| Literature DB >> 32425811 |
Shumin Lü1, Ming Jiang1,2, Xing Tian1, Shanwang Hong1, Junwei Zhang1, Yalin Zhang1.
Abstract
<span class="Gene">Muscarinic acetylcholine receptor (m<span class="Chemical">AChR) regulates many neurophysiological functions in insects. In this report, a full-length cDNA encoding an A-type mAChR was cloned from the oriental armyworm, Mythimna separata. Pharmacological properties studies revealed that nanomolar to micromolar concentrations of carbachol or muscarine induced an increase of intracellular Ca2+ concentration ([Ca2+] i ), with the EC50 values of 124.6 and 388.1 nM, respectively. The increases of [Ca2+] i can be greatly blocked by the antagonist atropine, with an IC50 value of 0.09 nM. The receptor mRNA is expressed in all developmental stages, with great differential expression between male and female adults. The tissue expression analysis identified novel target tissues for this receptor, including ovaries and Malpighian tubules. The distribution of Ms A-type mAChR protein in the male brain may suggest the neurophysiological roles that are mediated by this receptor. However, the receptor protein was found to be distributed on the membranes of oocytes that are not innervated by neurons at all. These results indicate that Ms A-type mAChR selectively mediates intracellular Ca2+ mobilization. And the high level of receptor protein in the membrane of oocytes may indicate a possible non-neuronal role of A-type mAChR in the reproductive system of M. separata.Entities:
Keywords: A-type mAChR; Ca2+; G protein-coupled receptor; Mythimna separata; pharmacology
Year: 2020 PMID: 32425811 PMCID: PMC7203735 DOI: 10.3389/fphys.2020.00400
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.566
Oligonucleotide primers used for Ms A-type mAChR.
| Name | Primer sequence 5′-3′ | Expected size | Tm |
| F1 | GAT(A/C/T)TC(C/G)TT(C/T)AAGATCGACAA | 1566 bp | 53° |
| R1 | GC(A/G)TTGCACA(A/G)GGCGTA(A/G)CA | ||
| 3′GSP1 | GGGATTGACGAAACAGCCGA | 532 bp | 56° |
| 3′GSP2 | CGTTGTCGGCCATCCTTCTA | ||
| 5′GSP1 | CTTCTGCCGTTTCTTAGTTTCC | 715 bp | 60° |
| 5′GSP2 | CTATCATCATGGTCGCTCTTCG | ||
| F2 | ATGCTCATCGCGCTCAATGA | 1806 bp | 53° |
| R2 | TCAGTTGTATACTCCTCTGG | ||
| QS1 | GCATCCCTGACGAACTGT | 154 bp | 60° |
| QA1 | ATCGCTTCCCTATTCCTAT | ||
| QS2 | CCTGCGTCTGGACTTGGC | 107 bp | 60° |
| QA2 | CGCGCACGATCTCACGCT | ||
| CTA | 1824 bp | 55° | |
| GGC |
FIGURE 1The nucleotide and deduced amino acid sequences of Mythimna separata A-type mAChR. The initiating codon ATG and the stop codon TAA are underlined and boldfaced. Seven N-glycosylation consensus sequences were underlined. Seven transmembrane-spanning domains are marked in gray. One cell attachment sequence RGD is double lined. Four cAMP- and cGMP-dependent protein kinase phosphorylation sites were marked with a wavy line. One G-protein coupled receptors signature is boldfaced. A DRY motif and the NPXXY motif are marked with a dotted line. The conserved amino acid residues that are responsible for coupling the mAChRs to G11 are marked with a triangle. 14 amino acid residues involved in the antagonist QNB binding are marked with a circle. The proposed (“modeled”) binding residues for acetylcholine are marked with a circle and underlined.
FIGURE 2Phylogenetic tree constructed on the basis of overall protein sequences of mAChRs from insects and human m1–m5 mAChRs (released in GenBank). Numbers at branch nodes are percentages of bootstrap confidence values. The phylogenetic tree was constructed by MEGA 7.0, using the neighbor-joining method with bootstrap test with 1000 replicates and a Poisson correction model. Mythimna separata, Ms: Ms-mAChR-A KY296116; Apis mellifera, Am:Am-mAChR-A XP_395760.4, Am-mAChR-B XP_006558421.1; Bombyx mori, Bm: Bm-mAChR-C XP_004924179.1; Tribolium castaneum, Tc: Tc-mAChR-C EFA01319.1, Tc-mAChR-A AFJ23966.1, Tc-mAChR-B AFJ23968.1; Anopheles gambiae, Ag: Ag-mAChR-C XP_310742.3; Drosophila melanogaster, Dm: Dm-mAChR-A AFJ23965.1, Dm-mAChR-B AGE13748.1, Dm-mAChR-C AAF46208.1; Homo sapiens, Hs:Hs-mAChR-M1 NP_000729.2, Hs-mAChR-M2 NP_001006633.1, Hs-mAChR-M3 NP_000731.1, Hs-mAChR-M4 NP_000732.2, Hs-mAChR-M5 NP_001307846.1.
FIGURE 3Functional assay of Mythimna separata A-type mAChR transiently expressed in HEK293 cell lines. (A) Dose–response curves of the effects of carbachol on representative [Ca2+] i responses. (B) Dose–response curves of the effects of muscarine on representative [Ca2+] i responses. (C) Dose–response curves of the effects of antagonist atropine on the [Ca2+] i responses induced by 10 μM carbachol. (D) Dose–response curves of the effects of carbachol on modulation of intracellular cAMP of A-type mAChR transiently expressed in HEK293 cell lines. (E) Dose–response curves of the effects of muscarine on modulation of intracellular cAMP of A-type mAChR transiently expressed in HEK293 cell lines. (F) Dose–response curves of the effects of antagonist atropine on intracellular cAMP responses induced by 10 μM carbachol.
FIGURE 4Relative expression profiles (±standard error of the mean; n = 3) of Ms A-type mAChR mRNA in different developmental stages of Mythimna separata. All expression levels are shown relative to the expression level in the first instar. Developmental stages from egg to the last instar; **highly significant difference [P ≦ 0.01, analysis of variance (ANOVA)] compared with other larval stages. Developmental stages from pupae to adults of male and female M. separata. **highly significant difference [P ≦ 0.01, analysis of variance (ANOVA)] compared with males of the same developmental stage.
FIGURE 5Relative expression profiles (±standard error of the mean; n = 3) of Ms A-type mAChR mRNA in different tissues of Mythimna separata adults. All expression levels are shown relative to the expression level in the head of female adults. **highly significant difference [P≦0.01, analysis of variance (ANOVA)], *significant difference (P ≦ 0.05, ANOVA).
FIGURE 6Immunostaining in the ovary of female Mythimna separata adults with polyclonal antiserum against Ms A-type mAChR protein. Streptavidin-peroxidase (SP) staining technique, cryosections. (A) Arrows showing the moderate positive signal at the membrane of the oocyte in the early stage of oogenesis. (B) The negative control, showing no positive signals. (C,D) Arrows the strong positive signal at the membrane of the oocytes and the old development oocytes. Scale bar = 200 μm.
FIGURE 7Immunostaining in the brain of male Mythimna separata adults with polyclonal antiserum against Ms A-type mAChR protein. streptavidin-peroxidase (SP) staining technique, cryosections. (A) Frontal section of the brain of males showing the distribution pattern of Ms A-type mAChR protein. Large arrows showing Ms A-type mAChR immunostaining in cell clusters and fibers of the optic lobe (OL), arrowheads showing Ms A-type mAChR immunostaining in antennal lobes (ALs), small arrow showing Ms A-type mAChR immunostaining in the central body (CB) and mushroom body (MB). (B) Arrows showing Ms A-type mAChR immunostaining in CB; small arrow showing Ms A-type mAChR immunostaining in MB. (C) Arrows showing Ms A-type mAChR immunostaining in the ordinary glomeruli (OG) and fibrous core of ALs. Arrowheads showing Ms A-type mAChR immunostaining in the lateral cell cluster (LC) of AL. (D) Frontal section through the OL showing Ms A-type mAChR immunostaining in the proximal layer of the lamina (La), fibers in the optic chiasm (OC) and the medulla (Me). (E) Arrowheads showing Ms A-type mAChR immunostaining in the LC of AL and in the CB, arrows showing Ms A-type mAChR immunostaining in OG of AL. (F) The negative control, showing no positive signals. Scale bar = 200 μm.