| Literature DB >> 32429272 |
Wedad Ahmed1,2, Heinrich Neubauer1, Herbert Tomaso1, Fatma Ibrahim El Hofy2, Stefan Monecke3,4, Ashraf Awad Abdeltawab2, Helmut Hotzel1.
Abstract
The aim of this study was to characterize staphylococci and streptococci in milk from Egyptian bovides. In total, 50 milk samples were collected from localities in the Nile Delta region of Egypt. Isolates were cultivated, identified using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), and antibiotic susceptibility testing was performed by the broth microdilution method. PCR amplifications were carried out, targeting resistance-associated genes. Thirty-eight Staphylococcus isolates and six Streptococcus isolates could be cultivated. Staphylococcus aureus isolates revealed a high resistance rate to penicillin, ampicillin, clindamycin, and erythromycin. The mecA gene defining methicillin-resistant Staphylococcus aureus, erm(C) and aac-aphD genes was found in 87.5% of each. Coagulase-negative staphylococci showed a high prevalence of mecA, blaZ and tetK genes. Other resistance-associated genes were found. All Streptococcus dysgalactiae isolates carried blaZ, erm(A), erm(B), erm(C) and lnuA genes, while Streptococcus suis harbored erm(C), aphA-3, tetL and tetM genes, additionally. In Streptococcus gallolyticus, most of these genes were found. The Streptococcus agalactiae isolate harbored blaZ, erm(B), erm(C), lnuA, tetK, tetL and tetM genes. Streptococcus agalactiae isolate was analyzed by DNA microarray analysis. It was determined as sequence type 14, belonging to clonal complex 19 and represented capsule type VI. Pilus and cell wall protein genes, pavA, cadD and emrB/qacA genes were identified by microarray analysis.Entities:
Keywords: DNA microarray; Egypt; Staphylococcus; Streptococcus; mastitis; resistance gene
Year: 2020 PMID: 32429272 PMCID: PMC7281669 DOI: 10.3390/pathogens9050381
Source DB: PubMed Journal: Pathogens ISSN: 2076-0817
Primers and their sequences used for the detection of antibiotic resistance-associated genes in Staphylococcus and Streptococcus isolates.
| Antibiotic | Target Gene | Primer Sequences | Expected Amplicon Size (bp) | Reference |
|---|---|---|---|---|
| Methicillin/ | F: TCC AGA TTA CAA CTT CAC CAG G | 161 | [ | |
| F: TTA ACA TAT ACA CCC GCT TG | 2263 | [ | ||
| AL3: TCA AAT TGA GTT TTT CCA TTA TCA | 1931 | [ | ||
| Penicillin | F: ACT TCA ACA CCT GCT GCT GCT TTC | 172 | [ | |
| F: AAG AGA TTT GCC TAT GCT TC | 517 | [ | ||
| Vancomycin | F: ATG AAT AGA ATA AAA GTT GCA ATA | 1030 | [ | |
| F: AAG CTA TGC AAG AAG CCA TG | 536 | [ | ||
| F: GGA ATC AAG GAA ACC TC | 822 | [ | ||
| Erythromycin | F: GAA AAG GTA CTC AAC CAA ATA | 639 | [ | |
| F: TAT CTT ATC GTT GAG AAG GGA TT | 138 | [ | ||
| F: CTT CTT GAT CAC GAT AAT TTC C | 189 | [ | ||
| F: ATAGAAATTGGGTCAGGAAAAGG | 376 | [ | ||
| Macrolides | F: AAG GAA TCC TTC TCT CTC CG | 342 | [ | |
| F: AGT ATC ATT AAT CAC TAG TGC | 500 | [ | ||
| Tetracycline | F: TCG ATA GGA ACA GCA GTA | 169 | [ | |
| F: TCG TTA GCG TGC TGT CAT | 267 | [ | ||
| F: GTG GAC AAA GGT ACA ACG AG | 406 | [ | ||
| F: AAC TTA GGC ATT CTG GCT CAC | 515 | [ | ||
| F: TGG AAC GCC AGA GAG GTA TT | 660 | [ | ||
| Aminoglyco-sides | F: CCA AGA GCA ATA AGG GCA TA | 219 | [ | |
|
| F: TAA TCC AAG AGC AAT AAG GGC | 227 | [ | |
|
| F: AGA AGA TGT AAT AAT ATA G | 978 | [ | |
|
| F: GGG GTA CCT TTA AAT ACT GTA G | 848 | [ | |
| Linezolid, | F: AGG TGG TCA GCG AAC TCA | 1400 | [ | |
| Linezolid | F: GTA ACG ATC ATC ATT TGG G | 339 | [ | |
| Oxazolidinone |
| F: TGA AGT ATA AAG CAG GTT GGG AGT CA | 400 | [ |
| Lincosamide | F: ACG GAG GGA TCA CAT GGT AA | 475 | [ | |
| F: GGT GGC TGG GGG GTA GAT GTA TTA ACT GG | 323 | [ |
Prevalence of Staphylococcus and Streptococcus isolates in milk samples from cattle and buffaloes with clinical and subclinical mastitis.
| Type of Mastitis | Origin of Milk | Number of Samples | Non- | |||||
|---|---|---|---|---|---|---|---|---|
| No. | % | No. | % | No. | % | |||
| Clinical mastitis | Cattle | 22 | 2 | 9.1 | 12 | 54.6 | 1 | 4.6 |
| Buffaloes | 10 | 1 | 10.0 | 9 | 90.0 | 1 | 10.0 | |
| Subclinical mastitis | Cattle | 5 | 1 | 20.0 | 5 | 100 | 1 | 20.0 |
| Buffaloes | 13 | 4 | 30.8 | 4 | 30.8 | 3 | 23.1 | |
| Total | 50 | 8 | 16.0 | 30 | 60.0 | 6 | 12.0 | |
Identified non-Staphylococcus aureus species recovered from 50 bovine milk samples.
| CoNS |
|
|
|
|
|
|
|
|
|
| Total |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Cattle | 3 | 5 | 3 | 2 | 2 | 0 | 0 | 0 | 1 | 1 | 17 |
| Buffaloes | 6 | 3 | 1 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 13 |
Antimicrobial susceptibility of Staphylococcus isolates from milk.
| Antibiotic | Class | Non | |||||||
|---|---|---|---|---|---|---|---|---|---|
| S | I | R | RR | S | I | R | RR | ||
| Ampicillin | β-Lactam | 2 | 0 | 6 | 75.0 | 9 | 0 | 21 | 70.0 |
| Cefoxitin | β-Lactam; cephamycin | 4 | 0 | 4 | 50.0 | 15 | 3 | 12 | 40.0 |
| Ceftaroline | Cephalosporin | 8 | 0 | 0 | 0.0 | 22 | 2 | 6 | 20.0 |
| Clindamycin | Lincosamide | 2 | 0 | 6 | 75.0 | 5 | 0 | 25 | 83.3 |
| Daptomycin | Cyclic lipopeptide | 2 | 1 | 5 | 62.5 | 3 | 2 | 25 | 83.3 |
| Erythromycin | Macrolide | 2 | 0 | 6 | 75.0 | 1 | 0 | 29 | 96.7 |
| Erythromycin/ | 2 | 0 | 6 | 75.0 | 2 | 0 | 28 | 93.3 | |
| Fosfomycin | Epoxide antibiotic | 6 | 0 | 2 | 25.0 | 1 | 1 | 28 | 93.3 |
| Fusidic acid | Steroide antibiotic | 4 | 0 | 4 | 50.0 | 2 | 1 | 27 | 90.0 |
| Gentamicin | Aminoglyside | 3 | 0 | 5 | 62.5 | 5 | 1 | 24 | 80.0 |
| Gentamicin high level | Aminoglyside | 3 | 0 | 5 | 62.5 | 16 | 2 | 12 | 40.0 |
| Linezolid | Oxazolidinone | 4 | 0 | 4 | 50.0 | 7 | 2 | 21 | 70.0 |
| Moxifloxacin | Fluorchinolone | 4 | 0 | 4 | 50.0 | 5 | 1 | 24 | 80.0 |
| Mupirocin | 5 | 1 | 2 | 25.0 | 21 | 5 | 4 | 13.3 | |
| Oxacillin | β-Lactam | 4 | 0 | 4 | 50.0 | 7 | 3 | 20 | 66.7 |
| Penicillin G | β-Lactam | 1 | 0 | 7 | 87.5 | 6 | 2 | 22 | 73.3 |
| Rifampicin | Ansamycine | 3 | 1 | 4 | 50.0 | 17 | 0 | 13 | 43.3 |
| Synercid | Streptogramine | 5 | 0 | 3 | 37.5 | 11 | 2 | 17 | 56.7 |
| Teicoplanin | Glycopeptide | 8 | 7 | 0 | 0.0 | 8 | 17 | 5 | 16.7 |
| Tigecycline | Glycylcycline | 4 | 0 | 4 | 50.0 | 9 | 1 | 20 | 66.7 |
| Trimethoprim/ | Dihdrofolatreductase/ | 2 | 1 | 5 | 62.5 | 6 | 3 | 21 | 70.0 |
| Vancomycin | Glycopeptide | 8 | 0 | 0 | 0.0 | 17 | 9 | 4 | 13.3 |
S—susceptible; I—immediate; R—resistant; RR—resistance rate.
PCR results for detection of resistance-associated genes of staphylococci.
| Resistance-Associated Genes | Non- | ||||
|---|---|---|---|---|---|
| Detected | % | Detected | % | ||
| β-Lactam resistance | 7 | 87.5 | 29 | 96.7 | |
| 0 | 0.0 | 0 | 0.0 | ||
| 0 | 0.0 | 0 | 0.0 | ||
| Penicillin resistance | 8 | 100 | 22 | 73.3 | |
| Linezolid resistance | 4 | 50.0 | 3 | 10.0 | |
| 8 | 100 | 9 | 30.0 | ||
|
| 0 | 0.0 | 0 | 0.0 | |
| Erythromycin resistance | 6 | 75.0 | 15 | 50.0 | |
| 2 | 25.0 | 1 | 3.33 | ||
| 7 | 87.5 | 16 | 53.3 | ||
| Vancomycin resistance | 0 | 0.0 | 2 | 6.7 | |
| 0 | 0.0 | 9 | 30.0 | ||
| 5 | 62.5 | 2 | 6.7 | ||
| Macrolide resistance | 6 | 75.0 | 4 | 13.3 | |
| Aminoglycoside resistance | 7 | 87.5 | 17 | 56.7 | |
| Tetracycline resistance | 8 | 100 | 24 | 80.0 | |
| 2 | 25.0 | 4 | 13.3 | ||
| 4 | 50.0 | 7 | 23.3 | ||
| 0 | 0.0 | 3 | 10.0 | ||
| 0 | 0.0 | 0 | 0.0 | ||
Antibiotic resistance-associated genes in streptococci.
| Penicillin Resistance | Macrolide | Lincosamide Resistance | Aminoglycoside Resistance | Tetracycline | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 3 | 0 | 0 | 3 | 3 | 3 | 3 | 0 | 2 | 0 | 0 | 0 | 3 | 3 | 0 | |
| 1 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | |
| 1 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | |
| 1 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | |