Literature DB >> 32395888

Methylation-mediated miR-214 regulates proliferation and drug sensitivity of renal cell carcinoma cells through targeting LIVIN.

Hao Xu1, Shangjun Wu1, Xin Shen2, Zhan Shi3, Ding Wu4, Yuan Yuan1, Wei Jiang1, Qianliang Wang1, Qin Ke1, Qing Mao1, Xianlong Li1, Yong Liu1, Pingcheng Yuan1, Qinghan Zhang1, Enying Huang1, Xiaogang Chen1.   

Abstract

LIVIN, a member of the inhibitor of apoptosis proteins (IAPs), is reported playing important roles in the development and progression of multiple human cancers. However, its underlined mechanisms in human renal cell carcinoma (RCC) are still needed to be clarified. In the present study, we reported that inhibition of miR-214 promoted the expression of LIVIN, then facilitated RCC cells growth and reduced the sensitivity of RCC cells to chemotherapeutic drugs. In constant, overexpression of miR-214 had contradictory effects. Further investigation showed that miR-214 was down-regulated in RCC because of abnormal methylation. In addition, DNA methyltransferase DNMT1, miR-214 and LIVIN are directly correlated in RCC patients. In conclusion, these results suggest that abnormal miR-214 methylation negatively regulates LIVIN, which may promote RCC cells growth and reduced the sensitivity of RCC cells to chemotherapeutic drugs.
© 2020 The Authors. Journal of Cellular and Molecular Medicine published by Foundation for Cellular and Molecular Medicine and John Wiley & Sons Ltd.

Entities:  

Keywords:  DNMT1; LIVIN; RCC; chemotherapy; methylation; miR-214

Mesh:

Substances:

Year:  2020        PMID: 32395888      PMCID: PMC7294148          DOI: 10.1111/jcmm.15287

Source DB:  PubMed          Journal:  J Cell Mol Med        ISSN: 1582-1838            Impact factor:   5.310


INTRODUCTION

RCC is a widespread carcinoma of the urinary system, making up more than 90% of the kidney carcinoma. Although most patients can heal by surgery, 20%‐30% will relapse. Therefore, exploring mechanisms of RCC and prolonging the survival time of patients become urgent and significant matters we are facing. As an IAP, LIVIN is firstly found in 2001. It has been shown to be involved in inhibiting apoptosis, , regulating proliferation and promoting cell cycle. Molecular biology studies have shown that LIVIN can inhibit the expression of caspase‐3, caspase‐7 and caspase‐9. On the other hand, LIVIN can ubiquitinate and degrade Smac/DIABLO. All these are the molecular basis for LIVIN to avoid apoptosis. Recently, it has been reported that LIVIN plays critical roles in the development and progression of human cancers. For example, the expression of LIVIN is frequently up‐regulated in human acute lymphoblastic leukaemia, rectal cancer, gastric cancer and lymphoma. , , , Furthermore, the role of LIVIN in RCC has also been confirmed. Silencing the level of LIVIN suppresses the growth of renal cancer transplantation tumour. Moreover, inhibition of LIVIN can improve the sensitivity of RCC cells to apoptosis. mRNA‐interfering complementary RNA (microRNA) is a small molecule that complements the regulated RNA or DNA. Pairing with the 3'UTR of the target mRNA, microRNA can regulate the transcribed protein‐coding genes through degradation of mRNA or inhibition of protein translation. About 700 human microRNAs have been determined, most of which have been tried and found tissue‐specific or cell‐specific. Studies have shown that microRNA is extremely essential for gene regulation, including cell growth, proliferation, differentiation and apoptosis, hematopoietic, organ formation, the occurrence and development of cancers. , In this study, we provide evidence that LIVIN was negatively regulated by miR‐214. Importantly, miR‐214 can inhibit RCC cells growth both in vitro and vivo, and enhance the sensitivity of RCC cells to chemotherapeutic drugs. Furthermore, abnormal miR‐214 methylation induces its down‐regulation in RCC. In conclusion, methylation‐mediated miR‐214 regulates proliferation and drug sensitivity of RCC cells through targeting LIVIN.

MATERIAL AND METHOD

Antibodies

The antibodies of Flag, LIVIN, PARP‐1, DNMT1, DNMT3A, DNMT3B and Actin were purchased from Abcam.

Cell culture

RCC cell lines RCC4, RCC10 and 786‐O and human embryonic kidney cell line 293 (HEK293) were purchased from the cell bank of Shanghai Institutes of Chinese Academy of Sciences. Cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% foetal bovine serum (TransGen) in a 5% CO2 incubator at 37°C.

Cell transfections

Cell transfection was performed with a Lipofection 2000 (Invitrogen) as described in the manufacturer's protocol. Cell transfection was carried out by Lipofection 2000 according to the manufacturer's instructions.

Western blotting

The Western blotting refers to Professor Wang. Lysing the cells within RIPA buffer and centrifuged at 12 000 g for 10 minutes at 4°C. Collecting the supernatants. Subjecting equal amount of proteins to 10% SDS‐PAGE and then transferred to 0.45‐μm pore size PVDF membrane (Millipore). After blocking with 3% BSA, the membrane was probed with primary antibodies (Flag, LIVIN, PARP‐1 and Actin) at 4°C overnight and secondary antibodies at room temperature for 1 hour. Bound antibodies were detected by the ECL Plus Western blotting substrate (Thermo Fisher) and detected by enhanced chemiluminescence detection system (Thermo Fisher). Band densities were quantified by ImageJ Software. The relative amount of proteins was determined by normalizing the densitometry value of interest to that of the loading control.

Chromatin immunoprecipitation

A total of 107‐108 cells were collected, and the cells were resuspended in PBS solution containing 1% formaldehyde. The cells were cross‐linked at room temperature for 10 minutes, and the final concentration reached 0.125 M by adding glycine solution. Cells were lysed by centrifugation using 1 mL FA lysis buffer containing proteinase inhibitor, and the cross‐linked DNA was broken by ultrasound cell fragmentation apparatus to about 300‐500 bp in size. Centrifugation was performed at 21 100 g at 4℃ for 5 minutes. A 50 μL was taken as input, and the remaining supernatant was used for immunoprecipitation experiment. After immune precipitation, protein A + G agarose added 1 mL washing buffer to wash three times and 1 mL final wash buffer to wash twice. A 120 μL elution buffer was added to each tube, which was shaken violently at room temperature for 15 minutes and centrifuged at 1000 g for 1 minutes to collect supernatant. A 280 μL elution buffer was added to each tube, 350 μL elution buffer was added to Input, 5 μL protease K (20 mg/mL) and 2 μL RNase A were added, and 4‐5 hours were digested at 65℃. Phenolic chloroform extraction, anhydrous ethanol precipitation collection of DNA. The collected DNA was used as template, and the amount of immunoprecipitated DNA was detected by PCR or qPCR using primers of specific chip‐PCR fragments, so as to infer the binding of proteins on DNA.

Luciferase reporter gene assay

HEK‐293 cells (1 × 105 cells) were inoculated into 24‐well plates, with a cell density of 70% or so. Each well was transfected with firefly luciferase reporter plasmid 0.25 μg, other exogenous plasmids 0.25 μg and sea kidney luciferase reporter plasmid pRL‐TK 0.01 μg. The activity of firefly luciferase reporter and sea kidney luciferase reporter was detected 24 hours after transfection with a Dual Luciferase Reporter Assay Kit from Promega.

MTT assay

The cells were inoculated into a 96‐well plate, and 24 wells of each cell were inoculated repeatedly, and 1000 cells were inoculated in each hole. In this study, DMEM medium containing 10% foetal bovine serum and 0.01% penicillin and streptomycin dual antibody solution was used. The cells were cultured in 37℃ incubators with 5% CO2 concentration. Three repeated wells of each cell were taken for testing every day, and 25 μL MTT was added into each hole, and then, the culture was conducted in a 37℃ incubator for 4‐8 hours in dark, followed by careful absorption of supernatant, 50 μL DMSO was added to dissolve the crystallites, and OD value of samples in each hole at 570 nm was tested by microplate analyser. After 7 days of continuous measurement, the growth curve of each cell can be plotted according to the change of OD value every day.

Plate colony formation

Five mL of cell suspension containing 400 cells was inoculated into a diameter 60 mm dish for continuous culture until the visible clones appeared. Then, the cells were fixed with methanol and stained with 0.05% crystal violet solution. After washing twice with PBS, the plates were photographed using a digital camera. Positive colony formation, defined as colonies with more than 50 cells, was confirmed by manual counting.

Quantitative polymerase chain reaction (QPCR)

RNA was extracted from stable cell lines, and cDNA was synthesized by reverse transcription kit (TIANGEN, Beijing, China) according to the manufacturer's instructions. Quantitative RT‐PCR was performed using the ABI 7500 real‐time PCR machine (Applied Biosystems, Carlsbad, CA, USA). β‐actin was used as a standardized control. The primers are as follows: LIVIN‐F:‐GCTCTGAGGAGTTGCGTCTG‐; LIVIN‐R: ‐CACACTGTGGACAAAGTCTCTT‐. miR‐148‐F: ‐CAAGCACGAT TAGCATTTGA‐; miR‐148‐R: ‐TAGAAAGCT TTCGAGACAA‐. miR‐214‐F: ‐GGCCTGGCTG GACAGAGTTG‐; miR‐214‐R: ‐AGGCTGGGTT GTCATGTGAC‐. miR‐423‐F: ‐ATAAAGGAAG TTAGGCTGAG‐; miR‐423‐R: ‐GCGC GGGTTAGGAA GCAAGA‐. DNMT1‐F: ‐CCTAGCCCCAGGATTACAAGG‐; DNMT1‐R: ‐ACTCATCCGATTTGGCTCTTTC‐.

RNA‐IP isolation of RISC complexes

RNA immunoprecipitation method was used to collect 107 stable transfection cells. After purple staining, RNase inhibitor (Thermo Fisher) and proteinase inhibitor (Sigma‐Aldrich) were used to lyse the cells, and DNase I (Thermo Fisher) was used to digest the DNA. The supernatant was isolated and incubated with 1 g Ago2 antibody (Cell Signaling Technology) or control IgG and protein g beads (Thermo Fisher) cross‐linked to magnetic beads. Magnetic beads were collected and used to extract immunoprecipitated RNA using TRIzol reagent (Thermo Fisher). Then, random reverse transcription primers were used for reverse transcription reaction.

Methylation detection

Bisulphite genome sequencing. Genomic DNA was extracted from DNMT1 overexpressed or inhibited RCC4, RCC10 and 786‐O cells and treated with bisulphite. Genomic DNA (1 mg) was denatured by incubation with 0.2M NaOH. Add equal parts of 10mM hydroquinone and 3M sodium bisulphite (pH 5.0) and incubate the solution at 50℃ for 16 hours. To analyse the DNA methylation status of miR‐214 CpG islands, nested PCR was used to amplify CpG island rich regions from bisulphite‐treated genomic DNA, using specific primers. The PCR products were then subcloned into the pGEM‐T easy vector (Promega) for DNA sequencing. #1 F: ‐ATTGTTTAGA ATTTTCCTGG‐; R: ‐AGAATTTAGA ACTTTAAATA‐ #2 F: ‐CTAAATAACA TCTTATCTAT‐; R: ‐TATTTGAACT CACTGGGCTT‐ #3 F: ‐TAAGAACTCA CAATCAAATG‐; R: ‐ACTCTTTTTC CCACTCTACA‐ #4 F: ‐CTCCTCACTG AGAAACTGGT‐; R: ‐ AGTTCATTAT TTCTCTGCAC‐ #5 F: ‐CCCCATGTGA GAATGAGCGA‐; R: ‐TAAATCATAA CTCTGTCTTC‐ #6 F: ‐TCTAGTGGTT ACTTTTCTAG‐; R: ‐ACATTCTCCT CTTGGCTTCC‐ #7 F: ‐GCTCCTAGAT GAGTTCATCT‐; R: ‐TAGGCTACTT GGCGGTCAGG‐ #8 F: ‐ACTGGCAAAT TGGATAAAGA‐; R: ‐ACACACATAG GCTCAAAATA‐ #9 F: ‐ACACCCCACT GTCAACATAA‐; R: ‐AACTGAACTC CGCTCTGCAC‐ #10 F: ‐TCTCAGACCA CAGTGCAATC‐; R: ‐GAAACTGAAC AACCTGCTCC‐

Graft experiment

Male BALB/C nude mice of 4 weeks old were purchased and cultured in cages at SPF level, with 5 nude mice in each cage. Next, the cells of the same experimental group were cultured synchronously. After the logarithmic phase, the cells were harvested. Then, 1 × 107 cells were suspended in 100 uL serum‐free DMEM medium, and the cells were injected subcutaneously into the armpits of nude mice, with 3 nude mice for each cell. The tumour size was measured every three days from the 10th day after continuous culture of nude mice for 30‐40 days. The volume was calculated by the formula V (mm cubed) = length × width ×height/2. After the measurement, the nude mice were killed, and the tumour was removed, weighed, photographed and analysed for protein expression. DPP, 5‐FU and MMC were used to treat the transplanted tumour in nude mice. In the treatment of transplanted tumour, 36 nude mice were modelled, and 107 Ctrl, miR‐124, miR‐124‐sponge RCC4, RCC10 or 776‐O cells were subcutaneously injected into each mouse, which were randomly divided into 4 groups, 3 in each group. At the 10th day, 107 titres of Ctrl, DPP, 5‐FU and MMC were injected into each group in situ for 4 weeks, twice a week, and the mice were killed after 40‐55 days. miRNA expression and tumour growth were detected in transplanted tumour specimens.

Prediction of miRNA target genes

Information analysis of miRNAs is done using the miRBase (www.mirbase.org/) database. The miRNA target genes of prediction using database is miRDB (www.mirdb.org), miRNA.org (http://www.microrna.org/microrna/getMirnaForm.do), miRwalk (www.ma.uniheidelberg.de/app‐s/zmf/mirwalk/), DIANAmT (http://diana.cslab.ece.ntua.gr/microT/,V3.0), Targetscan (http://ww‐w.targetscan.org/release6.2).

Biostatistical analysis

Data processing Software includes: GraphPad Prism Software (version 5.01), Microsoft Office 2013 (Windows version of Word, Excel and PowerPoint), CFX manager and Gen5.1. Spearman rank correlation test and unpaired two‐tailed Student's t test were used for data difference analysis. A P value less than .05 is considered statistically significant.

RESULTS

Identification of the microRNA targeting LIVIN

To investigate the microRNA targeting LIVIN, we took bioinformatics in Targetscan, miRWalk, miRDB and other databases. As Figure 1A showed, miR‐214, miR‐432 and miR‐148 were selected for verification. We detected the mRNA levels of LIVIN, miR‐214, miR‐432 and miR‐148 in RCC tissue. The results showed that, comparing with normal tissues, the mRNA levels of LIVIN and miR‐214 in RCC tissues were substantially increased and decreased, separately. However, there were no observable changes of miR‐432 or miR‐148 (Figure 1B). The following correlation analysis showed that only miR‐214 was germane to LIVIN (Figure 1C). Furthermore, we up‐regulated these microRNAs in HEK293 and MEF cells. As Figure 1D‐F showed, comparing with Ctrl group, the levels of LIVIN mRNA, protein and 3’UTR‐luciferace obviously reduced only in overexpressing miR‐214 group. These results suggest that miR‐214 targets LIVIN.
Figure 1

Identification of the microRNA targeting LIVIN. A, miRNAs capable of targeting LIVIN were predicted on Targetscan, miRWalk and miRDB, respectively. B, QPCR was used to detect the expression of LIVIN, miR‐214, miR‐148 and miR‐423 in RCC tissues. C, Correlation analysis of miR‐214, miR‐148 and miR‐423 with LIVIN in RCC tissues. D, Overexpressing miR‐214, miR‐148 and miR‐423 in HEK293 and MEF cells, and detecting the RNA level of LIVIN. E, Overexpressing miR‐214, miR‐148 and miR‐423 in HEK293 and MEF cells, and detecting the protein level of LIVIN. F, Overexpressing miR‐214, miR‐148 and miR‐423 in HEK293 and MEF cells, and testing their regulation on LIVIN's 3’UTR‐luciferace. *P < .05, **P < .01, ***P < .001

Identification of the microRNA targeting LIVIN. A, miRNAs capable of targeting LIVIN were predicted on Targetscan, miRWalk and miRDB, respectively. B, QPCR was used to detect the expression of LIVIN, miR‐214, miR‐148 and miR‐423 in RCC tissues. C, Correlation analysis of miR‐214, miR‐148 and miR‐423 with LIVIN in RCC tissues. D, Overexpressing miR‐214, miR‐148 and miR‐423 in HEK293 and MEF cells, and detecting the RNA level of LIVIN. E, Overexpressing miR‐214, miR‐148 and miR‐423 in HEK293 and MEF cells, and detecting the protein level of LIVIN. F, Overexpressing miR‐214, miR‐148 and miR‐423 in HEK293 and MEF cells, and testing their regulation on LIVIN's 3’UTR‐luciferace. *P < .05, **P < .01, ***P < .001

miR‐214 negatively regulates the express of LIVIN

To further determine the relationship between miR‐214 and LIVIN, we took the advantage of loss‐of‐function and gain‐of‐function approaches in RCC4, RCC10 and 786‐O cells. The QPCR and Western blotting showed that the mRNA and protein levels of LIVIN significantly decreased in RCC cells while miR‐214 was overexpressed, comparing with the Ctrl group (Figure 2A,B). In contrast, silencing of miR‐214 had contradictory effects (Figure 2C,D). Next, as Figure 2E showed, overexpression of miR‐214 inhibited the activity of LIVIN‐3’UTR‐luciferace but not the mutant, while knock down of miR‐214 facilitated it. Gene silencing in the process of RNA interference is transmitted by a ribonucleoprotein complex referred to as the RNA‐induced silencing complex (RISC). To continue to examine the regulation of LIVIN by miR‐214, we incorporated them into RISC. The results also showed that the RNA level of LIVIN significantly increased upon miR‐214 being silenced (Figure 2F). These results suggest that miR‐214 negatively regulates the express of LIVIN.
Figure 2

miR‐214 negatively regulates the express of LIVIN. A, The mRNA and (B) protein levels of LIVIN in miR‐214 overexpressed RCC cells. C, The mRNA and (D) protein levels of LIVIN in miR‐214 down‐regulated RCC cells. E, The activity of LIVIN‐3’UTR‐luciferace and the mutant in miR‐214 overexpressed/silence RCC cells. F, The RNA level of LIVIN while incorporating miR‐214 and LIVIN into RISC. *P < .05, **P < .01, ***P < .001

miR‐214 negatively regulates the express of LIVIN. A, The mRNA and (B) protein levels of LIVIN in miR‐214 overexpressed RCC cells. C, The mRNA and (D) protein levels of LIVIN in miR‐214 down‐regulated RCC cells. E, The activity of LIVIN‐3’UTR‐luciferace and the mutant in miR‐214 overexpressed/silence RCC cells. F, The RNA level of LIVIN while incorporating miR‐214 and LIVIN into RISC. *P < .05, **P < .01, ***P < .001

Overexpression of miR‐214 inhibits the proliferation of RCC cells and tumorigenesis in nude mice

It has been observed that microRNAs are involved in the occurrence and development of cancers. We have examined the role of miR‐214 on cell growth in vitro and vivo. The MTT assay showed the cell viability was decreased upon overexpressing miR‐214 (Figure 3A). The ability of colony formation was also obviously suppressed upon up‐regulating miR‐214, comparing with the Ctrl group (Figure 3B). On the other hand, tumour‐bearing experiment in nude mice showed that both the volume and weight of tumours were reduced, while miR‐214 was up‐regulated (Figure 3C‐D). Next, total lysates were extracted from these tumours, and the LIVIN and PARP‐1 (apoptosis biomarker) protein levels were evaluated by Western blotting. As Figure 3E showed, the expression level of LIVIN was dramatically decreased in miR‐214 group, while the expression level of PARP‐1 was increased sharply. These results indicate that overexpression of miR‐214 inhibits the proliferation of RCC cells and tumorigenesis in nude mice.
Figure 3

Overexpression of miR‐214 inhibits the proliferation of RCC cells and tumorigenesis in nude mice. A, The MTT assay showed the cell viability upon overexpressing miR‐214. B, The ability of colony formation was obviously suppressed upon up‐regulating miR‐214. C, Tumour‐bearing experiment in nude mice showed that (D) both the volume and weight of tumours were reduced, while miR‐214 was up‐regulated. E, Western blotting showed the expression level of LIVIN and PARP‐1 in miR‐214 overexpressed RCC cells. *P < .05, **P < .01, ***P < .001

Overexpression of miR‐214 inhibits the proliferation of RCC cells and tumorigenesis in nude mice. A, The MTT assay showed the cell viability upon overexpressing miR‐214. B, The ability of colony formation was obviously suppressed upon up‐regulating miR‐214. C, Tumour‐bearing experiment in nude mice showed that (D) both the volume and weight of tumours were reduced, while miR‐214 was up‐regulated. E, Western blotting showed the expression level of LIVIN and PARP‐1 in miR‐214 overexpressed RCC cells. *P < .05, **P < .01, ***P < .001

Knock down of miR‐214 encourages the proliferation of RCC cells and tumorigenesis in nude mice

To further investigate the roles of miR‐214 on the proliferation of RCC cells and tumorigenesis in nude mice, we silenced miR‐214. The MTT assay revealed that the proliferation rate of the miR‐214 sponge group was significantly increased (Figure 4A). The ability of colony formation was also obviously increased upon silencing miR‐214, comparing with the Ctrl group (Figure 4B). As opposed to overexpression, the volume and weight of tumours were raised while knocking down of miR‐214 (Figure 4C‐D). Furthermore, the Western blotting showed that the expression level of LIVIN was obviously increased in miR‐214 sponge group, while the expression of PARP‐1 was distinctly decreased (Figure 4E). These results suggest that knock down of miR‐214 encourages the proliferation of RCC cells and tumorigenesis in nude mice.
Figure 4

Knock down of miR‐214 encourages the proliferation of RCC cells and tumorigenesis in nude mice. A, The MTT assay showed the cell viability upon silencing miR‐214. B, The ability of colony formation was obviously enhanced upon down‐regulating miR‐214. C, Tumour‐bearing experiment in nude mice showed that (D) both the volume and weight of tumours were increased, while miR‐214 was down‐regulated. E, Western blotting showed that the expression level of LIVIN and PARP‐1 in miR‐214 silence RCC cells. *P < .05, **P < .01, ***P < .001

Knock down of miR‐214 encourages the proliferation of RCC cells and tumorigenesis in nude mice. A, The MTT assay showed the cell viability upon silencing miR‐214. B, The ability of colony formation was obviously enhanced upon down‐regulating miR‐214. C, Tumour‐bearing experiment in nude mice showed that (D) both the volume and weight of tumours were increased, while miR‐214 was down‐regulated. E, Western blotting showed that the expression level of LIVIN and PARP‐1 in miR‐214 silence RCC cells. *P < .05, **P < .01, ***P < .001

miR‐214 inhibits RCC cells growth through regulating LIVIN

The above results have shown that miR‐214 negatively regulates LIVIN and inhibits the growth of RCC cells. However, whether LIVIN is involved in the process of miR‐214 inhibiting the growth of RCC cells is not clear. Thus, we performed the rescue experiments by overexpressing LIVIN in miR‐214 up‐regulated cells. It was noted that overexpressing LIVIN effectively restored the cell proliferation and tumorigenesis induced by up‐regulation of miR‐214 (Figure 5). In constant, knocking down of LIVIN in miR‐214 down‐regulated cells significantly inhibited the cell proliferation and tumorigenesis caused by silencing of miR‐214 (Figure 6). These results suggest that miR‐214 negatively regulates LIVIN thereby inhibiting the growth of RCC cells and tumorigenesis in nude mice.
Figure 5

Overexpressing LIVIN effectively restored the cell proliferation and tumorigenesis induced by up‐regulation of miR‐214. A, The MTT assay showed that overexpressing LIVIN effectively restored the cell viability induced by up‐regulation of miR‐214. B, The ability of colony formation was obviously enhanced upon overexpressing LIVIN in miR‐214 up‐regulated RCC cells. C, Tumour‐bearing experiment in nude mice showed that (D) both the volume and weight of tumours were restored while overexpressing LIVIN in miR‐214 up‐regulated RCC cells. E, Western blotting showed that the expression level of LIVIN was dramatically increased in miR‐214 + LIVIN group, while the expression level of PARP‐1 was decreased sharply. *P < .05, **P < .01, ***P < .001

Figure 6

Knocking down of LIVIN in miR‐214 down‐regulated cells significantly inhibited the cell proliferation and tumorigenesis caused by silencing of miR‐214. A, The MTT assay showed that knocking down of LIVIN effectively inhibited the cell viability induced by down‐regulation of miR‐214. B, The ability of colony formation was obviously reduced upon silencing LIVIN in miR‐214 down‐regulated RCC cells. C, Tumour‐bearing experiment in nude mice showed that (D) both the volume and weight of tumours were inhibited while up‐regulating LIVIN in miR‐214 silenced RCC cells. E, Western blotting showed that the expression level of LIVIN was dramatically decreased in miR‐214 sponge + LIVIN group, while the expression level of PARP‐1 was increased sharply. *P < .05, **P < .01, ***P < .001

Overexpressing LIVIN effectively restored the cell proliferation and tumorigenesis induced by up‐regulation of miR‐214. A, The MTT assay showed that overexpressing LIVIN effectively restored the cell viability induced by up‐regulation of miR‐214. B, The ability of colony formation was obviously enhanced upon overexpressing LIVIN in miR‐214 up‐regulated RCC cells. C, Tumour‐bearing experiment in nude mice showed that (D) both the volume and weight of tumours were restored while overexpressing LIVIN in miR‐214 up‐regulated RCC cells. E, Western blotting showed that the expression level of LIVIN was dramatically increased in miR‐214 + LIVIN group, while the expression level of PARP‐1 was decreased sharply. *P < .05, **P < .01, ***P < .001 Knocking down of LIVIN in miR‐214 down‐regulated cells significantly inhibited the cell proliferation and tumorigenesis caused by silencing of miR‐214. A, The MTT assay showed that knocking down of LIVIN effectively inhibited the cell viability induced by down‐regulation of miR‐214. B, The ability of colony formation was obviously reduced upon silencing LIVIN in miR‐214 down‐regulated RCC cells. C, Tumour‐bearing experiment in nude mice showed that (D) both the volume and weight of tumours were inhibited while up‐regulating LIVIN in miR‐214 silenced RCC cells. E, Western blotting showed that the expression level of LIVIN was dramatically decreased in miR‐214 sponge + LIVIN group, while the expression level of PARP‐1 was increased sharply. *P < .05, **P < .01, ***P < .001

miR‐214 positively regulates the sensitivity of RCC cells to chemotherapy drugs

As we all know, all basic researches are definitely for the clinical service. To explore whether miR‐214 was associated with regulating the sensitivity of RCC cells to chemotherapy drugs, three chemotherapy drugs (Cisplatin, DPP; 5‐Fluorouracil, 5‐FU; and Mitomycin, MMC) were used. As showed in Figure 7A, when treated by chemotherapy drugs, overexpression of miR‐214 markedly attenuated cell activity, while knocking down of miR‐214 facilitated cell activity. The ability of colony formation was also obviously suppressed by up‐regulating of miR‐214 upon RCC cells being treated by these drugs. In constant, silencing of miR‐214 had conflicted effects (Figure 7B). Furthermore, tumour‐bearing experiments in nude mice also showed that overexpression of micR‐214 enhanced the sensitivity of RCC cells to chemotherapy drugs. Constantly, silencing of miR‐214 increased the resistance of RCC cells to these drugs (Figure 7C,D). These results suggest that miR‐214 positively regulates the sensitivity of RCC cells to chemotherapy drugs.
Figure 7

miR‐214 positively regulates the sensitivity of RCC cells to chemotherapy drugs. A, The MTT assay showed the cell viability of chemotherapy drugs treated RCC cells while overexpressing or silencing miR‐214. B, The ability of colony formation was obviously suppressed by up‐regulating of miR‐214 and was enhanced by silencing miR‐214, while RCC cells being treated by these drugs. C, D, The tumour‐bearing experiments in nude mice showed that overexpression of micR‐214 enhanced the sensitivity of RCC cells to chemotherapy drugs, while silencing of miR‐214 increased the resistance of RCC cells to these drugs. *P < .05, **P < .01, ***P < .001

miR‐214 positively regulates the sensitivity of RCC cells to chemotherapy drugs. A, The MTT assay showed the cell viability of chemotherapy drugs treated RCC cells while overexpressing or silencing miR‐214. B, The ability of colony formation was obviously suppressed by up‐regulating of miR‐214 and was enhanced by silencing miR‐214, while RCC cells being treated by these drugs. C, D, The tumour‐bearing experiments in nude mice showed that overexpression of micR‐214 enhanced the sensitivity of RCC cells to chemotherapy drugs, while silencing of miR‐214 increased the resistance of RCC cells to these drugs. *P < .05, **P < .01, ***P < .001

DNA methyltransferase DNMT1 regulates the miR‐214/LIVIN pathway through promoting the DNA methylation levels of miR‐214

It has been reported that protein expression levels are often closely correlated with DNA methylation levels. We evaluated the conservativeness of miR‐214 promoter at 10 kb upstream and 10 kb downstream (Figure 8A). The chromatin immunoprecipitation (ChIP) assay showed that the DNA methyltransferase DNMT1 mainly binds in the 5th and 6th amplicon subregions (Figure 8B). To further explore the roles of DNMT1 in regulating miR‐214/LIVIN pathway, we transiently transacted Flag‐tagged DNMT1 cDNA into RCC4, RCC10 and 786‐O cells to achieve the gain of function. As showed in Figure 8C, overexpression of DNMT1 obviously reduced the mRNA level of miR‐214 but increased the mRNA level of LIVIN. However, breakdown of DNMT1 (shDNMT1#1 and shDNMT1#2) had differing effects. The subsequent Western blotting had the same consequences (Figure 8D). The effect of methylation inhibitor (DC‐517) on the expression of miR‐214 and LIVIN was same with breakdown of DNMT1 (Figure 8E and F). Furthermore, overexpression of DNMT1 significantly inhibited the luciferase activity of miR‐214 promoter, while knock down of DNMT1 had contradictory effects (Figure 8G). Molecularly, DNMT1 positively promotes DNA methylation of miR‐214 promoter (Figure 8H). These results indicate that DNMT1 regulates the miR‐214/LIVIN pathway through promoting the DNA methylation levels of miR‐214.
Figure 8

DNA methyltransferase DNMT1 regulates the miR‐214/LIVIN pathway through promoting the DNA methylation levels of miR‐214. A, The conservativeness of miR‐214 promoter at 10kb upstream and 10kb downstream. B, ChIP assay showed that the DNA methyltransferase DNMT1 mainly binds in the 5th and 6th amplicon subregions. C, QPCR showed the mRNA levels of miR‐214 and LIVIN while overexpressing and silencing DNMT1. D, Western blotting showed the protein levels of miR‐214 and LIVIN while overexpressing and silencing DNMT1. E, The effect of methylation inhibitor (DC‐517) on the mRNA expression of miR‐214 and LIVIN. F, The effect of methylation inhibitor (DC‐517) on the protein expression of LIVIN. G, The activity of miR‐214‐3’UTR‐luciferace in DNMT1 overexpressed/silence RCC cells. H, DNMT1 positively promotes DNA methylation of miR‐214 promoter. *P < .05, **P < .01, ***P < .001

DNA methyltransferase DNMT1 regulates the miR‐214/LIVIN pathway through promoting the DNA methylation levels of miR‐214. A, The conservativeness of miR‐214 promoter at 10kb upstream and 10kb downstream. B, ChIP assay showed that the DNA methyltransferase DNMT1 mainly binds in the 5th and 6th amplicon subregions. C, QPCR showed the mRNA levels of miR‐214 and LIVIN while overexpressing and silencing DNMT1. D, Western blotting showed the protein levels of miR‐214 and LIVIN while overexpressing and silencing DNMT1. E, The effect of methylation inhibitor (DC‐517) on the mRNA expression of miR‐214 and LIVIN. F, The effect of methylation inhibitor (DC‐517) on the protein expression of LIVIN. G, The activity of miR‐214‐3’UTR‐luciferace in DNMT1 overexpressed/silence RCC cells. H, DNMT1 positively promotes DNA methylation of miR‐214 promoter. *P < .05, **P < .01, ***P < .001

DNMT1, miR‐214 and LIVIN are correlated in RCC patients

Finally, we studied the clinical relevance of DNMT1, miR‐214 and LIVIN and their relationship in clinical RCC patients. As is shown in Figures 9A‐C, the mRNA level of miR‐214 in RCC samples was lower than that of normal tissues, while DNMT1 and LIVIN had opposite results. Next, we analysed the correlation between them and found that there was a negative correlation between DNMT1 and miR‐214 levels (R = −0.5942, P < .0001), a positive correlation between DNMT1 and LIVIN levels (R = 0.4931, P = .0004) and a negative correlation between miR‐214 and LIVIN levels (R = −0.7356, P < .0001) in normal tissues and RCC patients (Figures 9D‐F). In addition, we assessed the protein level of DNMT1, LIVIN and PARP‐1 in clinical patients. The protein expression levels of more than half of the samples were consistent with intracellular (Figures 9G,H).
Figure 9

DNMT1, miR‐214 and LIVIN are correlated in RCC patients. A, The mRNA level of miR‐214, (B) LIVIN and (C) DNMT1 in RCC tissues. D, The correlation between DNMT1 and miR‐214 (R = −0.5942, P < .0001), (E) DNMT1 and LIVIN (R = 0.4931, P = .0004), (F) miR‐214 and LIVIN (R = −0.7356, P < .0001) in RCC tissues and normal tissues. G, Total proteins isolated from normal and RCC tissues were analysed by Western blotting for assessment of DNMT1, LIVIN and PARP‐1. H, Description of clinical samples

DNMT1, miR‐214 and LIVIN are correlated in RCC patients. A, The mRNA level of miR‐214, (B) LIVIN and (C) DNMT1 in RCC tissues. D, The correlation between DNMT1 and miR‐214 (R = −0.5942, P < .0001), (E) DNMT1 and LIVIN (R = 0.4931, P = .0004), (F) miR‐214 and LIVIN (R = −0.7356, P < .0001) in RCC tissues and normal tissues. G, Total proteins isolated from normal and RCC tissues were analysed by Western blotting for assessment of DNMT1, LIVIN and PARP‐1. H, Description of clinical samples

DISCUSSION

LIVIN, otherwise known as KIAP, ML‐IAP and Birc7 protein, is composed of a BIR (Baculoviral IAP Repeat) and a RING finger body structural domain. , , Studies have shown that LIVIN is involved in inhibiting apoptosis, , regulating proliferation and suppressing cell cycle through its distinctive structures. Recently, it has been found that the expression of LIVIN is frequently up‐regulated in human acute lymphoblastic leukaemia, rectal cancer, gastric cancer and lymphoma, , , , which indicates that LIVIN could be a promising biomarker in human cancers. On the other hand, the role of LIVIN in RCC has also been confirmed. Studies have shown that LIVIN efficiently governs the apoptosis, the proliferation, autophagy and drug sensitivity of RCC cells. , , However, at present, evidence of LIVIN as an independent cancer treatment target is always insufficient. In our present study, we took bioinformatics in Targetscan, miRWalk, miRDB and additional databases to explore the microRNA targeting LIVIN. We found that miR‐214 negatively regulated LIVIN. MicroRNAs may be partially or completely complementary to the 3’URT of the target gene mRNA, thereby degrade the target gene mRNA and is involved in the regulation of gene expression. It has been shown that microRNAs are involved in 90% of gene transcription and translation processes, and affecting protein expression and activation of cell signalling pathways. MiR‐214 is a member of the microRNA class. Several studies have shown that miR‐214 is involved in the regulation of various tumours, including liver cancer, breast cancer, colorectal cancer, stomach cancer and prostate cancer. , , , , However, the expression pattern in human RCC has not yet been clarified. In this case, we evaluated the effects of miR‐214 on the proliferation and chemotherapeutic susceptibility of RCC cells and found that up‐regulation of miR‐214 inhibited the cell proliferation but enhanced chemotherapeutic susceptibility of RCC cells, whereas knock down of miR‐214 had opposite effects. Moreover, up‐regulation of LIVIN could effectively rescue the inhibitory effect of overexpressed mir‐214 to cell proliferation, while knock down of LIVIN suppress the facilitation of down‐regulated mir‐214 to the proliferation of RCC cells. It indicates that miR‐214 inhibits the growth of RCC cells through regulating LIVIN. It is a known fact that, the aberrant expression of everyone in tumour tissues is not a shot in the dark. We detected low expression of miR‐214 in RCC tissues at the very beginning. Interestingly, the DNA methyltransferase DNMT1 can enhance DNA methylation of miR‐214, thus inhibiting the expression of mir‐214 and further promoting the expression of LIVIN. However, the effect of methylation inhibitor (DC‐517) on the expression of miR‐214 and LIVIN was opposite with DNMT1. Moreover, there was a direct correlation between DNMT1, miR‐214 and LIVIN in RCC tissues and normal tissues. In conclusion, we have firstly supplied the evidence linking miR‐214 to the proliferation and chemotherapeutic susceptibility of human RCC through regulating LIVIN. And this result might be based on DNA methylation of mir‐214. These findings have provided some basis for further investigation of miR‐214‐mediated signalling pathway and for evaluating the prognostic by analyzing miR‐214 status in patients diagnosed as RCC. However, more profound explorations are necessary in order to clarify the precise mechanisms of miR‐214‐mediated LIVIN down‐regulation in human RCC.

CONFLICT OF INTEREST

None.

AUTHOR CONTRIBUTIONS

XGC, HX and EYH conceived and designed the study. HX, SJW, XS, YY, WJ, QLW, QK, QM, XLL and YL performed experiments. XGC, HX, ZS, DW, PCY and QHZ analysed the data and compiled the figures. XGC, HX and EYH wrote the manuscript. HX, SJW and XS revised the manuscript.
  31 in total

1.  Two splicing variants of a new inhibitor of apoptosis gene with different biological properties and tissue distribution pattern.

Authors:  Y Ashhab; A Alian; A Polliack; A Panet; D Ben Yehuda
Journal:  FEBS Lett       Date:  2001-04-20       Impact factor: 4.124

2.  Livin, a novel inhibitor of apoptosis protein family member.

Authors:  G M Kasof; B C Gomes
Journal:  J Biol Chem       Date:  2000-10-09       Impact factor: 5.157

Review 3.  MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing.

Authors:  Victor Ambros
Journal:  Cell       Date:  2003-06-13       Impact factor: 41.582

4.  Decreased microRNA-214 levels in breast cancer cells coincides with increased cell proliferation, invasion and accumulation of the Polycomb Ezh2 methyltransferase.

Authors:  Assia Derfoul; Aster H Juan; Michael J Difilippantonio; Nallasivam Palanisamy; Thomas Ried; Vittorio Sartorelli
Journal:  Carcinogenesis       Date:  2011-08-08       Impact factor: 4.944

5.  Targeted inhibition of Livin resensitizes renal cancer cells towards apoptosis.

Authors:  I Crnković-Mertens; N Wagener; J Semzow; E F Gröne; A Haferkamp; M Hohenfellner; K Butz; F Hoppe-Seyler
Journal:  Cell Mol Life Sci       Date:  2007-05       Impact factor: 9.261

6.  RISC is a 5' phosphomonoester-producing RNA endonuclease.

Authors:  Javier Martinez; Thomas Tuschl
Journal:  Genes Dev       Date:  2004-04-22       Impact factor: 11.361

7.  Silencing Livin induces apoptotic and autophagic cell death, increasing chemotherapeutic sensitivity to cisplatin of renal carcinoma cells.

Authors:  Zhiyang Wang; Shuai Liu; Kejia Ding; Sentai Ding; Chensheng Li; Jiaju Lu; Dexuan Gao; Tong Zhang; Dongbin Bi
Journal:  Tumour Biol       Date:  2016-09-27

8.  Aberrant methylation of PCDH17 gene in high-grade serous ovarian carcinoma.

Authors:  Ivana Baranova; Helena Kovarikova; Jan Laco; Ondrej Dvorak; Iva Sedlakova; Vladimir Palicka; Marcela Chmelarova
Journal:  Cancer Biomark       Date:  2018       Impact factor: 4.388

9.  Translational regulation of gene expression.

Authors:  Stephanie Kervestin; Nadia Amrani
Journal:  Genome Biol       Date:  2004-11-25       Impact factor: 13.583

10.  TSG101 promotes the proliferation, migration and invasion of hepatocellular carcinoma cells by regulating the PEG10.

Authors:  Zhiyi Liu; Zilu Tian; Kuan Cao; Bin Zhang; Quan Wen; Xinyu Zhou; Weibin Yang; Tao Wang; Hengliang Shi; Renhao Wang
Journal:  J Cell Mol Med       Date:  2018-11-18       Impact factor: 5.310

View more
  6 in total

1.  Methylation and expression levels of microRNA-23b/-24-1/-27b, microRNA-30c-1/-30e, microRNA-301a and let-7g are dysregulated in clear cell renal cell carcinoma.

Authors:  I Gilyazova; E Ivanova; G Gilyazova; I Sultanov; A Izmailov; R Safiullin; V Pavlov; E Khusnutdinova
Journal:  Mol Biol Rep       Date:  2021-07-24       Impact factor: 2.316

Review 2.  The Role of Epigenetics in the Progression of Clear Cell Renal Cell Carcinoma and the Basis for Future Epigenetic Treatments.

Authors:  Javier C Angulo; Claudia Manini; Jose I López; Angel Pueyo; Begoña Colás; Santiago Ropero
Journal:  Cancers (Basel)       Date:  2021-04-25       Impact factor: 6.639

3.  Integrative Analysis of Multi-Omics Identified the Prognostic Biomarkers in Acute Myelogenous Leukemia.

Authors:  Jiafeng Zheng; Tongqiang Zhang; Wei Guo; Caili Zhou; Xiaojian Cui; Long Gao; Chunquan Cai; Yongsheng Xu
Journal:  Front Oncol       Date:  2020-12-10       Impact factor: 6.244

Review 4.  MicroRNA Signature in Renal Cell Carcinoma.

Authors:  Soudeh Ghafouri-Fard; Zeinab Shirvani-Farsani; Wojciech Branicki; Mohammad Taheri
Journal:  Front Oncol       Date:  2020-11-30       Impact factor: 6.244

Review 5.  Microbiomes, Epigenomics, Immune Response, and Splicing Signatures Interplay: Potential Use of Combination of Regulatory Pathways as Targets for Malignant Mesothelioma.

Authors:  Botle Precious Setlai; Zilungile Lynette Mkhize-Kwitshana; Ravi Mehrotra; Thanyani Victor Mulaudzi; Zodwa Dlamini
Journal:  Int J Mol Sci       Date:  2022-08-12       Impact factor: 6.208

6.  Methylation-mediated miR-214 regulates proliferation and drug sensitivity of renal cell carcinoma cells through targeting LIVIN.

Authors:  Hao Xu; Shangjun Wu; Xin Shen; Zhan Shi; Ding Wu; Yuan Yuan; Wei Jiang; Qianliang Wang; Qin Ke; Qing Mao; Xianlong Li; Yong Liu; Pingcheng Yuan; Qinghan Zhang; Enying Huang; Xiaogang Chen
Journal:  J Cell Mol Med       Date:  2020-05-12       Impact factor: 5.310

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.