at indicated concentration, and cell viability was analysed by MTT. D, Combination index is shown for U87 and U251 cells. Fa, fraction affected. (E, NHAs cells were treated with TRAIL+lestaurtinib at indicated concentration, and cell viability was analysed by MTT
Lestaurtinib enhances TRAIL‐induced cell proliferation inhibition of glioma cells. A, U87 cells were treated with TRAIL at indicated concentration, and cell viability was analysed by MTT. B, U251 cells were treated with TRAIL at indicated concentration, and cell viability was analysed by MTT. C, U87 and U251 cells were treated with TRAIL+Lestaurtinib at indicated concentration, and cell viability was analysed by MTT. D, Combination index is shown for U87 and U251 cells. Fa, fraction affected. (E, NHAs cells were treated with TRAIL+lestaurtinib at indicated concentration, and cell viability was analysed by MTT
Glioma cell lines are sensitized by lestaurtinib for TRAIL‐induced apoptosis and colony formation
Next, we examined whether the glioma cells could be made sensitive by lestaurtinib to TRAIL‐induced apoptosis. As per flow cytometric assays, a noticeable enhancement of the rate of apoptosis of treated U87 and U251 cells was observed after lestaurtinib and TRAIL combined treatment, in comparison with monotherapy using lestaurtinib or TRAIL (Figure 2A,B), which can be attenuated by pre‐treatment with z‐VAD‐fmk (Figure 2C,D).
Figure 2
Lestaurtinib enhances TRAIL‐induced cell apoptosis, and the combination of two drugs suppresses the clonogenic growth of glioma cells. A, U87 cells were exposed to lestaurtinib (200 nmol/L) and/or TRAIL (25 ng/mL). 24 h later, apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. B, U251 cells were exposed to lestaurtinib (200 nmol/L) and/or TRAIL (25 ng/mL). 24 h later, apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. C, U87 cells were pretreated with 10 μmol/L z‐VAD‐fmk for 30 min and then exposed to lestaurtinib (200 nmol/L)+TRAIL (25 ng/mL). 24 h later, apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. D, U251 cells were pretreated with 10 μmol/L z‐VAD‐fmk for 30 min and then exposed to lestaurtinib (200 nmol/L)+TRAIL (25 ng/mL). 24 h later, apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. E, Colony formation ability of U87 cells treated with lestaurtinib (200 nmol/L) and/or TRAIL (25 ng/mL). F, Colony formation ability of U251 cells treated with lestaurtinib (200 nmol/L) and/or TRAIL (25 ng/mL). Results were expressed as means ± SD of 3 independent experiments. **, P < .01
Lestaurtinib enhances TRAIL‐induced cell apoptosis, and the combination of two drugs suppresses the clonogenic growth of glioma cells. A, U87 cells were exposed to lestaurtinib (200 nmol/L) and/or TRAIL (25 ng/mL). 24 h later, apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. B, U251 cells were exposed to lestaurtinib (200 nmol/L) and/or TRAIL (25 ng/mL). 24 h later, apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. C, U87 cells were pretreated with 10 μmol/L z‐VAD‐fmk for 30 min and then exposed to lestaurtinib (200 nmol/L)+TRAIL (25 ng/mL). 24 h later, apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. D, U251 cells were pretreated with 10 μmol/L z‐VAD‐fmk for 30 min and then exposed to lestaurtinib (200 nmol/L)+TRAIL (25 ng/mL). 24 h later, apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. E, Colony formation ability of U87 cells treated with lestaurtinib (200 nmol/L) and/or TRAIL (25 ng/mL). F, Colony formation ability of U251 cells treated with lestaurtinib (200 nmol/L) and/or TRAIL (25 ng/mL). Results were expressed as means ± SD of 3 independent experiments. **, P < .01We then inquired whether the clonogenic growth of glioma cells was affected after lestaurtinib treatment and simultaneous exposure to TRAIL. As per our colony‐forming assays, TRAIL or lestaurtinib singly could only minimally inhibit the clonogenic growth of U87 and U251 cells. On the contrary, TRAIL and lestaurtinib combined treatment remarkably repressed U87 and U251 cells clonogenic growth (Figure 2E,F).
Glioma cells are sensitized by lestaurtinib to TRAIL‐induced apoptosis
To explore the mechanism of apoptosis induced by lestaurtinib/TRAIL in U87 cells, we examined caspase activation in U87TRAIL‐resistant cells after treatment with lestaurtinib with or without TRAIL. We found only little proteolytic processing of procaspase‐8, procaspase‐9 and procaspase‐3 occurred due to lestaurtinib and TRAIL single treatment. Contrastingly, TRAIL and lestaurtinib combination led to an apparently more enhanced cleavage because of the proteolysis of procaspase‐8, procaspase‐9 and procaspase‐3 (Figure 3A). Moreover, while TRAIL or lestaurtinib alone could not induce PARP cleavage, treatment with their combination caused PARP cleavage (Figure 3A). According to the caspase 3/7 activity, activities of caspases‐3/7 were enhanced by the combination treatment compared to single treatment (Figure 3B). When these treated cells were then co‐treated with the inhibitors of caspase, z‐VAD‐fmk, it abolished the activation of caspase induced by cotreatment with lestaurtinib and TRAIL (Figure 3B). Thus, activation of an apoptotic pathway involving caspase is one of the primary modes of exerting a synergistic effect of lestaurtinib on the TRAIL‐treated U87 cells. On examining the effect of lestaurtinib on TRAIL sensitization in U87 and U251 cells, we examined the effect of lestaurtinib on Bcl‐2 family proteins. Our findings demonstrated that treatment of glioma cells with lestaurtinib not affect Bax, Bad, Bcl‐2 and Bcl‐xl levels, but promoted Bid activation (Figure 3C,D). Our results indicated that lestaurtinib enhanced TRAIL‐induced apoptosis.
Figure 3
Sensitization of TRAIL‐induced apoptosis by lestaurtinib treatment is mediated through the caspase‐dependent mitochondrial pathway in glioma cells. A, U87 and U251 cells were treated with lestaurtinib (200 nmol/L), TRAIL (25 ng/mL) or their combination. Indicated proteins were analysed by Western blotting. B, U87 cells were pretreated with 10 μmol/L z‐VAD‐fmk for 30 min and then treated with lestaurtinib (200 nmol/L), TRAIL (25 ng/mL) or their combination for another 24 h. Caspase 3/7 activation was analysed. C, U87 cells were treated with lestaurtinib (200 nmol/L), TRAIL (25 ng/mL) or their combination. Indicated proteins were analysed by Western blotting. D, U251 cells were treated with lestaurtinib (200 nmol/L), TRAIL (25 ng/mL) or their combination. Indicated proteins were analysed by Western blotting. Results were expressed as means ± SD of 3 independent experiments. **, P < .01
Sensitization of TRAIL‐induced apoptosis by lestaurtinib treatment is mediated through the caspase‐dependent mitochondrial pathway in glioma cells. A, U87 and U251 cells were treated with lestaurtinib (200 nmol/L), TRAIL (25 ng/mL) or their combination. Indicated proteins were analysed by Western blotting. B, U87 cells were pretreated with 10 μmol/L z‐VAD‐fmk for 30 min and then treated with lestaurtinib (200 nmol/L), TRAIL (25 ng/mL) or their combination for another 24 h. Caspase 3/7 activation was analysed. C, U87 cells were treated with lestaurtinib (200 nmol/L), TRAIL (25 ng/mL) or their combination. Indicated proteins were analysed by Western blotting. D, U251 cells were treated with lestaurtinib (200 nmol/L), TRAIL (25 ng/mL) or their combination. Indicated proteins were analysed by Western blotting. Results were expressed as means ± SD of 3 independent experiments. **, P < .01
Lestaurtinib makes glioma cells sensitive to apoptosis induced by TRAIL via enhanced levels of DR5 via a mechanism dependent on CHOP
DR4 and DR5, the TRAIL receptors, which harbour functional death domains, may initiate signals of apoptosis after bonding of TRAIL.
According to the real‐time PCR assay, lestaurtinib remarkably enhanced the DR5, but not DR4, transcript levels in U87 and U251 cells (Figure 4A). Further, lestaurtinib significantly enhanced DR5 expression in both glioma cell lines, as revealed by Western blotting (Figure 4B). Flow cytometry results show that lestaurtinib increased cell surface expression of DR5 in U87 and U251 cells (Figure 4C). In addition, we also found another FLT3‐ITD inhibitor gilteritinib induced DR5 up‐regulation in U87 and U251 cells in a time‐dependent manner (Figure 4D). Hence, the increase in DR5 expression may bestow enhanced sensitivity of U87 and U251 cells to lestaurtinib and apoptosis induced by TRAIL.
Figure 4
Lestaurtinib promotes DR5 induction via CHOP up‐regulation. A, U87 and U251 cells were treated with lestaurtinib at indicated time‐points. mRNA level of DR4 and DR5 was analysed by real‐time PCR. B, U87 and U251 cells were treated with lestaurtinib at indicated time‐points. Protein level of DR4 and DR5 was analysed by Western blotting. C, U87 and U251 cells were treated with lestaurtinib for 24 h. Cell surface DR5 level was determined by flow cytometry. D, U87 and U251 cells were treated with 500 nmol/L gilteritinib at indicated time‐points. Protein level of DR4 and DR5 was analysed by Western blotting. E, U87 cells were treated with lestaurtinib at indicated time‐points. Indicated protein level was analysed by Western blotting. F, U87 and U251 cells were treated with lestaurtinib at indicated time‐points. Indicated protein level was analysed by Western blotting. G, U87 and U251 cells were treated with lestaurtinib at indicated time‐points. mRNA level of CHOP was analysed by real‐time PCR. H, U87 cells transfected with siRNA against CHOP were treated with lestaurtinib for 24 h. Indicated protein level was analysed by Western blotting. I, Chromatin immunoprecipitation (ChIP) was performed using anti‐CHOP antibody on U87 cells following lestaurtinib treatment for 6 h. The IgG was used to control for antibody specificity. PCR was carried out using primers surrounding the CHOP binding sites in the DR5 promoter. Results were expressed as means ± SD of 3 independent experiments. *, P < .05; **, P < .01
Lestaurtinib promotes DR5 induction via CHOP up‐regulation. A, U87 and U251 cells were treated with lestaurtinib at indicated time‐points. mRNA level of DR4 and DR5 was analysed by real‐time PCR. B, U87 and U251 cells were treated with lestaurtinib at indicated time‐points. Protein level of DR4 and DR5 was analysed by Western blotting. C, U87 and U251 cells were treated with lestaurtinib for 24 h. Cell surface DR5 level was determined by flow cytometry. D, U87 and U251 cells were treated with 500 nmol/L gilteritinib at indicated time‐points. Protein level of DR4 and DR5 was analysed by Western blotting. E, U87 cells were treated with lestaurtinib at indicated time‐points. Indicated protein level was analysed by Western blotting. F, U87 and U251 cells were treated with lestaurtinib at indicated time‐points. Indicated protein level was analysed by Western blotting. G, U87 and U251 cells were treated with lestaurtinib at indicated time‐points. mRNA level of CHOP was analysed by real‐time PCR. H, U87 cells transfected with siRNA against CHOP were treated with lestaurtinib for 24 h. Indicated protein level was analysed by Western blotting. I, Chromatin immunoprecipitation (ChIP) was performed using anti‐CHOP antibody on U87 cells following lestaurtinib treatment for 6 h. The IgG was used to control for antibody specificity. PCR was carried out using primers surrounding the CHOP binding sites in the DR5 promoter. Results were expressed as means ± SD of 3 independent experiments. *, P < .05; **, P < .01Then, the mode of lestaurtinib‐mediated induction of DR5 in glioma was investigated through Western blotting to assess the role of several transcription factors.
,
The phosphorylation of p65 did not occur after lestaurtinib treatment, and thus, it is not involved. Another transcription factor, MZF1 level, also did not change after lestaurtinib treatment and was therefore ruled out (Figure 4E). Earlier studies have indicated the role of CHOP in DR5 induction and its contribution to enhanced sensitivity of TRAIL‐mediated apoptosis.
Thus, we examined the role of lestaurtinib on CHOP expression and other ER (endoplasmic reticulum) stress markers. Our results indicated several ER stress activation markers, such as e‐IF2α and p‐PERK, besides CHOP up‐regulation in a time‐dependent manner upon lestaurtinib treatment (Figure 4F). Furthermore, enhanced transcript levels of CHOP were observed after lestaurtinib treatment (Figure 4G). Moreover, the siRNA‐mediated knockdown of CHOP clearly repressed DR5 induction by lestaurtinib (Figure 4H). The direct role of CHOP in activating DR5 transcription was evaluated through ChIP (chromatin immunoprecipitation) assay, which revealed the recruitment of CHOP to CHOP binding sites on DR5 promotor after lestaurtinib treatment (Figure 4I). Our results indicated lestaurtinib‐induced CHOP‐dependent DR5 induction.
DR5 is required for lestaurtinib sensitizes TRAIL in glioma
Next, we determined whether DR5 induction is involved in lestaurtinib‐mediated TRAIL sensitivity in glioma. As shown in Figure 5A, knockdown of DR5 by siRNA abrogated the combination of lestaurtinib/TRAIL‐induced caspase activation. Furthermore, we compared the effects of the combination of lestaurtinib/TRAIL on apoptosis and caspase activation in WT and DR5‐KO U87 cells (Figure 5B). Our results indicated that apoptosis induced by lestaurtinib/TRAIL was suppressed significantly in DR5‐KO cells (Figure 5C). Moreover, lestaurtinib/TRAIL promotes caspase‐3 activation in WT U87 cells, but was attenuated in DR5‐KO U87 cells (Figure 5D). Moreover, knockdown of DR5 using siRNA significantly suppressed lestaurtinib/TRAIL‐induced caspase‐3 and caspase‐8 activation in U251 cells (Figure 5E). The above data suggest that lestaurtinib up‐regulates DR5 expression, which is required for the sensitization to TRAIL.
Figure 5
DR5 is required for lestaurtinib+TRAIL‐induced apoptosis in glioma cells. A, U87 cells transfected with siRNA against DR5 were treated with lestaurtinib+TRAIL for 24 h. Caspase activation was analysed by Western blotting. B, WT and DR5‐KO U87 cells were treated lestaurtinib+TRAIL for 24 h. DR5 was analysed by Western blotting. C, WT and DR5‐KO U87 cells were treated with lestaurtinib+TRAIL for 24 h. Apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. D, WT and DR5‐KO U87 cells were treated with lestaurtinib+TRAIL for 24 h. Cleaved caspase 3 was analysed by Western blotting. E, U251 cells transfected with siRNA against DR5 were treated with lestaurtinib+TRAIL for 24 h. Indicated protein level was analysed by Western blotting. Results were expressed as means ± SD of 3 independent experiments. ***, P < .001
DR5 is required for lestaurtinib+TRAIL‐induced apoptosis in glioma cells. A, U87 cells transfected with siRNA against DR5 were treated with lestaurtinib+TRAIL for 24 h. Caspase activation was analysed by Western blotting. B, WT and DR5‐KO U87 cells were treated lestaurtinib+TRAIL for 24 h. DR5 was analysed by Western blotting. C, WT and DR5‐KO U87 cells were treated with lestaurtinib+TRAIL for 24 h. Apoptosis was analysed by Annexin V/PI staining followed by flow cytometry assay. D, WT and DR5‐KO U87 cells were treated with lestaurtinib+TRAIL for 24 h. Cleaved caspase 3 was analysed by Western blotting. E, U251 cells transfected with siRNA against DR5 were treated with lestaurtinib+TRAIL for 24 h. Indicated protein level was analysed by Western blotting. Results were expressed as means ± SD of 3 independent experiments. ***, P < .001
Lestaurtinib significantly inhibits tumour growth in vivo by increasing TRAIL sensitivity of subcutaneous glioma xenografts
The antitumour function of TRAIL and lestaurtinib combination was examined in a tumour xenograft model of athymic nude mice by transplanting WT and DR5‐KO U87cancer cells. Post‐implantation, on the 8th day, after categorizing the mice into four groups, with each group containing at least eight mice bearing tumours, tumours were examined. The volume of the tumour was reduced significantly 21 days after intraperitoneal injection of lestaurtinib and TRAIL for in contrast to monotherapy using lestaurtinib or TRAIL (Figure 6A,B). However, DR5‐KO tumours are insensitive to the combination treatment. The tumours were excised at the study end and weighed for each group. A clear decrease in tumour weight was observed in the combination therapy group in comparison with the control group, or monotherapy using lestaurtinib or TRAIL (Figure 6C). Additionally, no obvious toxicity, behavioural change and alterations in body mass (Figure 6D) were observed in mice treated with lestaurtinib alone, TRAIL alone, or lestaurtinib and TRAIL combined. The mice xenografts from lestaurtinib, or the combination groups, showed increased DR5 levels (Figure 6E). Thus, the in vitro and in vivo analyses show the TRAIL‐sensitizing effect of lestaurtinib on glioma cells through the same process involving DR5 regulation. Finally, the TUNEL assay indicated that the combined treatment inhibited U87tumours in vivo by inducing apoptosis (Figure 6F,G).
Figure 6
Lestaurtinib and TRAIL combined therapy inhibits in vivo tumour xenograft growth. WT and DR5‐KO U87 cells were injected subcutaneously into the dorsal flanks of athymic nude mice. One week later, mice were i.p. with lestaurtinib and TRAIL or the combination of two drugs every two day for a total of 11 days. A, The tumour growth inhibitory effects of different treatments were compared in WT and DR5‐KO tumours. B, Representative tumours at the end of the experiment in (A). C, At the end of the study, the excised tumours from each group were weighed. D, The weight of nude mice from each group did not change significantly during the experiment. E, Expression of DR5 in tumours after lestaurtinib and TRAIL treatment. F, G, Tissue sections were analysed by TUNEL staining. Representative staining pictures (F); TUNEL‐positive cells were counted and plotted (G). Scale bar: 25 μm
Lestaurtinib and TRAIL combined therapy inhibits in vivo tumour xenograft growth. WT and DR5‐KO U87 cells were injected subcutaneously into the dorsal flanks of athymic nude mice. One week later, mice were i.p. with lestaurtinib and TRAIL or the combination of two drugs every two day for a total of 11 days. A, The tumour growth inhibitory effects of different treatments were compared in WT and DR5‐KO tumours. B, Representative tumours at the end of the experiment in (A). C, At the end of the study, the excised tumours from each group were weighed. D, The weight of nude mice from each group did not change significantly during the experiment. E, Expression of DR5 in tumours after lestaurtinib and TRAIL treatment. F, G, Tissue sections were analysed by TUNEL staining. Representative staining pictures (F); TUNEL‐positive cells were counted and plotted (G). Scale bar: 25 μm
DISCUSSION
In several cancers, including glioma, chemotherapy using a combination of agents produces a better response rate than those obtained with single agent.
,
,
However, the therapies may be successful only to a limited extent, and one of the reasons may be drug resistance.
,
The survival is more than a year in only few cases after treatment, indicating the need to develop novel agents and approaches to improve the therapies in gliomapatients. Therefore, a proper knowledge of the biochemical basis of apoptosis and other mechanism that lead to anticancer drugs resistance is therefore crucial to potentially activate distinct or overlapping apoptotic pathways to improve the antitumour effects.We showed, in this study, the synergism between TRAIL and lestaurtinib in glioma cells. TRAIL can induce apoptosis of tumour cells and spare healthy cells, thus making it a novel antitumour target for cancer treatment, although many cancer types are not sensitive to apoptosis induced by TRAIL.
Therefore, it is vital to use agents to make cancer cells sensitive to apoptosis induced by TRAIL. While lestaurtinib has been shown to be antitumour for several humantumours, its effect is limited and its role, when combined with other anticancer drugs, has not been evaluated extensively.
To this effect, we show here that lestaurtinib improved the cell death in glioma cells induced by TRAIL. Furthermore, the xenograft mice experiment showed the synergistic interaction between lestaurtinib and TRAIL wherein their coadministration more potently repressed tumour growth than these agents singly, indicating that the combination can be a robust option for humanglioma treatment.In this study, glioma cell lines, U87 and U251 were used to assess in vitro and in vivo, that lestaurtinib enhances the cytotoxicity of TRAIL. The MTT assay proved that lestaurtinib synergistically inhibited TRAIL‐treated tumour cell growth and proliferation. Further, in comparison with the use of these drugs singly, the two drugs combined could induce remarkably apoptosis of tumour cells at a low dosage. The caspase family members need to be activated for apoptosis through both mitochondrial pathways and death receptor. Based on their functions, these caspases are the effector caspases (caspase‐3, caspase‐6 and caspase‐7) and initiator caspases (caspase‐2, caspase‐8, caspase‐9 and caspase‐10).
We found that caspase‐8, caspase‐9 and caspase‐3 activation‐induced apoptosis of glioma cells by the combination of lestaurtinib and TRAIL treatment. The activation of caspases led to the condensation of the nucleus, PARP cleavage and, ultimately, the apoptotic induction. The breakdown of Bid to tBid by caspase‐8 and the latter's movement into mitochondria reveals an association between intrinsic and extrinsic apoptotic pathways.The ER (endoplasmic reticulum) stress enhances CHOP expression, which has a role in apoptosis mediated by ER.
,
Moreover, CHOP is a transcription factor that participates in the induction of DR5.
We show here that up‐regulation of CHOP is an important for DR5 expression and facilitates lestaurtinib‐induced apoptosis and that CHOP depletion prevents the apoptosis induced by various antitumour agents. We also showed here that lestaurtinib induced the sensitivity of the cells to TRAIL in vivo, and this combined treatment inhibited tumour growth efficiently. Therefore, we show here for the first time the anticancer effects of lestaurtinib in glioma cells involving TRAIL sensitization via a mechanism dependent on CHOP.In conclusion, we showed a limited inhibition potential of lestaurtinib on the in vitro growth of humanglioma cell lines, but could synergistically induce cell apoptosis in combination with TRAIL at lower concentrations. The combined treatment was found to significantly reduce xenografted U87 cell growth in athymic mice with no toxicity. Hence, we state here the great therapeutic capacity of lestaurtinib combined with TRAIL against glioma, and it requires further investigation.
CONFLICT OF INTEREST
There is no conflict of interest.
AUTHOR CONTRIBUTIONS
YC conceived and designed the study. YC, SK, YX, YM, SS and YQ performed the experiments and analysed data. YC organized data and wrote the manuscript. All authors read and approved the final version of the manuscript.