Literature DB >> 32437418

Species-, organ- and cell-type-dependent expression of SPARCL1 in human and mouse tissues.

Anika Klingler1, Daniela Regensburger1, Clara Tenkerian1, Nathalie Britzen-Laurent1, Arndt Hartmann2, Michael Stürzl1, Elisabeth Naschberger1.   

Abstract

SPARCL1 is a matricellular protein with anti-adhesive, anti-proliferative and anti-tumorigenic functions and is frequently downregulated in tumors such as colorectal carcinoma or non-small cell lung cancer. Studies have identified SPARCL1 as an angiocrine tumor suppressor secreted by tumor vessel endothelial cells, thereby exerting inhibitory activity on angiogenesis and tumor growth, in colorectal carcinoma. It is unknown whether SPARCL1 may exert these homeostatic functions in all organs and in other species. Therefore, SPARCL1 expression was comparatively analysed between humans and mice in a systematic manner. Murine Sparcl1 (mSparcl1) is most strongly expressed in the lung; expressed at an intermediate level in most organs, including the large intestine; and absent in the liver. In human tissues, SPARCL1 (hSPARCL1) was detected in all organs, with the strongest expression in the stomach, large intestine and lung, mostly consistent with the murine expression pattern. A striking difference between human and murine tissues was the absence of mSparcl1 expression in murine livers, while human livers showed moderate expression. Furthermore, mSparcl1 was predominantly associated with mural cells, whereas hSPARCL1 was detected in both mural and endothelial cells. Human SPARCL1 expression was downregulated in different carcinomas, including lung and colon cancers. In conclusion, this study revealed species-, organ- and cell-type-dependent expression of SPARCL1, suggesting that its function may not be similar between humans and mice.

Entities:  

Year:  2020        PMID: 32437418      PMCID: PMC7241726          DOI: 10.1371/journal.pone.0233422

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Secreted protein acidic and rich in cysteines like 1 (SPARCL1, syn.: Sc1, hevin, MAST9) is a matricellular protein belonging to the SPARC protein family, and SPARC/osteonectin is its closest and most prominent family member [1, 2]. Matricellular proteins are secreted proteins present in the extracellular matrix [3]. They have de-adhesive activity, in contrast to the adhesive extracellular matrix proteins fibronectin, vitronectin, and collagen [3]. Human SPARCL1 consists of an N-terminal secretion signal peptide causing an internal follistatin-like domain (FLD), a C-terminal extracellular calcium-binding domain and a highly acidic domain positioned between the signal peptide sequence and the FLD that is 411 amino acids long in SPARCL1 but only 51 amino acids in SPARC [1]. Only limited and partly conflicting information is available on the expression pattern of SPARCL1 in humans and mice. In agreement with the initial isolation of human SPARCL1 (hSPARCL1) from high endothelial venules, subsequent publications showed that hSPARCL1 expression in different tumors, including colorectal carcinoma (CRC), is highly associated with blood vessel endothelial cells [1, 4]. In culture, hSPARCL1 expression is induced in quiescent endothelial cells (ECs) but absent in actively proliferating ECs [5]. However, with the exception of pancreatic carcinoma cells, SPARCL1 was not found to be expressed in many other cell types investigated [4]. Initially, conflicting results have been reported on hSPARCL1 expression in tumor cells in CRC tissues [6, 7]. This was paralleled by conflicting results on the association of hSPARCL1 expression with the prognosis of CRC patients [6, 7]. These contradictory findings may have originated from nonspecific staining signals. The initial study on hSPARCL1 expression in CRC detected a strong association with tumor vessel endothelial cells (TECs) using in situ hybridization (ISH) [4]. These findings were confirmed by our group using ISH and at the protein level with immunohistochemistry (IHC) [5]. In human CRC tissues, hSPARCL1 was identified to be preferentially expressed by endothelial (EC) and mural cells in CRC but not by the tumor cells themselves [5]. In this study, staining controls such as isotype controls were included, and independent methods (IHC, ISH) were used. Therefore, the previously described epithelial/tumor cell signal in the colon and CRC was demonstrated to be nonspecific. Accordingly, the previously reported associations of hSPARCL1 expression with a specific CRC patient prognosis now require validation. Moreover, hSPARCL1 expression was found to be retained in favourable Th1 tumor microenvironments (TME) in CRC patients similar to the normal colon but to be preferentially lost in aggressive TMEs. Notably, in vitro hSPARCL1 expression was then identified to be induced by endothelial cell quiescence and was further stabilized by the addition of the Th1 cytokines interferon (IFN)-γ and/or interleukin (IL)-2, which are present in favourable Th1-TMEs of CRC patients [5]. Human SPARCL1 expression is also commonly downregulated in other cancer tissues, including CRC, metastatic prostate adenocarcinoma [8, 9], non-small cell lung cancer [10], metastases of pancreatic cancer [11], gastric cancer [12, 13], breast cancer [14], and hilar cholangiocarcinoma [15]. In contrast, mouse Sparcl1 (mSparcl1) expression has been examined in only a few studies, mostly at the RNA level. Mouse Sparcl1 mRNA was found to be highly expressed in the brain, at moderate levels in the lung, heart and adrenal gland and at low levels in the kidney, eye, liver, submandibular gland and testis [16]. Expression was mainly localized in the media and adventitia layers of medium and larger vessels as well as in the cardiac muscle and the bronchial tube system of the lung [16]. A limited number of murine organs, such as the brain, eye, heart and lung, were also analysed by western blot and found to express mSparcl1 at high or intermediate levels [17]. The presence of mSparcl1 protein at the single-cell level in different organs has not yet been investigated. Notably, full-length mSparcl1 migrates at approximately 120–130 kDa in western blots. Additional mSparcl1-specific bands between 40–55 kDa in size with an unknown function have been described [17, 18]. It has been shown that these proteins may be generated by cleavage with ADAMTS4 [17] or matrix metalloproteinase-3 [19] preferentially in the brain, resulting in a fragment with a similar molecular weight to that of SPARC. Regarding SPARCL1 function, it was reported that hSPARCL1 and mSparcl1 inhibit endothelial cell attachment and spreading on fibronectin [20] and adhesion of murine dermal fibroblasts during wound closure, respectively [21]. Mice with a double knockout of mSparcl1 and mSparc showed increased vessel density during a foreign body response reaction, indicating anti-angiogenic activity of one or both of the proteins [22]. Interestingly, mSparcl1 induces the formation of synapses between cultured rat ganglion cells, whereas mSparc antagonizes this effect, indicating that the two proteins can have opposite activities [3, 23]. However, at the tissue level, mSparc and mSparcl1 are generally not coexpressed. For example, mSparc is highly expressed in the placenta and testis and at low levels in the brain, whereas mSparcl1 is highly expressed in the brain, colon, heart and lungs and at low levels in the placenta and testis [1]. No cellular receptor has been identified for human or mouse SPARCL1 as yet. It has been shown that hSPARCL1 inhibits cell proliferation by prolonging the G1 phase in HeLa cells [24]. Recent studies revealed that hSPARCL1 in CRC exerts both anti-angiogenic [5] and anti-tumorigenic [6] functions. In this context, hSPARCL1 actively maintains vessel homeostasis in the CRCs of patients with favourable prognosis by inducing EC quiescence and stabilization of mature vessels by acting on both endothelial and mural cells [5]. Overall, human SPARCL1 can be considered a vascular-derived and therefore angiocrine tumor suppressor. Accordingly, its presence and potentially different cell type-associated expression patterns in the tissues of humans and mice are of great interest for future mechanistic in vivo studies using transgenic mouse models. The aim of the present study was to comparatively investigate SPARCL1 expression between humans and mice and to systematically analyse it at the RNA and protein levels with different techniques to identify overlapping and differential SPARCL1 expression patterns between the different species.

Materials and methods

Tissues from human patients and mice

Human tissues were retrieved after completion of routine diagnostics as formalin-fixed, paraffin-embedded blocks from the Institute of Pathology, Friedrich-Alexander University Erlangen-Nuremberg. Murine tissues were harvested from Sparcl1/Sc1 knockout C57BL/6 mice [5] (n = 3) and wild-type animals (n = 3) and were either immediately processed to obtain formalin-fixed, paraffin-embedded tissue blocks or snap-frozen with liquid nitrogen for later RNA isolation. The procedures were approved by the local ethics committee (human tissues) and licensed by the local government (mouse tissues).

Protein extraction and western blot analysis

Protein was extracted from fresh murine tissues by homogenization in RIPA buffer using a TissueLyser II (Qiagen, Hilden, Germany) at 25 Hz for 2 min, 30 min incubation on ice and 20 min of centrifugation at 4°C and 18,000 xg. The obtained supernatant was stored at -20°C until analysis. Protein concentrations in the tissue extracts were determined using the DC protein assay (Bio-Rad, Munich, Germany). The samples were boiled in Laemmli buffer for 5 min, size-separated by 10% SDS-PAGE, and electrophoretically transferred to a PVDF membrane (Carl Roth, Karlsruhe, Germany) at 250 mA for 2 h. After blocking in PBS-0.1% Tween containing 5% skim milk overnight at 4°C, the blots were incubated for 1 h at room temperature (RT) with the following primary antibodies: polyclonal goat anti-mouse Sparcl1 (R&D Systems, Minneapolis, USA, 1:500) and polyclonal rabbit anti-mouse GAPDH (Merck, Darmstadt, Germany, cat no. ABS16, 1:10,000). Detection of the primary antibodies was performed using rabbit anti-goat and goat anti-rabbit immunoglobulin G (IgG) coupled to horseradish peroxidase (HRP) (DakoCytomation, Santa Clara, USA, 1:5,000) for 45 min at RT. All antibodies were diluted in PBS-0.1% Tween/2.5% skim milk. The HRP enzyme reaction was developed using enhanced chemiluminescence (ECL) prime reagents (GE Life Sciences, Chalfont St Giles, Great Britain) and recorded using the Amersham Imager 600 (GE Life Sciences).

RNA isolation and quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR)

RNA from murine tissues was isolated using the RNeasy Mini Kit (Qiagen). DNA digestion (Ambion, Carlsbad, USA) and glycogen purification (Thermo Scientific, Waltham, USA) were performed. RNA quantity was measured using a Nanodrop 2000c (Thermo Scientific). Primers and probes for qRT-PCR were designed using Primer-BLAST (NIH). The primers and probes were purchased from Eurogentec (Lüttich, Belgium). The RNA primer/probe sequences were as follows: mSparcl1: forward CCTCTCCGCAGATCTAGCCA, probe TCCTCCTGTGCGCCTTGGGA, reverse CTTCCGGTGTCACCAGTGTT; mGAPDH: forward ACTGAGCAAGAGAGGCCCTA, probe TCCCAACTCGGCCCCCAACA, reverse TATGGGGGTCTGGGATGGAA. qRT-PCR was performed as described previously using the SuperScript III Platinum One-Step Quantitative RT-PCR System with ROX (Life Technologies) [5]. In brief, a reaction (10 μl total volume) consisted of 0.2 μL RT/Taq-mix, 50 nM ROX Reference dye (both Life Technologies), 10 ng total RNA, 3.28 μl water, 500 nM forward/reverse primer and 250 nM probe. The reactions were assayed in triplicate in 96-well qPCR plates (Agilent Technologies, Santa Clara, USA) using an MX3005P qPCR system (Agilent Technologies) with Versant kPCR software (Siemens Healthcare Diagnostics, Erlangen, Germany). For the quantification of RNA, the absence of potential residual DNA was analysed by DNA-specific primers for the progestogen-associated endometrial protein (PAEP) gene: forward CACAGAATGGACGCCATGAC, probe AAGCCCTCAGCCCTGCTCTCCATC, reverse AAACCAGAGAGGCCACCCTAA; the results were negative in all cases. The fluorescence threshold (ROX dRn) was set to 0.02 for all samples. All samples were normalized using murine GAPDH (mean of triplicates) as a reference gene. The ΔCT method was used to calculate the respective relative expression values.

Permanent immunohistochemistry (IHC)

Tissue blocks embedded in paraffin were cut into 4 μm tissue sections and transferred to slides (Superfrost Plus, Thermo Scientific). The tissue was deparaffinized with xylene two times for 15 min and rehydrated using decreasing concentrations of ethanol (100%, 96%, 85%, 70%) for 2 min each. Antigen retrieval was performed for both murine and human tissues using Target Retrieval Solution pH 9.0 (DakoCytomation) at 95°C for 20 min in a water bath followed by 20 min cooling at RT. The slides were washed in Tris buffered saline (TBS), pH 7.6, two times for 5 min. Blocking of the endogenous peroxidase was performed using 7.5% H2O2 in 70% ethanol for 10 min followed by three washes with A.d. and twice for 5 min of TBS. Nonspecific antigens were blocked using 2.5% normal horse serum for 20 min. Next, the sections were incubated with one of the following primary antibodies: polyclonal goat anti-mouse Sparcl1 (15 min, 1:1,000, cat. no. AF2836, R&D Systems) or polyclonal goat anti-human SPARCL1 (1 h, 1:900, cat. no. AF2728, R&D Systems). Normal goat IgG (in corresponding concentrations, cat. no. AB-108-C, R&D Systems) was used for isotype controls. All antibodies used were diluted in background reducing antibody diluent (DakoCytomation). The slides were washed 5 min two times in TBS and incubated for 30 min with ImmPRESS HRP Reagent (Vector Laboratories, Burlingame, USA). After washing the slides for 5 min two times in TBS, the substrate Nova Red (Vector Laboratories) was added for 15 min. Next, the slides were washed twice for 2.5 min in A.d., counterstained with Gill-III haematoxylin (Merck), dehydrated and mounted with VectaMount Permanent Mounting Medium (Vector Laboratories). The tissues were analysed by a DM6000 B microscope (Leica, Wetzlar, Germany) and LAS-X software (Leica).

Fluorescent immunohistochemistry (F-IHC)

Cutting, deparaffinizing, rehydration and antigen retrieval were performed as described above. Slides were washed in 0.45 μm filtered TBS, pH 7.6, two times for 5 min. The slides were blocked in 10% donkey normal serum (DNS; Dianova, Hamburg, Germany) diluted in filtered TBS for 10 min. Next, the tissues were incubated with the following primary antibodies in different combinations diluted in 5% DNS for 1 h at RT: polyclonal goat anti-human SPARCL1 (1:50, cat. no. AF2728, R&D Systems), polyclonal rabbit anti-human CD31 (1:50, cat. no. RB-10333-P, Thermo Scientific), polyclonal goat anti-murine Sparcl1 (1:50, cat. no. AF2836, R&D Systems) and monoclonal rat anti-mouse CD31 (1:100, clone SZ31, Dianova). For isotype controls, the following antibodies were used: normal goat IgG (in corresponding concentrations, cat. no. AB-108-C, R&D Systems), mouse IgG1 isotype control (in corresponding concentrations, cat. no. MAB002, R&D Systems) and rat IgG2a (in corresponding concentrations, cat. no. MAB006, R&D Systems). The slides were washed twice for 5 min in filtered TBS and incubated with the following secondary antibodies in different combinations diluted in 5% DNS for 45 min at RT: Alexa Fluor 488 donkey anti-goat IgG (1:500, cat. no. A11055, Life Technologies), Alexa Fluor 546 donkey anti-rabbit IgG (1:500, cat. no. A10040, Life Technologies) and Alexa Fluor 555 donkey anti-rat IgG (1:500, cat. no. 6430–32, Southern Biotech, Birmingham, USA). The sections were washed twice for 5 min in filtered TBS and incubated with DRAQ5 (1:800, cat. no. 4084L, Cell Signaling, Danvers, USA) diluted in A.d. for 10 min. Next, slides were washed twice for 5 min in TBS and mounted with Fluorescence Mounting Medium (DakoCytomation). Confocal microscopy was performed on a Leica TCS SPE (Leica) with LAS-X software (Leica).

Results

Murine Sparcl1 expression is organ dependent

Sparcl1 expression in murine tissues was first examined at both the RNA and protein levels by qRT-PCR and western blot. At the mRNA level, organs from at least 3 independent wild-type C57BL/6NRj mice and corresponding Sparcl1 knockout animals were investigated, and the highest mSparcl1 expression levels were identified in the lung, followed by the stomach, spleen, large intestine (coecum/colon), and heart (Fig 1A, left panel: normalized Ct values; right panel: relative fold change). Murine Sparcl1 was only weakly expressed in the oesophagus, small intestine and kidney compared to the other organs. In the murine liver, mSparcl1 expression was absent (Fig 1A, +/+). In the knockout animals used as a control, all organs were negative (Fig 1A, left panel, KO). Western blot analysis of the same organs from 3 independent wild-type animals using a specific anti-murine Sparcl1 antibody revealed mSparcl1 to be expressed in most of the organs, and the results were relatively consistent compared to the RNA assay, namely, strong expression in the stomach, colon, and lung (Fig 1B, Sc1 +/+). Intermediate levels were detected in the coecum, whereas weak levels were detected in the oesophagus, heart and spleen. Similar to the RNA, mSparcl1 expression was absent in the liver (Fig 1B, liver). The low levels of RNA expression in the small intestine and kidney did not result in mSparcl1 expression detected at the protein level (Fig 1B). Notably, the large intestine with samples of the colon and coecum was the only organ clearly showing the previously described mSparcl1-specific band migrating at the lower size of 55 kDa [18] (Fig 1B, mSparcl1 fragment). As a control, lysates from the corresponding organs of mSparcl1-knockout animals were used and were negative in all cases (Fig 1B, Sc1-/-).
Fig 1

Murine Sparcl1 is expressed at different levels in murine organs.

(A) Quantification of mSparcl1 mRNA expression by RT-qPCR in different organs of wild-type (Sc1 +/+, grey dots) and SPARCL1 knockout (Sc1 -/-, black dots) animals. The relative mRNA expression levels are indicated as 40-ΔCt values for each animal (left panel) and for wild-type animals only as the mean fold change calculated relative to the liver (right panel). (B) Western blot analysis of mSparcl1 protein expression in different murine organs of Sparcl1 wild-type (Sc1 +/+, n = 3) and knockout (Sc1 -/-, n = 3) mice. The results of one representative animal for each genotype are depicted. Murine GAPDH was detected as a loading control. The mSparcl1 signal (large band) of the depicted western blot was quantified and is given as the relative mSparcl1 signal after normalization to mGAPDH.

Murine Sparcl1 is expressed at different levels in murine organs.

(A) Quantification of mSparcl1 mRNA expression by RT-qPCR in different organs of wild-type (Sc1 +/+, grey dots) and SPARCL1 knockout (Sc1 -/-, black dots) animals. The relative mRNA expression levels are indicated as 40-ΔCt values for each animal (left panel) and for wild-type animals only as the mean fold change calculated relative to the liver (right panel). (B) Western blot analysis of mSparcl1 protein expression in different murine organs of Sparcl1 wild-type (Sc1 +/+, n = 3) and knockout (Sc1 -/-, n = 3) mice. The results of one representative animal for each genotype are depicted. Murine GAPDH was detected as a loading control. The mSparcl1 signal (large band) of the depicted western blot was quantified and is given as the relative mSparcl1 signal after normalization to mGAPDH.

Murine Sparcl1 is preferentially expressed by mural cells

F-IHC and permanent IHC were conducted to elucidate the expression pattern of mSparcl1 at the single-cell level. In accordance with the western blot results, mSparcl1 expression was detected strongly in the lung; at intermediate levels in the stomach, large intestine (coecum/colon), heart and urinary bladder; and weakly in the oesophagus, small intestine, spleen and kidney (Fig 2; S1 Fig; Sc1 +/+, green signal). Co-staining of mSparcl1 with CD31 was performed to evaluate potential vessel-associated expression of mSparcl1 as suggested by our previous data from the colon. This analysis revealed that mSparcl1 was associated with vessels in all organs except the lung and was absent in the liver. The vessel-associated mural cells of the oesophagus, stomach, large intestine (coecum/colon), lung, heart, spleen, kidney and urinary bladder were predominantly mSparcl1-positive (Fig 2; S1 Fig; Sc1 +/+). Endothelial cells expressed mSparcl1 only in the oesophagus, small intestine and large intestine (Fig 2; Sc1 +/+, yellow signal). Moreover, mSparcl1 was expressed by the stromal cells of the stomach, small intestine, large intestine and urinary bladder, by muscle cells of the heart, and in the lung around the bronchial tubes and in the alveolar tissue (Fig 2; S1 Fig; Sc1 +/+). Control isotype antibody staining was performed for all the organs and was negative (Fig 2; S1 Fig; Sc1 +/+ isotype). Furthermore, mSparcl1 knockout mice were stained for CD31 and mSparcl1 as an additional control. Staining was also negative for mSparcl1 in all cases (Fig 2; S1 Fig; Sc1 -/).
Fig 2

Murine Sparcl1 is expressed in all murine organs examined except the liver.

Murine Sparcl1 expression (Sc1 +/+, green, arrows) was determined by immunofluorescence in various organs of Sparcl1 wild-type mice (n = 3). Isotype antibody (Sc1 +/+ isotype) and knockout mouse (Sc1-/-, n = 3) staining were used as controls. All tissues were counterstained using DRAQ5 (blue). Scale bar = 100 μm.

Murine Sparcl1 is expressed in all murine organs examined except the liver.

Murine Sparcl1 expression (Sc1 +/+, green, arrows) was determined by immunofluorescence in various organs of Sparcl1 wild-type mice (n = 3). Isotype antibody (Sc1 +/+ isotype) and knockout mouse (Sc1-/-, n = 3) staining were used as controls. All tissues were counterstained using DRAQ5 (blue). Scale bar = 100 μm. In addition, permanent IHC was conducted as a control. Consistently, immunofluorescence showed that the expression of mSparcl1 was strongest in the lung with specific signals in the alveolar tissue and around the bronchial tubes (S2 Fig; Sc1 +/+, brown signal). Intermediate mSparcl1 expression levels were revealed in the large intestine (coecum/colon), heart and kidney. The small intestine and spleen showed low mSparcl1 expression levels. In these organs, mSparcl1 expression was located at the vessels and in other stromal cells, likely smooth muscle cells. In contrast to the immunofluorescent staining results, weak mSparcl1-specific staining was observed in hepatocytes of the liver. Isotype staining (S2 Fig; Sc1 +/+ isotype) and staining of mSparcl1 knockout mice (S2 Fig; Sc1 -/-) were used as controls. These results revealed nonspecific staining of the epithelium in the small intestine and large intestine, throughout the tissue of the spleen and in the tubule cells of the kidney (S2 Fig; asterisks).

Human SPARCL1 is preferentially expressed by endothelial and mural cells in an organ-dependent manner

In a next step, different tissues of human patients were stained for hSPARCL1 by F-IHC and permanent IHC. These staining assays revealed hSPARCL1 to be expressed in all organs at different levels (Fig 3, healthy, green signal). The strongest expression of hSPARCL1 was detected in the stomach, large intestine, and lung, followed by an intermediate expression level in the oesophagus, small intestine and liver (Fig 3). Co-staining for hSPARCL1 and CD31 was conducted to determine vessel-associated hSPARCL1 expression. Human SPARCL1 expression was associated with the endothelial cells of the small intestine, large intestine, and lung (Fig 3, healthy, yellow signal). Human SPARCL1 was also detected in the mural cells of all organs examined. Furthermore, other stromal cells, likely smooth muscle cells of the oesophagus, stomach, small intestine and large intestine, expressed hSPARCL1 occasionally. The pancreas showed hSPARCL1 expression in the islet cells and the lung around the bronchial tubes and in the alveolar tissue (Figs 3 and 4). Notably, as a control, isotype antibody control staining was performed for all the organs and was negative in all cases (Fig 3; isotype).
Fig 3

Human SPARCL1 expression is highly detectable in all human organs examined and downregulated in their respective neoplasms.

Human SPARCL1 expression (green, arrows) was determined by immunofluorescence in various healthy and neoplastic organs of human patients (healthy, neoplastic, n = 3 for all organs except oesophagus, small intestine and lung tumor with n = 2). Isotype antibody staining of consecutive sections was used as a negative control (isotype). All tissues were counterstained using DRAQ5 (blue). Scale bar = 250 μm.

Fig 4

SPARCL1 is differentially expressed between murine and human organs in a species- and cell-type-dependent manner.

Co-localization of human and murine (Sc1 +/+) SPARCL1 and CD31 was determined by immunofluorescent double staining (SPARCL1 green, arrows; CD31 red). Isotype antibody staining of consecutive sections was used as a negative control (isotype). All tissues were counterstained using DRAQ5 (blue). Scale bar = 50 μm.

Human SPARCL1 expression is highly detectable in all human organs examined and downregulated in their respective neoplasms.

Human SPARCL1 expression (green, arrows) was determined by immunofluorescence in various healthy and neoplastic organs of human patients (healthy, neoplastic, n = 3 for all organs except oesophagus, small intestine and lung tumor with n = 2). Isotype antibody staining of consecutive sections was used as a negative control (isotype). All tissues were counterstained using DRAQ5 (blue). Scale bar = 250 μm.

SPARCL1 is differentially expressed between murine and human organs in a species- and cell-type-dependent manner.

Co-localization of human and murine (Sc1 +/+) SPARCL1 and CD31 was determined by immunofluorescent double staining (SPARCL1 green, arrows; CD31 red). Isotype antibody staining of consecutive sections was used as a negative control (isotype). All tissues were counterstained using DRAQ5 (blue). Scale bar = 50 μm. In addition, permanent IHC was conducted as a control. This analysis also revealed hSPARCL1 to be vastly expressed in all organs examined, consistent with the results of F-IHC. Here, again, hSPARCL1 expression was shown to be preferentially associated with vessels (S3 Fig; healthy). Furthermore, hSPARCL1-specific staining was located in the epithelium of the oesophagus, smooth muscle cells of stomach, small and large intestine, islet cells of the pancreas, hepatocytes of the liver and alveolar tissue of the lung as well as around the bronchial tubes. Isotype antibody control staining (S3 Fig; isotype) showed that the hSPARCL1 staining of the glandular cells of the stomach was nonspecific.

Human SPARCL1 is downregulated in malignant diseases

To estimate potential differences in human SPARCL1 expression between healthy tissues and malignant diseases, corresponding malignant tissue sections of the abovementioned healthy organs were analysed. Both permanent IHC (S3 Fig; brown signal) and F-IHC showed consistently that hSPARCL1 expression is reduced in the corresponding malignomas of stomach, small and large intestine, and lung (Fig 3; neoplastic; Table 1) when compared with the healthy tissue. Additionally, for malignomas, co-staining for hSPARCL1 and CD31 was conducted to estimate the association with vessels. Human SPARCL1 was expressed in the endothelial cells of malignant tissues from the oesophagus, stomach, and lung (Fig 3; neoplastic, yellow signal). Permanent IHC consistently identified hSPARCL1 as expressed in a similar pattern to that detected by immunofluorescent staining (S3 Fig; neoplastic). Furthermore, in malignomas, hSPARCL1-specific staining was located in the stromal cells of the large intestine, hepatocytes of the liver and alveolar tissue of the lung.
Table 1

Expression of SPARCL1 in different human and murine tissues.

OrganHuman SPARCL1Murine Sparcl1
IHCCellular locationIHCWBRNACellular location
Oesophagus++EC, MC, epithelium, SMC+++EC, MC, SMC
Stomach+++EC, MC, SMC+++++++MC, SMC
Small intestine++EC, MC, SMC+-+EC, SMC
Large intestine+++EC, MC, SMC+++++++EC, MC, SMC
Pancreas+++EC, MC, islet cells++++MC
Liver++MC, hepatocytes----
Lung+++EC, MC, around bronchial tubes, alveolar tissue+++++++++MC, around bronchial tubes, alveolar tissue
Heartn.d.+++++MC, muscle cells
Spleenn.d.++++MC
Kidneyn.d.+-+MC
Urinary bladdern.d.++++++MC, SMC

IHC, immunohistochemistry; WB, western blot

EC, endothelial cells; MC, mural cells; SMC, smooth muscle cells

+++, strong expression; ++, intermediate expression; +, weak expression; -, no expression

n.d. not determined

IHC, immunohistochemistry; WB, western blot EC, endothelial cells; MC, mural cells; SMC, smooth muscle cells +++, strong expression; ++, intermediate expression; +, weak expression; -, no expression n.d. not determined

Liver and pancreas show differential SPARCL1 expression between mouse and human

Comparison of healthy murine and human tissues revealed that SPARCL1 is differentially expressed. The most striking difference that was observed was in the overall expression levels in the pancreas and liver (Fig 4). The murine pancreas showed only weak mSparcl1 expression at the protein level by IHC, whereas the healthy human pancreas expressed hSPARCL1 strongly (Figs 3 and 4). Likewise, the murine liver did not express mSparcl1 at all, in contrast to the human liver, which was found to have intermediate SPARCL1 expression as detected by IHC (Figs 1, 3 and 4). The human small intestine showed slightly higher hSPARCL1 expression than the corresponding murine organ. All other organs examined, such as the stomach, large intestine and lung, exhibited similar SPARCL1 expression levels and patterns (Fig 4). Moreover, fluorescent co-staining of SPARCL1 and CD31, an endothelial cell marker, revealed that SPARCL1 is expressed in a vessel-associated manner according to our previous data. Human SPARCL1 was found to be colocalized with CD31 and hence expressed in endothelial cells in organs of the gastrointestinal tract, namely, the stomach, small intestine and large intestine (Fig 4; Table 2). However, in mice, vascular-associated mSparcl1 was mostly expressed by vessel-associated mural cells (Fig 4; Table 2). In contrast, the human tissues showed a different SPARCL1 expression pattern regarding vascular cell association. Here, all organs, except for the liver, showed SPARCL1 expression in both endothelial and mural cells (Fig 4, right; Table 2).
Table 2

Downregulation of human SPARCL1 in malignant carcinomas.

Healthy tissueMalignant carcinoma
IHCCellular locationIHCCellular location
Oesophagus++EC, MC, epithelium, SMC++EC, MC
Stomach+++EC, MC, SMC++EC, MC
Small intestine++EC, MC, SMC++EC, MC
Large intestine+++EC, MC, SMC++EC, MC, SMC
Pancreas+++EC, MC, islet cells++EC, MC
Liver++MC, hepatocytes++MC, hepatocytes
Lung+++EC, MC, around bronchial tubes, alveolar tissue++EC, MC, alveolar tissue

IHC, immunohistochemistry

EC, endothelial cells; MC, mural cells; SMC, smooth muscle cells

+++, strong expression; ++, intermediate expression; +, weak expression

IHC, immunohistochemistry EC, endothelial cells; MC, mural cells; SMC, smooth muscle cells +++, strong expression; ++, intermediate expression; +, weak expression

Discussion

In this study, a species-, organ- and cell-type-dependent differential expression pattern of SPARCL1 between humans and mice was identified. SPARCL1 is an anti-angiogenic, anti-proliferative and anti-adhesive protein [5, 20, 21, 24]. Previous analyses of hSPARCL1 expression in human tissues showed a preferential downregulation of expression in neoplastic tissues [5, 8–15]. This is also reflected by recent studies examining the effects of hSPARCL1 on tumorigenesis and metastasis formation [25-30]. However, there is still little information on the general expression patterns of SPARCL1 in human and murine tissues. Here, we analysed the expression of SPARCL1 in various tissues of mice and humans and showed that hSPARCL1 and mSparcl1 expression patterns are different in a species- and cell type-dependent manner. This was accomplished with the help of F-IHC, permanent IHC, western blot analysis and qRT-PCR to investigate SPARCL1 expression at both the protein and mRNA levels. Notably, a comparison of previous studies indicated that in some instances, cross-reactivity of different antibodies might be the reason for differential staining results. To avoid this in our study, careful staining controls were applied. First, in all cases, an isotype control antibody was used. In addition, mouse staining was controlled with tissues derived from a Sparcl1 complete knockout mouse, and in human studies, comparisons between healthy tissue and respective tumor tissue of the same organs were used. Moreover, the results were validated by western blot and qRT-PCR. In all instances, consistent results were obtained within organs of the same species, indicating that specific staining results were obtained. Therefore, the different methods employed can also be used without a major change in results in the future. The striking difference in the SPARCL1 expression patterns for the liver and pancreas between mice and humans emphasizes that the possibility of transferring findings from mouse models to human patients is not possible in all cases. According to our results, care must be taken when analysing the impact of SPARCL1 specifically in the liver context. Moreover, our findings suggest that it is highly recommended to perform systematic expression analyses in humans and mice before performing mechanistic mouse studies. Similar differences in the expression pattern of a protein in the human and murine organisms have been reported in a few previous studies, for example, for LIM-only proteins [31]. Finally, previous studies showed that hSPARCL1 expression in endothelial cells induced an inhibition of EC proliferation, migration and sprouting and consequently reduced angiogenesis. Human SPARCL1 has been found to be endogenously expressed in the ECs of quiescent vessels as well as in mural cells and stabilizing mature vessels, in turn leading to homeostasis [5]. Here, the functions of SPARCL1-secreting ECs in particular might be one reason for the downregulation of hSPARCL1 expression in neoplastic tissues in the course of tumor escape, which we found in accordance with previous studies. Future studies should elucidate whether the preferential loss of SPARCL1 in various malignomas is due to its function as a vascular-derived tumor suppressor favouring vessel homeostasis, as reported for colorectal carcinoma. Moreover, it will be necessary to investigate whether the differential association with vessel cells between humans and mice has functional implications in both physiological and pathophysiological contexts.

Murine Sparcl1 is expressed in several murine organs.

Murine Sparcl1 expression (Sc1 +/+, green, arrows) was determined by immunofluorescence in various organs of Sparcl1 wild-type mice (n = 3). Isotype antibody (Sc1 +/+ isotype) and knockout mouse (Sc1-/-, n = 3) staining were used as controls. All tissues were counterstained using DRAQ5 (blue). Scale bar = 100 μm. (TIF) Click here for additional data file.

Murine Sparcl1 is expressed in all organs examined.

Murine Sparcl1 expression (Sc1 +/+, brown, arrows) was determined by permanent IHC in various organs of Sparcl1 wild-type mice (n = 3). Isotype antibody- (Sc1 +/+ isotype) and knockout mice (Sc1 -/-, n = 3) staining were used as controls. Asterisks indicate nonspecific staining. Scale bar = 75 μm. (TIF) Click here for additional data file. Human SPARCL1 expression (brown, arrows) was determined by permanent IHC in various healthy and neoplastic organs of human patients (healthy, neoplastic, n = 3 for all organs except oesophagus, small intestine and lung tumor with n = 2). Isotype antibody staining of consecutive sections was used as a negative control (isotype). Asterisks indicate nonspecific staining. Scale bar = 100 μm. (TIF) Click here for additional data file. 14 Apr 2020 PONE-D-20-06477 Species-, organ- and cell type-dependent expression of SPARCL1 in human and mouse tissues PLOS ONE Dear Dr. Naschberger, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== Reviewers' comments: Reviewer #1: SPARCL1 is a matricellular protein with tumorigenic function and is frequently down-regulated in tumors. Previous studies have found that SPARCL1 is differentially expressed in liver between mice and human, which is probably associated with colorectal carcinoma and its metastasis to liver. However, whether and how SPARCL1 is expressed in all organs and in other species has not been investigated. In the present study, the authors systematically analyzed the expression of SPARCL1 in multiple organs with various methods and compared the expression of SPARCL1 between mouse and human. And the results shows that in human samples, SPARCL1 was detected in all organs with the strongest expression in stomach, large intestine and lung, which is consistent with the expression pattern in mice; but murine liver showed an absence of SPARCL1 expression that is different with human liver, indicating that SPARCL1 function may not be similar in all tissues but dependent on species. The experiments were well designed, and were carefully controlled by setting SPARCL1 complete knock-out mouse and using healthy tissue and respective tumor tissue of the same organs. The results were clear and cautiously interpreted and the conclusion seems to be convictive. Generally speaking, this is an interesting manuscript regarding the expression of SPARCL1. However, revisions are needed before it could be accepted for publication in PLOS ONE. Major points: 1. The main purpose of the study was to widely compare the expression of between murine model and human tissue. Therefore the author should focus on this purpose. It is acceptable to compare the SPARCL1 expression between different organs, different cells and between normal and neoplastic tissues, and the results are significant and interesting. However, during writing of this manuscript, it should always focus on the purpose of comparing the expression of between murine model and human tissue. Therefore the writing needs revision, especially those in the abstract and the introduction section. 2. The paragraph two, discussion section seems redundant. It can be removed and the contents may be written in relative paragraphs, respectively. Minor points: 1. It is noted that the manuscript should be carefully edited to avoid grammar mistakes, e.g. the first sentence in paragraph 1, result section. 2. The left panel in figure 1A needs notes for symbols. E.g. the black dots represent mRNA level of wild type mSPARCL1 while grey dots represent that of SPARCL1 knockout type, which needs to be denoted clearly in the chart and/or figure legends. Reviewer #2: Klingler Anika et al show that SPARCL1 expresses differently among species, organ and cell types. The experiments are well designed and performed with different controls. Relying on this study, we should be careful when we want to transfer findings from mouse models for the human patients. And some drug screen dependent on mice may not be applied into human diseases. It should be accepted for this journal and I have some concerns: The major one is: For human SPARCL1, a western blot is needed for its expression in each tissue and the migrating bands should be included in the WB. I am interested that the migrating bands may be functional. And some minor concerns: 1) In Fig1B, migrating bands are different between Colon and Coecum, the authors should give an explanation for this. 2) Similar as the above one, the authors show that human SPARCL1 is downregulated in malignant diseases, a WB is needed to test whether there is difference in the migrating bands. 3) SPARCL1 in mouse should be written as Sparcl1, with only the first letter capitalized. ============================== We would appreciate receiving your revised manuscript by May 29 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Yuqin Yao Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. At this time, we request that you  please report additional details in your Methods section regarding animal care: 1) Please provide details of animal welfare (e.g., shelter, food, water, environmental enrichment) 2) please describe any steps taken to minimize animal suffering and distress, such as by administering anesthetics or analgesics, 3) please include the method of sacrifice and 4) Please describe the source of the animals used in this study. Thank you for your attention to these requests. 3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 4. We note you have included a table to which you do not refer in the text of your manuscript. Please ensure that you refer to Table 2 in your text; if accepted, production will need this reference to link the reader to the Table. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: comments on PONE-D-20-06477.doc Click here for additional data file. Submitted filename: plosone-Review.pdf Click here for additional data file. 22 Apr 2020 Point-by-point response for the reviewers Klingler et al, PLOS ONE “Species-, organ- and cell type-dependent expression of SPARCL1 in human and mouse tissues” #PONE-D-20-06477 We thank both reviewers for their positive evaluation of our manuscript. In addition, their suggestions were very helpful. All points were answered or addressed in full and have been incorporated into the revised version of the manuscript. The alterations introduced in the revised manuscript are shaded in gray. REVIEWER 1: Major points: 1. The main purpose of the study was to widely compare the expression of between murine model and human tissue. Therefore, the author should focus on this purpose. It is acceptable to compare the SPARCL1 expression between different organs, different cells and between normal and neoplastic tissues, and the results are significant and interesting. However, during writing of this manuscript, it should always focus on the purpose of comparing the expression of between murine model and human tissue. Therefore, the writing needs revision, especially those in the abstract and the introduction section. The abstract and introduction has been revised according to the reviewer´s suggestions and it was tried to put a more stringent focus on the mentioned comparison between human and mouse. All alterations are shaded in grey. 2. The paragraph two, discussion section seems redundant. It can be removed and the contents may be written in relative paragraphs, respectively. As suggested the paragraph two has been removed and the content was added in a more compact form as a single sentence at the beginning of the discussion section. Minor points: 1. It is noted that the manuscript should be carefully edited to avoid grammar mistakes, e.g. the first sentence in paragraph 1, result section. The sentence is corrected now. Moreover, the whole manuscript was sent to “American Journal Experts” for professional revision of the language. The certificate for language revision is attached now for the reviewer´s attention. 2. The left panel in figure 1A needs notes for symbols. E.g. the black dots represent mRNA level of wild type mSPARCL1 while grey dots represent that of SPARCL1 knockout type, which needs to be denoted clearly in the chart and/or figure legends. The respective notes for the symbols are added now in the corresponding legend of Figure 1A. REVIEWER 2: The major one is: For human SPARCL1, a western blot is needed for its expression in each tissue and the migrating bands should be included in the WB. I am interested that the migrating bands may be functional. We fully agree with the suggestion of the reviewer and would highly appreciate to perform this type of analysis. We have tried already before submission of the manuscript to get the required material for western blot. However, our pathology cannot provide us with cryomaterial of the required human organs but instead only with FFPE-blocks. From the latter material western blot analysis cannot be performed at sufficient quality, unfortunately. Therefore, we ask the reviewer kindly to refrain from this experiment. And some minor concerns: 1) In Fig1B, migrating bands are different between Colon and Coecum, the authors should give an explanation for this. We have revisited the original blots following the reviewer´s suggestion. The colon and coecum lysates were running on two different gels as also indicated by the separated boxes in the figure. We have referenced the SPARCL1-specific bands to our protein marker and aligned accordingly. However, the protein standard does not produce sharp bands in the low kDa range. Therefore, we cannot say with a high accuracy whether the small difference in size is a real difference or is only related to small variations produced by standard alignment. Accordingly, we did not state in the results section that there is a real difference in size. 2) Similar as the above one, the authors show that human SPARCL1 is downregulated in malignant diseases, a WB is needed to test whether there is difference in the migrating bands. As stated above, we unfortunately do not have access to human material compatible with western blot. Therefore, we ask the reviewer kindly to refrain from this experiment. 3) SPARCL1 in mouse should be written as Sparcl1, with only the first letter capitalized. The whole manuscript and the figures were revised accordingly. Of note, in order to be consistent with the mouse nomenclature also murine SPARC (osteonectin) was now abbreviated as mSparc with small letters after the first letter capitalized. All alterations are shaded in grey. 6 May 2020 Species-, organ- and cell-type-dependent expression of SPARCL1 in human and mouse tissues PONE-D-20-06477R1 Dear Dr. Naschberger, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Yuqin Yao Academic Editor PLOS ONE Reviewers' comments: Reviewer #1: The authors have addressed all my concerns and revised mistakes that I pointed out. I have no further comments. I think the manuscript is acceptable for publication in PLOS ONE. Reviewer #2: All of my concerns are addressed or at least have explanations. For human SPARCL1, I understand that human samples are not easy to get for western blot analysis and I think conclusions in the paper are still solid, although western blot analyses make it better. 8 May 2020 PONE-D-20-06477R1 Species-, organ- and cell-type-dependent expression of SPARCL1 in human and mouse tissues Dear Dr. Naschberger: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Yuqin Yao Academic Editor PLOS ONE
  31 in total

1.  SPARCL1: a potential molecule associated with tumor diagnosis, progression and prognosis of colorectal cancer.

Authors:  Hong Zhang; Emma Widegren; Da-Wei Wang; Xiao-Feng Sun
Journal:  Tumour Biol       Date:  2011-09-02

2.  Proteolysis of the matricellular protein hevin by matrix metalloproteinase-3 produces a SPARC-like fragment (SLF) associated with neovasculature in a murine glioma model.

Authors:  Matt Weaver; Gail Workman; Chad R Schultz; Nancy Lemke; Sandra A Rempel; E Helene Sage
Journal:  J Cell Biochem       Date:  2011-11       Impact factor: 4.429

3.  Hevin, an antiadhesive extracellular matrix protein, is down-regulated in metastatic prostate adenocarcinoma.

Authors:  P S Nelson; S R Plymate; K Wang; L D True; J L Ware; L Gan; A Y Liu; L Hood
Journal:  Cancer Res       Date:  1998-01-15       Impact factor: 12.701

Review 4.  Diverse biological functions of the SPARC family of proteins.

Authors:  Amy D Bradshaw
Journal:  Int J Biochem Cell Biol       Date:  2012-01-09       Impact factor: 5.085

5.  Secreted protein acidic and rich in cysteines-like 1 suppresses aggressiveness and predicts better survival in colorectal cancers.

Authors:  Hanguang Hu; Hang Zhang; Weiting Ge; Xiyong Liu; Sofia Loera; Peiguo Chu; Huarong Chen; Jiaping Peng; Lun Zhou; Shujing Yu; Ying Yuan; Suzhan Zhang; Lily Lai; Yun Yen; Shu Zheng
Journal:  Clin Cancer Res       Date:  2012-08-13       Impact factor: 12.531

6.  Processing of the matricellular protein hevin in mouse brain is dependent on ADAMTS4.

Authors:  Matt S Weaver; Gail Workman; Marina Cardo-Vila; Wadih Arap; Renata Pasqualini; E Helene Sage
Journal:  J Biol Chem       Date:  2009-12-15       Impact factor: 5.157

7.  Hevin is down-regulated in many cancers and is a negative regulator of cell growth and proliferation.

Authors:  A Claeskens; N Ongenae; J M Neefs; P Cheyns; P Kaijen; M Cools; E Kutoh
Journal:  Br J Cancer       Date:  2000-03       Impact factor: 7.640

Review 8.  Revisiting the matricellular concept.

Authors:  Joanne E Murphy-Ullrich; E Helene Sage
Journal:  Matrix Biol       Date:  2014-07-24       Impact factor: 11.583

9.  Prognostic value of SPARCL1 in patients with colorectal cancer.

Authors:  Wei Han; Fang Cao; Wei Ding; Xiao-Jiao Gao; Fang Chen; Yong-Wei Hu; Hou-Zhong Ding
Journal:  Oncol Lett       Date:  2017-12-05       Impact factor: 2.967

10.  SPARCL1 suppresses osteosarcoma metastasis and recruits macrophages by activation of canonical WNT/β-catenin signaling through stabilization of the WNT-receptor complex.

Authors:  S-J Zhao; Y-Q Jiang; N-W Xu; Q Li; Q Zhang; S-Y Wang; J Li; Y-H Wang; Y-L Zhang; S-H Jiang; Y-J Wang; Y-J Huang; X-X Zhang; G-A Tian; C-C Zhang; Y-Y Lv; M Dai; F Liu; R Zhang; D Zhou; Z-G Zhang
Journal:  Oncogene       Date:  2017-10-30       Impact factor: 9.867

View more
  2 in total

1.  Sparcl1 promotes nonalcoholic steatohepatitis progression in mice through upregulation of CCL2.

Authors:  Bin Liu; Liping Xiang; Jing Ji; Wei Liu; Ying Chen; Mingfeng Xia; Yuejun Liu; Wenyue Liu; Peiwu Zhu; Yi Jin; Yu Han; Jieli Lu; Xiaoying Li; Minghua Zheng; Yan Lu
Journal:  J Clin Invest       Date:  2021-10-15       Impact factor: 14.808

2.  Targeting adipose tissue to tackle NASH: SPARCL1 as an emerging player.

Authors:  Robim M Rodrigues; Yukun Guan; Bin Gao
Journal:  J Clin Invest       Date:  2021-10-15       Impact factor: 19.456

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.