Literature DB >> 32379754

Bidirectional crosstalk between Hypoxia-Inducible Factor and glucocorticoid signalling in zebrafish larvae.

Davide Marchi1, Kirankumar Santhakumar2, Eleanor Markham1, Nan Li3, Karl-Heinz Storbeck4, Nils Krone3,5, Vincent T Cunliffe1, Fredericus J M van Eeden1.   

Abstract

In the last decades in vitro studies highlighted the potential for crosstalk between Hypoxia-Inducible Factor-(HIF) and glucocorticoid-(GC) signalling pathways. However, how this interplay precisely occurs in vivo is still debated. Here, we use zebrafish larvae (Danio rerio) to elucidate how and to what degree hypoxic signalling affects the endogenous glucocorticoid pathway and vice versa, in vivo. Firstly, our results demonstrate that in the presence of upregulated HIF signalling, both glucocorticoid receptor (Gr) responsiveness and endogenous cortisol levels are repressed in 5 days post fertilisation larvae. In addition, despite HIF activity being low at normoxia, our data show that it already impedes both glucocorticoid activity and levels. Secondly, we further analysed the in vivo contribution of glucocorticoids to HIF activity. Interestingly, our results show that both glucocorticoid receptor (GR) and mineralocorticoid receptor (MR) play a key role in enhancing it. Finally, we found indications that glucocorticoids promote HIF signalling via multiple routes. Cumulatively, our findings allowed us to suggest a model for how this crosstalk occurs in vivo.

Entities:  

Year:  2020        PMID: 32379754      PMCID: PMC7237044          DOI: 10.1371/journal.pgen.1008757

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   5.917


Introduction

Glucocorticoids (GC) constitute a well-characterized class of lipophilic steroid hormones produced by the adrenal glands in humans and by the interrenal tissue in teleosts. The circadian production of glucocorticoids in teleosts is regulated by the hypothalamus-pituitary-interrenal (HPI) axis, which is the equivalent of the mammalian hypothalamus-pituitary-adrenal (HPA) axis. Both are central to stress adaptation [1-4]. Interestingly, both in humans and teleosts cortisol is the primary glucocorticoid and regulates a plethora of physiological processes including glucose homeostasis, inflammation, intermediary metabolism and stress response [5]. In particular, cortisol can exert these functions via direct binding both to the glucocorticoid receptor (Gr) and to the mineralocorticoid receptor (Mr), which bind cortisol with different affinities. [3,6]. Together they act as a transcription factor, which can function either in a genomic or in non-genomic way [5,7-9]. Hypoxia-inducible factor (HIF) transcription factors are key regulators of the cellular response to hypoxia, which coordinate a metabolic shift from aerobic to anaerobic metabolism in the presence of low oxygen availability in order to assure homeostasis [10]. In mammals there are at least three isoforms of HIF-α (HIF-1α, HIF-2α and HIF-3α) and two main isoforms of HIF-1β (ARNT1 and ARNT2). [11]. Interestingly, due to a genome duplication event, there are two paralogs for each of the three Hif-α isoforms (Hif-1αa, Hif-1αb, Hif-2αa, Hif-2αb, Hif-3αa and Hif-3αb) in zebrafish. Among these, Hif-1αb is thought to be the key zebrafish homologue in the hypoxic response [12]. With respect to HIF-1β (ARNT) paralogues, the expression of two genes encoding Arnt1 and Arnt2 proteins has been described in zebrafish [13-16]. Whilst ARNT is constitutively expressed, the cytoplasmic HIF-α subunits are primarily regulated post-translationally via the PHD3-VHL-E3-ubiquitin ligase protein degradation complex. This is believed to occur in order to allow a rapid response to decreasing oxygen levels [12,17-19]. Indeed, hypoxia, is a common pathophysiological condition [20,21] to which cells must promptly respond in order to avert metabolic shutdown and subsequent death [12]. In the presence of normal oxygen levels, a set of prolyl hydroxylases (PHD1, 2 and 3) use the available molecular oxygen directly to hydroxylate HIF-α subunit. Hydroxylated HIF-α is then recognised by the Von Hippel Lindau (VHL) protein, which acts as the substrate recognition part of a E3-ubiquitin ligase complex. This leads to HIF-α proteasomal degradation to avoid HIF pathway activation under normoxic conditions. On the other hand, low O2 levels impair the activity of the PHD enzymes leading to HIF-α stabilisation and subsequent translocation in the nucleus. Here, together with the HIF-β subunit, HIF-α forms a functional transcription complex, which drives the hypoxic response [22]. Although the HIF response is aimed to restore tissue oxygenation and perfusion, it can sometimes be maladaptive and can contribute to a variety of pathological conditions including inflammation, tissue ischemia, stroke and growth of solid tumours [23]. Finally, it is important to note for this study that HIF signalling is able to regulate its own activation via negative feedback, by inducing the expression of PHD genes, in particular prolyl hydroxylase 3 (PHD3) [24,25]. The presence of a crosstalk between glucocorticoids and hypoxia dependent signalling pathways has been reported in several in vitro studies [26-30]. Moreover, synthetic glucocorticoids (ie. betamethasone and dexamethasone), which are analogous to naturally occurring steroid hormones, have been extensively used for decades as anti-inflammatory drugs for treating pathological conditions which are linked to hypoxia (i.e. asthma, rheumatoid arthritis, ischemic injury, etc.) [31-33]. However, due to the presence of adverse effects [34] and glucocorticoid resistance [35,36], their use has been limited. Therefore, extending the research on how precisely this interplay occurs in vivo, may have a wide physiological significance in health and disease. The first evidence of interaction between HIF and GR was provided by Kodama et al. 2003 [26], who discovered that ligand-dependent activation of glucocorticoid receptor enhances hypoxia-dependent gene expression and hypoxia response element (HRE) activity in HeLa cells. Leonard et al. 2005 [27] subsequently revealed that GR is transcriptionally upregulated by hypoxia in human renal proximal tubular epithelial cells. Furthermore, the hypoxic upregulation of GR was confirmed by Zhang et al 2015 [29]. In contrast, a dexamethasone-mediated inhibition of HIF-1α target genes expression in hypoxic HEPG2 cells was demonstrated by Wagner et al. 2008 [28]. In addition to that, they showed retention of HIF-1α in the cytoplasm, suggesting a blockage in nuclear import. Finally, Gaber et al., 2011 [37] indicated the presence of dexamethasone-induced suppression of HIF-1α protein expression, which resulted in reduced HIF-1 target gene expression. From these in vitro results it has become clear that the HIF-GC crosstalk is complex and may depend on cell type. In the present study, we have used the zebrafish (Danio rerio) as an in vivo model organism to study how and to what degree hypoxic signalling affects the endogenous glucocorticoids’ response and vice versa. The use of whole animals allows us to show how these signals interact at a more global level than in cell culture, where interactions between different tissues and cell types are not easily modelled. The zebrafish offers an excellent genetic vertebrate model system for endocrine studies, and similar to humans, they are diurnal and use cortisol as the main glucocorticoid hormone [38]. Importantly, unlike other teleosts, zebrafish have only a single glucocorticoid (zGr) and mineralocorticoid receptor (Mr) (zMr) isoform [3]. Moreover, zGr shares high structural and functional similarities to its human equivalent, making zebrafish a reliable model for studying glucocorticoids activity in vivo [39-41]. Additionally, zebrafish share all the components of the human HIF signalling pathway and it has been proved to be a very informative and genetically tractable organism for studying hypoxia and HIF pathway both in physiological and pathophysiological conditions [12,25,42]. In our previous work, we identified new activators of the HIF pathway, e.g. betamethasone, a synthetic glucocorticoid receptor agonist [43]. Counterintuitively, GR loss of function was shown by Facchinello and colleagues to hamper the transcriptional activity linked to immune-response (i.e of cytokines Il1β, Il8 and Il6 and of the metalloproteinase Mmp-13) [5]. Finally, glucocorticoid receptor has been also found to synergistically activate proinflammatory genes by interacting with other signalling pathways [40,44-46]. In the present study, we utilised both a genetic and pharmacological approach to alter these two pathways during the first 120 hours post fertilisation of zebrafish embryos. In particular, we took advantage of two different mutant lines we have generated (hif1β (arnt1) and gr (nr3c1) respectively), coupled to an already existing vhl;phd3:eGFPi144/i144 hypoxia reporter line [25], to study the effect of HIF activity on GC signalling and vice-versa, via a “gain-of-function/loss-of-function” approach. Phenotypic and molecular analyses of these mutants have been accompanied by optical and fluorescence microscope imaging. Importantly, we not only confirm that betamethasone is able to increase the expression of phd3:eGFP, a marker of HIF activation in our zebrafish HIF-reporter line, but we also show that BME-driven HIF response requires Hif1β/Arnt1 action to occur. Furthermore, our results also demonstrate that both Gr and Mr loss of function are able to partially rescue vhl phenotype, allowing us to confirm the importance of glucocorticoids in assuring high HIF signalling levels. This finding may have wider significance in health and disease, as so far it is proven difficult to downregulate HIF signalling. Our results also demonstrate that in the presence of upregulated HIF pathway (by mutating vhl), both the glucocorticoid receptor activity and the endogenous cortisol levels are repressed in 5 dpf larvae, whereas when the HIF pathway is suppressed (by mutating hif1β) they are significantly increased. Finally, qPCR analysis on GC target genes, in situ hybridisation on the expression of steroidogenic genes and cortisol quantification on the aforementioned mutant lines confirmed our hypothesis. Taken together, these results allow us to deepen the knowledge of how the crosstalk between HIF and glucocorticoid pathway occurs in vivo and to underscore a new model of interaction between these two major signalling pathways.

Results

Generating arnt1 and arnt1;vhl knockout in zebrafish

To study the interplay between HIF and GC signalling in vivo, using a genetic approach, we required a Hif1β/Arnt1 mutant line (in a phd3:eGFP;vhl background) to enable the downregulation of the HIF pathway. Hif-1β (hypoxia-inducible factor 1 beta, Arnt1) is a basic helix-loop-helix-PAS protein which translocates from the cytosol to the nucleus after ligand binding to Hif-α subunits, after the stabilization of the latter in the cytoplasm. It represents the most downstream protein in the HIF pathway and for this reason it is the most suitable target. Using CRISPR/Cas9 mutagenesis we obtained a 7 bp insertion in exon 5 (coding bHLH DNA binding domain (DBD) of the Hif-1β protein; allele name sh544) in vhl heterozygote embryos (). The resulting frameshift mutation was predicted to lead to a premature stop codon at the level of the DNA-binding domain, which would result in a severely truncated protein. The resulting line hif1β;vhl;phd3:eGFP will be called arnt1;vhl, whereas the vhl;phd3:eGFP line will be called vhl hereafter.

arnt1 and arnt2 have partially overlapping functions and synergistically contribute to HIF signalling.

A. Schematic representation of zebrafish hif1β (arnt1) gene. Exons are shown as black boxes, whereas introns as lines. The red arrowhead shows the position of a +7 bp insertion in exon 5 (encoding the bHLH DNA binding domain). In the arnt1 wt and mutant sequence. CRISPR target site: bold. Protospacer-adjacent-motif (PAM) sequence: red. B-B’. Magnified picture of a representative 5 dpf vhl-/- larva compared to 5dpf arnt1-/-;vhl-/- (C-C’). Among the 120 GFP+ embryos derived from arnt1;vhl(phd3:eGFP) x arnt1;vhl(phd3:eGFP), 15 larvae were characterized by the absence of pericardial oedema, no ectopic extra vasculature at the level of the tail, no bright liver and a reduced brightness in the rest of the body (black and white arrowheads). Genotyping post phenotypic analysis on sorted larvae confirmed genotype-phenotype correlation. Fluorescence, exposure = 2 seconds. Scale bar 200 μm. D-G. Representative picture of phenotypic analysis performed on DMSO and BME [30 μM] treated 5 dpf larvae, derived from arnt1;vhl(phd3:eGFP) x arnt1;vhl(phd3:eGFP) (n = 540). All the genotype combinations observed are represented in the figure. Among the 405 GFP+ larvae, all the 25 arnt1;vhl showed the aforementioned partially rescued vhl phenotype (D). Fluorescence, exposure = 2 seconds. Scale bar 500 μm. H-J. Representative pictures of 5 dpf CRISPANT mutants created by redundantly targeting arnt2 gene via co-injection of 4x gRNAs in arnt1;vhl(phd3:eGFP) x arnt1; vhl(phd3:eGFP) derived embryos (n = 300). Uninjected embryos were used as control (n = 120). White asterisks: head, liver and tail ragions. Fluorescence, exposure = 991,4 ms. Scale bar 500 μm. K. Statistical analysis performed on mean grey values quantification (at the level of the head, liver and tail), after phenotypic analysis on 5 dpf arnt2 4x gRNAs injected and uninjected larvae. vhl uninjected n = 8 larvae: head 93.1 ± 2.33 (mean ± s.e.m); liver 99.65 ± 3.49 (mean ± s.e.m); tail 29.58 ± 0.73 (mean ± s.e.m). arnt1;vhl uninjected n = 10 larvae: head 56.49 ± 3.36 (mean ± s.e.m); liver 24,7 ± 2.36 (mean ± s.e.m); tail 12.39 ± 0,75 (mean ± s.e.m). vhl injected n = 12 larvae: head 43.69 ± 3.25 (mean ± s.e.m); liver 45.54 ± 4.57 (mean ± s.e.m); tail 16.09 ± 1.37 (mean ± s.e.m). arnt1;vhl injected n = 11 larvae: head 24.66 ± 1.63 (mean ± s.e.m); liver 13.88 ± 0.66 (mean ± s.e.m); tail 5.16 ± 0.33 (mean ± s.e.m). Ordinary One-way ANOVA followed by Sidak’s multiple comparison test (*P < 0.05; **P < 0.01; ***P <0.001; ****P < 0.0001). Initial analysis performed on arnt1;vhl incross-derived 5 dpf larvae (F1 generation) confirmed the suppressive effect that arnt1 mutation was expected to have on vhl mutants. Overall, arnt1;vhl larvae showed a substantially attenuated vhl phenotype, characterized by a reduced phd3:eGFP related brightness, especially in the liver (’), with the absence of pericardial edema, excessive caudal vasculature and normal yolk usage () compared to vhl-/- larvae (). In particular, this was quantified as a 39% downregulation (P<0.0017) at the level of the head, a 75% downregulation (P<0.0001) in liver and a 58% downregulation (P<0.0001) in the rest of the body (from the anus to the caudal peduncle), in terms of phd3:eGFP-related brightness, compared to vhl-/- larvae (Figs ’, ). Furthermore, since homozygous vhl mutants are lethal by 8-10dpf [47], we analysed the efficacy of arnt1 mutation in rescuing vhl phenotype. To this end, we attempted to raise arnt1;vhl after day 5 post fertilization. Notably, double mutants were able to survive beyond 15 dpf, but failed to grow and thrive when compared to their wild-type siblings, which led us to euthanise them due to health concerns at 26 dpf (. Of note, arnt1 homozygotes, in a vhl/+ or wt background, were morphologically indistinct and adults were viable and fertile. In contrast, the previously published arnt2 zebrafish larvae were embryonic lethal around 216 hpf [14].

Arnt1 and Arnt2 are mutually required for HIF signalling in zebrafish

As arnt1;vhl double mutants still activate the phd3:eGFP HIF reporter, we examined the importance of Arnt2 isoform in the HIF pathway. Phenotypic analysis was carried out on 5 dpf Arnt2 CRISPANTs, created both in a vhl and arnt1;vhl background, according to the protocol of Wu et al., 2018 [48]. By analysing the expression of the phd3:eGFP transgene, we observed that arnt2 CRISPR injected vhl mutants were characterized by a significant downregulation of phd3:eGFP-related brightness at the level of the head (equals to 53%, P<0.0001), in the liver (equals to 54%, P<0.0001) and in the rest of the body (equals to 46%, P<0.0001), compared to uninjected vhl mutant larvae (. Furthermore, when both arnt1 and arnt2 isoforms were simultaneously knocked-out (), the downregulation was even stronger at the level of the head (equals to 74%, P<0.0001), the liver (equals to 86%, P<0.0001) and in the rest of the body (equals to 83%, P<0.0001) (). Of note, phd3:eGFP-related brightness in these mutants was still slightly higher than wildtype, (not shown; these levels are undetectable). Overall, these data show that Arnt1, even if not fundamental for survival, is the main isoform in the zebrafish liver required for HIF signalling, whereas Arnt2 is more expressed in the developing central nervous system (CNS), as reported by Hill et., al 2009. Of note, since both isoforms can form a functional complex with Hif-α isoforms and appear to function in the same organs, this allows us to confirm that they have partially overlapping functions in vivo and to show that they synergistically contribute to the HIF response.

Modulation of HIF signalling affects GR signalling

To investigate the interaction between HIF and glucocorticoid signalling, we quantified the expression of four potential glucocorticoid target genes from mammalian studies (fkbp5, il6st, pck1 and lipca) both in a HIF upregulated (vhl), and downregulated scenario (arnt1) via RTqPCR analysis on 5 dpf larvae. We confirmed that in zebrafish larvae, fkbp5 is the most sensitive and well-established readout of Gr activity [5,49,50], whilst the other aforementioned genes do not directly take part in the GC-GR negative feedback loop. Therefore, we focused this analysis on fkbp5. Interestingly, our analysis shows that the expression of fkbp5 is downregulated (fold change = 0.1; P = 0.0035) in the presence of an upregulated HIF pathway (vhl) compared to DMSO treated vhl siblings (). Vice versa, when the HIF pathway is suppressed (arnt1), fkbp5 expression is upregulated (fold change = 24.1; P<0.0001), compared to DMSO treated wild-type levels ().

HIF signalling inversely correlate with GC transcriptional activity and cortisol biosynthesis.

A. Schematic view of RTqPCR analysis on fkbp5 expression performed on the vhl(phd3:eGFP) and the arnt1(phd3:eGFP) mutant lines at 5 dpf:. Upregulated (in vhl) HIF signalling repressed Gr activity, whereas arnt1 loss of function derepressed it. Statistical analysis was performed on ΔΔCt values, whereas data are shown as fold change values for RTqPCR analysed samples; ordinary Two-way ANOVA followed by Dunnett’s multiple comparison test (*P < 0.05; **P < 0.01; ***P <0.001; ****P < 0.0001). B-C’. Representative pictures of WISH performed on DMSO and BME [30 μM] treated arnt1 mutant line, at 5 dpf, using pomca as probe. arnt1 wt DMSO treated (n = 30/30 larvae) showed normal pomca expression; arnt1 wt BME treated (n = 29/30 larvae) showed downregulated pomca expression. In contrast, arnt1-/- DMSO treated (n = 28/30) and arnt1-/- BME treated (n = 30/30) larvae showed downregulated pomca expression. Chi-square test (****P < 0.0001). Scale bar 50 μm. D-E’. Representative pictures of WISH performed on DMSO and BME [30 μM] treated vhl mutant line, at 5 dpf, using pomca as probe. DMSO treated vhl siblings (n = 26/28) showed normal pomca expression; BME treated vhl siblings (n = 28/30) showed downregulated pomca expression. In contrast, vhl-/- DMSO (n = 28/29) and BME (n = 28/28) treated larvae showed downregulated pomca expression. Chi-square test (****P < 0.0001). Scale bar 50 μm. F-F’. Steroid quantification results showed a significantly reduced cortisol concentration (P value <0;0028) in vhl mutants (92.7 fg/larva, in triplicate), compared to vhl siblings (321 fg/larva, in triplicate) at 5 dpf (F). Moreover, a significantly increased cortisol concentration (P value <0;0001) was measured in arnt1 mutants (487.5 fg/larva, in triplicate), compared to arnt1 wild-types (325 fg/larva, in triplicate) at 5 dpf (F’); unpaired t-test (**P < 0.01; ***P <0.001). G. DMSO: Speculative scheme of how the putative HIF-GC crosstalk occurs in wildtypes and how it is affected both in arnt1 and in vhl larvae at 5 dpf. In wildtype scenario HIF signalling helps the GC-GR negative feedback to protect the body from an uncontrolled stress response. In particular, we speculate that HIF transcriptional activity is able to inhibit pomca expression when cortisol levels arise over a certain threshold in order to maintain both HIF and GC basal levels. However, in arnt1 scenario, the HIF-mediated negative feedback is compromised by the lack of a functional Arnt1. This triggers an initial uncontrolled pomca expression, which increases cortisol levels and subsequently downregulate pomca expression itself. Vice versa, in vhl scenario, the HIF-mediated negative feedback can exert a stronger inhibition of pomca due to the presence of upregulated HIF signalling. This results both in downregulated cortisol levels and in a suppressed GR responsiveness. However, the presence of alternative mechanisms cannot be completely excluded (i.e HIF might interact more directly with GC/GR to impair its function). Finally, the combination high cortisol/low pomca is very rare and this combination may change over the course of development. G. BME: Speculative scheme of how the putative HIF-GC crosstalk occurs in wildtypes and how it is affected both in arnt1 and in vhl larvae at 5 dpf, after BME[30μM] treatment. In all the cases, because of betamethasone acts downstream of the HPI axis, by binding directly to Gr, it is able to upregulate glucocorticoid target genes expression. Consequently, since GC are able to stimulate HIF signalling, as expected, we observed an increase phd3:eGFP-related brightness both in wildtypes and in vhl. However, the fact that we did not observed any HIF upregulation both in arnt1 and in arnt1;vhl, highlighted the fact that the BME-induced HIF signalling activation is an Arnt1 dependent mechanism. To further examine the effect of HIF signalling on glucocorticoid responsiveness, we also performed betamethasone (BME) treatment [30 μM] on the aforementioned mutant lines, followed by RTqPCR analysis. Of note, BME was able to increase fkbp5 expression in vhl siblings and was only able to mildly do that in vhl mutants. Indeed, its induction levels appeared not only lower in BME treated vhl mutants (fold change = 2.1) than in BME treated siblings (fold change = 7, P = 0.0286), but also its expression was not significantly different from DMSO treated wild-types (). In contrast, when the HIF pathway was suppressed (arnt1), BME treatment was able to further upregulate the expression of fkbp5 (fold change = 107,5; P = 0.0031), compared to DMSO treated arnt1 mutants (). Collectively, we speculate that the upregulated HIF levels are able to repress the glucocorticoid receptor activity and can blunt its responsiveness to an exogenous GR agonist (BME treatment). On the other hand, importantly, although HIF activity is expected to be low in wild-type larvae in a normoxic environment, its function is also detectable with respect to suppression of GR activity. Indeed, if arnt1 gene is knocked-out (arnt1-/-) an increased GR sensitivity is observed (). To further test whether this had repercussions on steroidogenesis and/or cortisol levels, we analysed them both in a HIF upregulated (vhl) and downregulated scenario (arnt1).

HIF signalling acts as negative regulator of steroidogenesis

To investigate the relationship between HIF signalling and steroidogenesis, we initially performed in situ hybridization on larvae obtained from the arnt1 mutant line, using both pro-opiomelanocortin (pomca) and Cytochrome P450 family 17 polypeptide 2 (cyp17a2) as probes. Expression of pomca, at the level of the anterior part of the pituitary gland, is a well-established readout of GR function in zebrafish larvae. Pomca is negatively regulated by increased blood cortisol levels via GC-GR signalling, as part of the HPI axis feedback loop [4,51]. Previous work also suggested that HIF promotes POMC activity in the mouse hypothalamic region [52]. On the other hand, Cyp17a2 is an enzyme involved in steroid hormone biosynthesis at the level of the interrenal gland, which is activated upon ACTH stimulation [53-55]. We found that 5 dpf arnt1 larvae, which were characterized by an upregulated GC responsiveness, showed upregulated cyp17a2 expression () coupled to downregulated pomca (). As expected, arnt1 siblings showed normally expressed cyp17a2 ( and pomca (), which were observed to be downregulated only as a consequence of BME treatment (). Therefore, we speculate that in the absence of arnt1 (HIF suppressed scenario), pomca downregulation is most likely to occur as a consequence of GC-GR induced negative feedback loop, triggered by putative high cortisol levels (). We subsequently examined both pomca and cyp17a2 expression in the opposite -HIF upregulated- scenario, by performing WISH analysis on the vhl mutant line. Interestingly, 5 dpf vhl-/- larvae, which were characterized by a downregulated GR activity, displayed downregulated cyp17a2 expression (), coupled to downregulated pomca expression (). On the other hand, vhl siblings showed normally expressed pomca (), which was observed to be downregulated after BME treatment, as expected (). Consequently, we speculate that in the absence of vhl (HIF upregulated scenario), pomca downregulation is most likely to occur as a consequence of HIF-mediated downregulation of pomca expression. (). Cumulatively, if this is true, we predicted to observe reduced levels of endogenous cortisol in vhl-/- larvae and normal or even increased levels in arnt1 larvae at 5 dpf.

Steroidogenesis is repressed in vhl-/- and derepressed in arnt1-/-

To confirm this hypothesis, we performed cortisol quantification on the aforementioned vhl and arnt1 mutant lines. Interestingly, cortisol concentration was significantly reduced (P value <0.0028) in vhl mutant larvae (92,7 fg/larva), compared to vhl siblings (321 fg/larva) (). Conversely, cortisol was significantly increased (P value <0.0001) in arnt1 mutants (487.5 fg/larva), compared to arnt1 siblings (325 fg/larva) (). Taken together, these data confirmed our hypothesis and showed for the first time that HIF signalling can act as negative regulator both of GR transcriptional activity and of steroidogenesis. Indeed, if only GR transcriptional activity was blocked by HIF, cortisol levels would be expected to be high in vhl mutants. This is because by blocking GR (i.e as occurs in gr), the GC-GR mediated negative feedback cannot occur, making larvae hypercortisolemic [3,5]. Interestingly, since vhl larvae are characterized both by downregulated cortisol levels and GR transcriptional activity, this strongly suggests that HIF signalling can act both at the hypothalamic level (to inhibit pomca expression) and intracellularly to block GR transcriptional activity itself.

Generating gr and gr;vhl knockout in zebrafish

Conversely, to investigate the role of glucocorticoids on the HIF response, we created a novel glucocorticoid receptor (gr, nr3c1) mutant line and we crossed it with the vhl;phd3:eGFP hypoxia reporter line (this line will be called gr;vhl hereafter). We created this line because the existing gr allele may still have some activity via non-genomic pathways or tethering, promoting HIF activation upon GC treatment [4,43,51]. Of note, gr mutants are hypercortisolemic [3,5]. This is due to the inability of glucocorticoids to bind to a functional receptor (GR). As a result, they fail to provide negative feedback and are not able to shut down GC biosynthesis [3,5]. We generated an 11 bp deletion at the level of gr exon 3, which is predicted to truncate the DNA binding domain, lacks the C-terminal ligand binding domain and is predicted to be a true null (. The homozygous gr/nr3c1 mutants, characterized during the first 5dpf, were morphologically similar to control siblings and adult fish were viable and fertile, as predicted [5].

gr mutation partially rescues vhl phenotype.

A. Schematic representation of zebrafish gr (nr3c1) gene. Exons are shown as boxes, introns as lines. The red arrowhead shows the position of a -11 bp deletion in exon 3 (encoding the DNA binding domain). gr wt and mutant sequence. CRISPR target site: bold. PAM sequence: red. B-C’. Representative pictures of WISH performed on DMSO and BME [30 μM] treated gr mutant line, at 5 dpf, using pomca as probe. Scale bar 100 μm. gr siblings DMSO treated (n = 30/30 larvae) showed normal expression; gr siblings (n = 29/30 larvae) showed downregulated pomca expression after BME treatment. Both DMSO treated (n = 30/30) and BME treated (n = 30/30) gr larvae showed upregulated pomca expression. D. RTqPCR analysis performed on gr wt (n = 10; 3 repeats) and gr-/- (n = 10; 3 repeats) larvae at 5 dpf, using fkbp5 as probe. Statistical analysis was performed on ΔΔCt values, whereas data are shown as fold change values. Ordinary Two-way ANOVA followed by Dunnett’s multiple comparison test (****P < 0.0001). E-G. Magnified picture of representative gr; vhl larvae compared to arnt1;vhl and vhl larvae. Both double mutants are characterized by the absence of pericardial oedema, no ectopic extra vasculature at the level of the tail, no bright liver and a reduced brightness in the rest of the body (white and black arrowheads), compared to vhl larvae. Fluorescence, exposure = 2 seconds. Scale bar 200 μm. H. RTqPCR analysis performed both on HIF and GC target genes expression carried out on gr; vhl and sibling at 5 dpf, (n = 10 larvae, per group, in triplicate) compared to arnt1;vhl larvae and siblings, at 5dpd (n = 10 larvae, per group, in triplicate). Both vegfab and egln3 are HIF target genes, whereas fkbp5 is a GC target gene. Statistical analysis was performed on ΔΔCt values, whereas data are shown as fold change values, Ordinary Two-way ANOVA followed by Dunnett’s multiple comparison test. I-L. Representative picture of phenotypic analysis performed on DMSO and BME [30 μM] treated gr; vhl(phd3:eGFP) incross-derived 5 dpf larvae (n = 600). All the genotype combinations observed are represented in the figure. Among the 450 GFP+ larvae analysed, 28 showed a partially rescued vhl phenotype which resembled the arnt1’s one. Three experimental repeats. In all panels: *P < 0.05; **P < 0.01; ***P <0.001; ****P < 0.0001. Fluorescence, exposure = 2 seconds. Scale bar 500 μm. To confirm loss-of-function, we initially subjected larvae to a visual background adaptation (VBA) test, as it is linked to impaired glucocorticoid biosynthesis and action [4,56]. Larvae derived from gr incross were VBA tested and sorted according to melanophore size at 5 dpf. PCR-based genotyping on negative VBA-response sorted samples revealed that most larvae were homozygous for the gr allele, whereas positive VBA-response samples were always gr siblings. Furthermore, WISH analysis performed on 5 dpf DMSO and BME treated gr incross derived larvae using pomca as probe, showed the presence of upregulated pomca expression in DMSO treated gr-/- at the level of the anterior part of the pituitary gland (), compared to wild-type siblings (). Of note, BME treatment was not able to downregulate pomca levels in gr(), as it occurs in BME treated siblings ( via GC-GR mediated negative feedback loop, due to the absence of a functional gr allele. Finally, the loss of function was also determined in 5 dpf gr mutants by the strong downregulation of fkbp5 mRNA levels quantified via RTqPCR, both in the presence (fold change = 0.01; P<0.0001) and in the absence of BME treatment (DMSO treated, fold change = 0.01; P<0.0001), compared to DMSO treated wildtypes ().

gr mutation partially rescues vhl phenotype

We next analyzed the effect of gr loss of function on vhl phenotype. Phenotypic analysis carried out on 5dpf larvae, derived from gr;vhl incross, revealed that nr3c1 mutation was able to cause an efficient, but not complete rescue of vhl phenotype, in a way which resembled arnt1 mutation (). In particular, 5dpf gr;vhl larvae showed a 43% downregulation at the level of the head (P<0.0001), a 66% downregulation in the liver (P<0.0001) and a 51% downregulation in the tail (from the anus to the caudal peduncle) (P = 0.0020), in terms of phd3:eGFP-related brightness, compared to vhl-/- larvae (Figs ). As expected, 5 dpf double mutant larvae were unable to respond to BME [30 μM] treatment (Figs , as also confirmed via RTqPCR analysis on HIF (vegfab and egln3) and GC target genes (fkbp5) (). Rescue was also apparent by morphology. Indeed, even if gr;vhl showed reduced yolk usage, they displayed a reduction in ectopic vessel formation at the level of the dorsal tailfin, no pericardial edema, and developed air-filled swim bladders (. Moreover, whilst vhl mutants are inevitably deceased by 10 dpf [47], we were able to raise all selected double mutants beyond 15 dpf, but then (similarly to arnt1;vhl) they failed to grow and thrive when compared to their siblings. This led us to euthanise them due to health concerns at 21 dpf (). Together, these data indicate for the first time, in our in vivo animal model, that GR function is essential for HIF signalling in zebrafish larvae, particularly at the level of the head and the liver.

gr loss of function can further reduce HIF signaling in arnt1;vhl double mutants

The similarity of gr and arnt1 mutations could mean they work in a single linear “pathway”. If true, mutation of both genes should not lead to a further attenuation of the reporter expression. To test this, we bred the gr mutant line with the arnt1;vhl double mutant line and we crossed gr;arnt1;vhl triple carriers. Phenotypic analysis carried out on 5 dpf phd3:eGFP positive larvae (n = 488) showed a small class of larvae with an even more rescued phenotype and a stronger downregulation of phd3:eGFP related brightness compared both to arnt1;vhl () and gr;vhl double mutants (). Of note, 7 putative very weak GFP+ larvae were selected and genotypic analysis confirmed that 5 out of 7 were indeed gr-/-; arnt1;vhl. In particular, these triple mutants showed a 54% downregulation at the level of the head, a 71% downregulation in the liver and a 72% downregulation in the tail region, in terms of phd3:eGFP-related brightness compared to vhl (Figs ). Thus, these data suggest that glucocorticoids are likely to act on both Arnt1 and Arnt2 mediated HIF signalling pathway.

gr loss of function effect is stronger when HIF-signalling is moderately upregulated.

A-E. Representative picture of the main differences between vhl, arnt1;vhl, gr;vhl and triple gr;arnt1;vhl larvae at 5 dpf. Among the 488 phd3:eGFP expressing larvae analysed, 7 larvae were characterized by the absence of pericardial oedema (black arrowheads, left), no ectopic extra vasculature at the level of the tail (black arrowheads, right), no visible phd3:eGFP HIF reporter in the liver (white arrowheads, left) and even more reduced levels of this marker in the head and in the rest of the body (white arrowheads, right). Genotypic analysis allowed to confirm the presence of a genotype-phenotype correlation in 5 out 7 samples and to prove that they were triple mutants. Fluorescence, exposure = 2 seconds. Scale bar 200 μm. F-I. Representative pictures of WISH performed on gr; vhl incross derived larvae, at 5 dpf, using pomca as probe. Of note, gr;vhl showed upregulated pomca expression (20/20 larvae), as observed in gr (20/20 larvae); vhl mutants showed downregulated pomca expression (20/20 larvae), whereas wildtypes showed normal pomca expression (19/20). Chi-square test (****P < 0.0001). Scale bar 50 μm.

The BME-induced HIF response is Arnt1 dependent

To further examine the effect of glucocorticoids on HIF signalling, we performed BME [30 μM] treatment on all the available mutant lines. Of note, unlike cortisol, betamethasone has a very high affinity for Gr, but an insignificant affinity for Mr [57,58]. As expected, 5 dpf wild-types larvae showed a mild upregulation of phd3:eGFP-related brightness at the hepatic level, compared to untreated controls (Figs . BME treatment was also able to further increase phd3:eGFP-related brightness at the level of the head and the liver of 5 dpf vhl, as also confirmed by WISH, using both lactate dehydrogenase A (ldha) () and prolyl hydroxylase 3 (phd3) as probes (). As predicted, both gr and gr;vhl mutants were unaffected due to the absence of functional Gr (). Interestingly, in both the arnt1( and also arnt1;vhl ( the phd3:eGFP-related brightness did not change after BME treatment (). This was also confirmed via, RTqPCR analysis carried out on HIF target gene egln3/phd3 in the arnt1 mutant ( see also arnt1;vhl )

BME treatment is able to upregulate HIF signalling in vhl.

A-B’. Representative pictures of WISH performed on DMSO (A-B) and BME [30 μM] (A’-B’) treated vhl incross derived larvae, at 5 dpf, using ldha as probe. DMSO treated vhl siblings showed basal ldha expression (34/35 larvae), which showed to be upregulated after BME treatment (33/35 larvae). On the other hand, DMSO treated vhl showed upregulated ldha expression (32/35 larvae), which was further upregulated after BME treatment (34/35 larvae). (black arrowhead: head and liver) Chi-square test (****P < 0.0001). Scale bar 200 μm. C-D’. Representative pictures of WISH performed on DMSO (C-D) and BME [30 μM] (C’-D’) treated vhl incross derived larvae, at 5 dpf, using phd3 (egln3) as probe. As expected, vhl siblings DMSO treated (n = 30/30 larvae) showed basal phd3 expression, which was mildly increased after BME treatment (n = 27/30 larvae). Vhl DMSO treated (n = 28/30 larvae) showed upregulated phd3 expression, which was further increased after BME treatment (n = 26/30 larvae). (black arrowhead: head and liver) Chi-square test (****P < 0.0001). Scale bar 200 μm. Taken together these data suggest that in vhl larvae, BME treatment can upregulate HIF signalling by “bypassing” HIF-mediated pomca negative regulation. By directly binding to Gr, it can compensate for the repressed cortisol levels in vhl mutants. (). On the other hand, both in arnt1 and also arnt1;vhl larvae, even if BME can act downstream of pomca, it can only upregulate GR responsiveness, but cannot upregulate HIF signalling due to arnt1 loss of function. Cumulatively, we speculate that even if Arnt2 can interact with the HIF-α isoforms to maintain a moderately upregulated HIF levels (arnt1;vhl), the BME-mediated HIF upregulation is Arnt1 dependent.

gr mutation overrides HIF-mediated pomca suppression in a vhl deficient background

To examine the effect of gr loss of function on steroidogenesis in gr;vhl, we performed WISH analysis on 5 dpf gr;vhl incross derived larvae, using pomca as probe. As expected, vhl showed downregulated pomca expression (), whereas gr displayed upregulated pomca (), compared to wildtypes (). Notably, since a strong upregulation of pro-opiomelanocortin a was observed in the double mutants (), this suggests that gr mutation overrides HIF-mediated pomca inhibition. PCR-analysis performed post-WISH confirmed this genotype-phenotype correlation. These data, in accordance with our hypothesis, suggest that in gr;vhl mutants the upregulation of pomca, triggered by the absence of functional Gr (and of the GC-Gr mediated negative feedback), cannot be inhibited with the same efficiency by HIF activity at the hypothalamic level. In gr;vhl mutants, we speculate that the upregulated endogenous cortisol interacts with Mr to stimulate the HIF pathway, resulting in a mildly upregulated phd3:EGFP expression, in-between the levels seen in vhl mutants and wild-type larvae (. To test this assumption, we set up to block the mr gene in a gr;vhl background, in order to check the importance of Mr in the HIF signaling pathway.

Both Gr and Mr are directly required in the HIF signalling pathway

Cortisol has high affinity both for Gr and Mr and they have been recently shown to be differentially involved in the regulation of stress axis activation and function in zebrafish [3]. Therefore, we analysed the role of Mr on the HIF signaling pathway. To achieve this, we knocked-out mr in gr;vhl;phd3:eGFP incross-derived embryos, using CRISPant technology [48,59]. Interestingly, phenotypic analysis performed on 5 dpf injected and uninjected larvae revealed that mr CRISPR injected vhl mutants were characterized by a significant downregulation of phd3:eGFP-related brightness at the level of the head (equals to 49%, P<0.0001), in the liver (equals to 56%, P<0.0001) and in the rest of the body (equals to 47%, P<0.0001), compared to vhl mutant uninjected larvae (). Moreover, when both gr and mr were knocked-out, the downregulation was even stronger at the level of the head (equals to 62%, P<0.0001), in the liver (equals to 77%, P<0.0001) and in the rest of the body (equals to 63%, P<0.0001) compared to vhl mutant uninjected larvae (). Of note, mr injection in vhl-/- larvae was more efficient in downregulation of phd3:eGFP expression compared to uninjected gr;vhl larvae at the level of the head (equals to 31%, P = 0.0087) ().

Both Gr and Mr are directly required in the HIF signalling pathway.

A-F. Representative pictures of 5 dpf CRISPANT mutants created by redundantly targeting nr3c2 (mr) gene via co-injection of 4x gRNAs in gr;vhl(phd3:eGFP) x gr; vhl(phd3:eGFP) derived embryos (n = 344). Uninjected embryos were used as control (n = 170). Fluorescence, exposure = 991,4 ms. Scale bar 500 μm. G. Statistical analysis performed on mean grey value quantification (at the level of the head, liver and tail), after phenotypic analysis, on 5 dpf mr 4x gRNAs injected and uninjected larvae. vhl uninjected n = 17 larvae: head 48.28 ± 2.99 (mean ± s.e.m); liver 46.47 ± 3.55 (mean ± s.e.m); tail 16.15 ± 1.06 (mean ± s.e.m). gr;vhl uninjected n = 8 larvae: head 35.48 ± 2.03 (mean ± s.e.m); liver 23.56 ± 1.72 (mean ± s.e.m); tail 10.98 ± 0.75 (mean ± s.e.m). vhl injected n = 15 larvae: head 24.62 ± 0.97 (mean ± s.e.m); liver 20.67 ± 1.1 (mean ± s.e.m); tail 8.57 ± 0.39 (mean ± s.e.m). gr;vhl injected n = 16 larvae: head 18.33 ± 0.46 (mean ± s.e.m); liver 10.71 ± 0.56 (mean ± s.e.m); tail 6.07 ± 0.26 (mean ± s.e.m); ordinary One-way ANOVA followed by Sidak’s multiple comparison test. To test the reliability of CRISPant method, we chose to knock-out a gene (which was not involved in the HIF pathway) into vhl incross derived embryos, to test whether it was able to affect HIF signalling. Laminin, beta 1b (lamb1b), which codes for an extracellular matrix glycoprotein, was injected as CRISPR-injection control in vhl+/-incross derived embryos at 1 cell stage. Genotypic analysis carried out on these larvae confirmed that these guides were effective. Finally, quantification of phd3:eGFP-related brightness performed on 5 dpf injected and uninjected vhl larvae, showed no significant differences between the two groups (). Overall, these data corroborated the efficiency of the CRISPant method and, at the same time, confirmed that both glucocorticoid and mineralocorticoid receptor play a pivotal role in the HIF signalling in vivo.

Discussion

Both HIF and glucocorticoid mediated transcriptional responses play a pivotal role in tissue homeostasis, glucose metabolism and in the regulation of cellular responses to various forms of stress and inflammation [60-62]. Previous in vitro studies highlighted the potential for crosstalk between HIF and glucocorticoid pathways, however there are still conflicting data on how this interaction occurs in vivo and there is no information on Mr contribution to HIF signalling. In this regard, we have presented a novel in vivo study using zebrafish larvae, focusing on the crosstalk between these two pathways. In contrast to in vitro cell culture studies, a whole animal study allows us to consider the interactions that occur between various tissues and provide novel insights. To this end, we generated arnt1 and gr null mutants to downregulate HIF and GR signalling respectively, as a basis for a genetic analysis of this crosstalk. As a prelude to this, we had to establish the relative importance of arnt1 and arnt2 in the overall HIF response. To achieve this, a discriminative test was devised to place them in a vhl mutant background, where HIF signaling is strongly upregulated [25,42]. Phenotypic analysis performed on 5 dpf arnt1;vhl larvae showed reduced phd3:eGFP related brightness, normal yolk usage, properly developed and air-filled swim bladder as well as by the absence of pericardial oedema and excessive caudal vasculature. However, beyond 5 days, these double mutants exhibited only partial recovery from the vhl phenotype. Indeed, they developed well till 15 dpf, but subsequently failed to grow and thrive when compared to their siblings. In addition, arnt1 homozygous mutants were found to be viable and fertile, in contrast to both homozygous vhl and arnt2 mutants, which are embryonic lethal by 8–10 dpf [14,47]. Even though Arnt1 is not fundamental for survival, we found that it is required in the liver and in organs outside the central nervous system for HIF−α function. Conversely, using CRISPant technology [48,59], we established that Arnt2 is mainly required in the developing central nervous system (CNS), as also reported by Hill et al. in 2009 [14]. However, the similarities observed in terms of phd3:eGFP-induced brightness in both arnt1;vhl and arnt2 CRISPR injected vhl mutants, suggest there is no strong functional separation. Therefore, both Arnt2 and Arnt1 have partially overlapping functions in vivo and both contribute to the HIF response.

The effect of HIF signalling on the glucocorticoid pathway

We next investigated the effect of HIF signalling and glucocorticoid responsiveness, by performing RTqPCR analysis on 5 dpf larvae. Collectively, we show that strong activation of HIF signalling (in vhl) is able to blunt glucocorticoid receptor transcriptional regulation as judged by fkbp5 expression, whereas arnt1 loss of function derepressed it. As our experiments are done at normal atmospheric oxygen levels, we conclude from the latter result that normoxic HIF activity nevertheless suffices to attenuate GR transcriptional regulation. We checked whether HIF signalling affects steroidogenesis. To this end, we quantified the expression of steroidogenesis-related genes (pomca and cyp17a2) both in vhl and in arnt1 larvae, via whole-mount in situ hybridization. Surprisingly, both lines showed downregulation of pomca expression. However, arnt1 larvae showed upregulated cyp17a2 expression, whereas vhl larvae, were characterized by downregulated cyp17a2. Considering our results with GR-target fkbp5 in these mutants, we assume that in an arnt1 knock-out scenario, pomca downregulation occurs as a consequence of the GC/GR-mediated negative feedback loop aimed to control cortisol biosynthesis. This is also consistent with a significant upregulated basal cortisol levels quantified in these mutants. Vice versa, when HIF signalling is upregulated (in vhl mutants) we speculate that pomca and cyp17a2 downregulation may occur via HIF-mediated activity, leading to the observed low cortisol levels coupled to suppressed GR activity. Indeed, glucocorticoids regulate a plethora of physiological processes, act on nearly every tissue and organ in the body to maintain homeostasis and are characterized by a potent anti-inflammatory and immunosuppressive actions. For these reasons, their secretion must be finely controlled by the HPA/I axis [63]. As previous work in our laboratory showed that glucocorticoids also act as HIF activators [25,43], we infer that HIF can in turn control GC levels by acting on pomca. This would enable HIF signalling not only to control its own levels, but also to assure homeostasis. Finally, since HIF signalling is a master regulator of cellular pro-inflammatory responses to hypoxia [64-66], which would counteract the anti-inflammatory glucocorticoid activity, we speculate that the simultaneous expression of both upregulated HIF and GC pathway would be detrimental to homeostasis. Our data would also be in accordance with a previous study showing that hypoxia exposure resulted in downregulation of steroidogenic genes (StAR, cyp11c1, hmgcr, hsd17b2, cyp19a, cyp19b) in 72 hpf larvae, whereas zHIF-α loss of function triggered the upregulation specifically of StAR, cyp11b2 and cyp17a1 [67]. Cumulatively, if this is true, we predicted to observe reduced levels of endogenous glucocorticoids in vhl-/- and normal or even increased levels in arnt1. Importantly, the fact that cortisol levels were lowered in vhl mutants and were upregulated in arnt1 mutants is consistent with our hypothesis. As a consequence of the above considerations, the HIF-mediated pomca negative regulation seems to be a logic homeostatic interaction: Increased HIF reduces GR activity, which in turn should lead to less HIF signalling.

The effect of glucocorticoids on the HIF signaling pathway

To further investigate the role of glucocorticoids on the HIF signalling, we initially analyzed the effect of gr loss of function on vhl phenotype. Surprisingly, we observed that gr mutation was able to cause an efficient, but not complete rescue of the vhl phenotype. Notably, gr;vhl survived much longer than vhl (> = 21 dpf compared to max. 10 dpf), but then similar to arnt1;vhl, they failed to grow and thrive when compared to siblings. Our previous work [43] established that activation of GR signalling negatively regulates VHL protein in human liver cells. Our current genetic analysis shows that in zebrafish larvae, there must be an additional point of interaction between these two pathways, as we observed further activation of our HIF reporter after GC treatment even in the absence of VHL. Cumulatively, we showed for the first time in an in vivo animal model that Gr is fundamental to allow high HIF signalling levels. We next analysed the effect of betamethasone treatment in arnt1. Although BME activated the GR target fkbp5, as expected, it failed to activate HIF signaling [43]. This was unexpected and would be best explained by assuming that a Gr-BME complex would preferentially interact with a HIFα/ARNT1 complex but not a HIFα/ARNT2 complex. Whether this holds up in mammalian cells would be interesting to address.

Evaluation of mineralocorticoid receptor contribution to HIF signalling

Recent work published by Faught and Vijayan, 2018 showed that both Gr and Mr are involved in the regulation of zebrafish stress axis activation and function [3]. Nothing is known about mineralocorticoid receptor contribution to HIF signalling. Therefore, we tested the effect of mr knock-out in gr;vhl;phd3:eGFP incrossed derived embryos. Interestingly, in mr injected- vhl we observed a significant reduction of phd3:eGFP-related brightness, compared to uninjected vhl larvae. Moreover, a further reduction of phd3:eGFP expression was found at the level of the head in mr injected- vhl compared to gr;vhl larvae. Finally, the additional removal of mr in a gr;vhl background reduced the hypoxia reporter expression even further. Therefore, we were able to show that both the glucocorticoid receptor and mineralocorticoid receptor play a pivotal role in promoting HIF signaling in zebrafish. In contrast to mammals, teleosts lack aldosterone and cortisol is the primary glucocorticoid hormone that can interact both with Gr and Mr to assure a correct HPI axis activity [68,69]. Of note, Mr was shown to not have a role in rapid non-genomic behaviors that required HPI axis signaling in zebrafish [70]. However, our hypothesis is consistent with Faught and Vijayan, 2018 elegant work, showing that both Gr and Mr signalling are involved in the GC negative feedback regulation. Importantly, this outcome may have a wider significance in health and disease. This is because so far, HIF signalling, which plays a key role in tumour growth, is proven difficult to downregulate. In this regard, our study suggests that modulation of Gr and Mr might be a potential avenue. In conclusion, although Mr contribution to HIF response in other organisms remains unclear, our work suggests that research into its function is warranted.

Conclusion

Our present study stresses the importance of the glucocorticoid pathway in driving HIF signalling. In addition, we uncovered a negative regulatory role played by HIF in regulating both GR responsiveness and steroidogenesis as demonstrated via RTqPCR and steroid hormone quantification. We also identified a mineralocorticoid receptor contribution to HIF-GC crosstalk. Finally, we presented novel gr;vhl, arnt1;vhl and arnt1;gr;vhl+/- zebrafish mutant lines which helped to better understand how the interplay between HIF and glucocorticoids occurs in vivo. For these reasons, we believe that this work could pave the way for further in vivo analysis to precisely identify the extensive crosstalk behind these two major signalling pathways.

Materials and methods

Ethics statement

Zebrafish (Danio rerio) lines were raised and maintained under standard conditions (14 hours of light and 10 hours of dark cycle, at 28°C) in the Aquaria facility of the University of Sheffield. Zebrafish embryos used for experiments were reared in E3 medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM MgCl2, 0.33 mM CaCl2, pH 7.2) with or without methylene blue (Sigma-Aldrich) and staged according to standard methods [71] for up to 5,2 days post fertilisation (dpf) in accordance with UK Home Office legislation. Our studies conform with the UK Home Office guidelines (ASPA), Licence No. PC9C3D4CB and PB2866ED0. Ethics approval was obtained from the University of Sheffield Ethics committee AWERB.

Zebrafish strains

The following zebrafish lines were used: wild-type (wt) strain AB (ZDB-GENO-960809-7), vhlhu2117/+;phd3:eGFPi144/i144 (ZDB-GENO-090611-18), hif1β; hif1β;vhl, gr, gr;vhl, gr;hif1β; and gr;hif1β;vhl lines were generally maintained in a phd3:eGFP background. The following 4x gRNAs CRISPR-injected G0 null mutant lines were created according to Wu et al, 2018 [48] protocol and raised up to to 5,2 dpf: mr;gr;vhl;phd3:eGFP, hif1β2;1hif1β;vhl;phd3:eGFP and lamb1b;vhl;phd3:eGFP.

Generation of gr (nr3c1) and hif1β (arnt1) null zebrafish lines

Both nr3c1 mutant line (gr) and arnt1 mutant line (hif1β) were generated using the CRISPR/Cas9-based mutagenesis method. A gene-specific guide RNA (sgRNA) sequence was identified using the CHOPCHOP website [72,73]. To design both gr and arnt1 sgRNA, an 18 nucleotides sequence upstream to a selected PAM site (gr: CCAGCTGACGATGTGGCAG; hif1β: TCGGTGCTGGTGTTTCCAG) was inserted into a scaffold sequence [74], containing a promoter for the T7 Polymerase. The sgRNA was amplified via PCR, purified from agarose gel and in vitro transcribed using MEGAshortscript T7 kit (Ambion). 1 nl of CRISPR mixture containing 2,4 μg/μl of gRNA and 0.5 μl Cas9 protein (NEB) was injected in one-cell stage embryos and raised for 24 hours. Wild-type (wt), strain AB embryos were used to generate the gr mutant line, whereas vhl;phd3:eGFP incross-derived embryos were used to create the hif1β mutant line. Efficiency was verified via whole-embryo PCR-based genotyping, by a diagnostic restriction digest. Injected embryos were raised to adulthood. Embryos collected from transmitting G0 founders crossed with WT(AB) fish were raised and genotyped to confirm germline transmission of the mutation (F1 generation). Heterozygous mutants, carrying the same mutation, were selected and crossed to obtain homozygous mutant embryos (F2 generation).

Generation of CRISPR/Cas9-mediated mutants (CRISPANTs)

To generate G0 knockout embryos we used the method developed by Burger et al 2016 [59] and improved by Wu et al., 2018 [48]. In short, a pool of four guide-RNAs (25μM each, Sigma Aldrich) were co-injected with 0.5 μl Cas9 protein (NEB, M0386, 20μM), diluted 1:10) and 1 μl tracrRNA (100μM) in one-cell stage embryos. This method was used to create G0 CRISPANTs for the following genes of interest: mineralocorticoid receptor (mr, nr3c2), aryl hydrocarbon receptor nuclear translocator 2 (arnt2, hif1β2) and laminin, beta 1b (lamb1b). The latter was used as CRISPR-injection control. The gRNA target sequences used in this study are as follows: arnt2: gRNA1-ACGGCGCCTACAAACCCTCC (exon 5), gRNA2-GGCCGATGGCTTCTTGTTCG (exon6), gRNA3-TTCACGCCACAATTCGGATG (exon11), gRNA4-GTCGCAGGTGCGTAAAAACA (exon 14); nr3c2: gRNA1-GCATTGTGGGGTCACCTCCA (exon 2), gRNA2-AAGGGGATTAAACAGGAAAC (exon 2), gRNA3-CAACCAGCTCGCCGGAAAAC (exon 5), gRNA4-ATATCTGACGCCGTCCGTCT (exon 5); lamb1b gRNA1-TTGTTAATAGCATAGTACATTGG (sequence upstream 5’UTR), gRNA2-GGAGAACAAGCAAAACGATGAGG (ATG), gRNA3- GCGTGGTGCAGGGTTTGTAG (5’UTR), gRNA4- TCACAATGACATGTGTGCG (exon 2). The success of the injection was determined via phenotypic analysis, followed by quantification of phd3:eGFP related brightness and whole-embryo PCR-based genotyping performed on a fraction of injected embryos at 5 dpf.

Whole-mount in situ hybridisation

Whole-mount in situ hybridization (WISH) was performed according to standard protocols [75]. The following antisense RNA probes were used: proopiomelanocortin a (pomca) created as previously described [76]; Cytochrome P450 family 17 polypeptide 2 (cyp17a2), created as previously described [55], both prolyl hydroxylase 3 (phd3; BC066699), and lactate dehydrogenase A (ldha1; BC067188) probes, generated as previously described [25,47].

Embryos harvesting, drug treatment and fixation for WISH

Embryos intended for whole-mount in situ hybridisation were treated with 16,8 μl of 1-phenyl 2-thiourea (PTU, stock concentration 75mg/ml) diluted into 35 ml E3 medium to inhibit melanogenesis, according to Karlsson et al., 2001 [77]. GR agonist treatment was performed on batches of 15 embryos each, at 4 dpf, treated in 6-well plates, with 30 μM Betamethasone 17,21-dipropanoate (BME) and with 1% DMSO (Sigma-Aldrich), as control, for 24 hours [4]. Inside the 6-well plates, embryos were incubated in 3 ml total volume of E3 medium, without methylene blue. Afterwards, up to 30 embryos at 5 dpf were collected in 1,5 ml Eppendorf tubes and anaesthetized using Tricaine Solution (MS-222, Sigma Aldrich) prior to fixation in 1 ml 4% PFA solution overnight, at 4°C. Embryos were then washed twice for 10 minutes in PBST and post-fixed in 1 ml 100% MeOH. Finally, samples were stored at -20°C.

gr mutants sorting by visual background adaptation (VBA)

Visual background adaptation (VBA) is a glucocorticoid receptor-dependent neuroendocrine response which causes zebrafish melanocytes to shrink when exposed to bright illumination [78,79]. To identify gr mutants from siblings and to confirm the absence of a functional VBA response, 5dpf larvae were exposed to 30 minutes darkness and then transferred onto a white background under bright, whole-field illumination, using a 30W fluorescent lamp mounted 50 cm above the dish [80,81].

Cortisol extraction and quantification

Three biological replicates of 150 larvae at 5 dpf each of hif1β mutants, hif1β siblings, vhl mutants and vhl siblings, respectively, were used for steroid hormone extraction and quantification. vhl larvae were sorted among siblings at 4 dpf according to both their phenotype and phd3:eGFP-related brightness. Because of the lack of visible phenotype, arnt1 larvae where derived from arnt1 fish incrossed, whereas siblings were from arnt1 fish crossed with arnt1 ones. Cortisol quantification was carried out according to the protocol published by Eachus et al., 2017 [55], based on the use of an Acquity UPLC System (Waters, Milford, CT) coupled to a Xevo TQ-S tandem mass spectrometer (Waters).

RNA isolation, cDNA synthesis and qPCR analysis

Transcript abundance of target genes was measured by quantitative real-time PCR (RTqPCR). Three biological replicates of 10 larvae at 4 dpf each, were treated for 24 hours with 30 μM Betamethasone 17,21-dipropanoate and with 1% DMSO, used as control, prior to RNA isolation. Total RNA was extracted from pools of 10 larvae at 5dpf with TRIzol reagent (Invitrogen by Thermo Fisher Scientific, 15596026). RNA extracted was quantified using a Nanodrop ND-1000 spectrophotometer. cDNA was then synthesized from 1μg RNA template through reverse transcription using Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs), as recommended by manufacturer’s instructions. All RTqPCR reactions were performed in triplicate using TaqMan probes in combination with CFX96 Touch Real-Time PCR Detection System (BioRad), paired with CFX Maestro Analysis Software. Each reaction mixture (20 μl) reaction mixture containing 1 μl cDNA template (100ng/ml), 1 μl FAM probe and 10 μl TaqMan Universal Master Mix (Applied biosystems by Thermo Fisher Scientific, Epsom, UK) was amplified as follows: denaturation at 95°C for 10 minutes and 39 cycles at 95°C for15 seconds, 60°C for 30 seconds. Four hypoxia-inducible factor dependent genes (egln3: Dr03095294_m1, pfkfb3: Dr03133482_m1, vegfab: Dr03072613_m1 and slc2a1a: Dr03103605_m1) and four glucocorticoid dependent genes (fkbp5: Dr03114487_m1, il6st: Dr03431389_m1, pck1: Dr03152525_m1 and lipca: Dr03113728_m1) were quantified in the present study (Applied biosystems by Thermo Fisher Scientific, Epsom, UK). Expression levels for each gene were normalized to eef1a1 (Dr03432748_m1) and/or rps29 (Dr03152131_m1) and fold change values were generated relative to wild-type DMSO treated control levels, according to ΔΔCT method [82]. All data were expressed as fold change mean ± s.e.m and P ≤ 0.05 was considered statistically significant.

Quantifying phd3:eGFP-related brightness

Images were acquired using Leica Application Suite version 4.9, which allowed the capture both of bright-field and GFP fluorescent images. To quantify the phd3:eGFP-related brightness of live embryos derived from each incrossed mutant line used in this project, Fiji (Image J) software v.2.0.0 was used. Images were converted into a grey scale 8-bit format and subsequently analysed by the software, by summing the grey values of all the pixels in the selected area, divided by the number of pixels. By default, since values equal to 0 are assigned to black and values equal to 255 to white, the quantified mean grey values are proportional to the intensity of the eGFP-related brightness expressed in the embryos. In particular, head, liver and tail (from the anus to the caudal peduncle) related brightness were selected and measured in all the mutant lines used in this study (). Genotyping post phenotypic analysis on phd3:eGFP sorted larvae confirmed the genotype-phenotype correlation.

Statistical analysis

GraphPad Prism version 8.0 for MacOS (GraphPad Software, La Jolla, California, USA, www.graphpad.com) was used to perform statistical analysis on all the samples analysed. Unpaired t tests were used to test for significant differences between two sample groups (i.e cortisol quantification). One-way ANOVA was used for assessing mean grey values data quantification, whereas two-way ANOVA was used to evaluate qPCR data. As post-hoc correction tests, Sidak’s method for multiple comparisons was used on normally distributed populations following one-way ANOVA, while Dunnett’s correction was used for comparing every mean to a control mean, on normally distributed populations following two-way ANOVA.

arnt1; vhl larvae showed a reduced phd3:eGFP brightness and a partially rescued vhl phenotype.

A. Statistical analysis performed on mean gray value quantification (at the level of the head, liver and tail), after phenotypic analysis on 5dpf DMSO and BME [30μM] treated arnt1;vhl(phd3:eGFP) x arnt1; vhl(phd3:eGFP) derived larvae (n = 540). vhl DMSO treated n = 17 larvae: head 166.67 ± 9.63 (mean ± s.e.m); liver 138.61 ± 12.05 (mean ± s.e.m); tail 50.31 ± 4.51 (mean ± s.e.m). arnt1;vhl DMSO treated n = 13 larvae: head 121.05 ± 6.99 (mean ± s.e.m); liver 49.61 ± 3.88 (mean ± s.e.m); tail 21.75 ± 1.12 (mean ± s.e.m). vhl BME treated n = 18 larvae: head 199.88 ± 7.71 (mean ± s.e.m); liver 222.57 ± 8.72 (mean ± s.e.m); tail 57.57 ± 4.11 (mean ± s.e.m). arnt1;vhl BME treated n = 12 larvae: head 153.71 ± 8.66 (mean ± s.e.m); liver 62.58 ± 5.16 (mean ± s.e.m); tail 25.82 ± 1.54 (mean ± s.e.m). Ordinary One-way ANOVA followed by Sidak’s multiple comparison test (*P < 0.05; **P < 0.01; ***P <0.001; ****P < 0.0001). B. Kaplan-Meier survival curves of the zebrafish arnt1; vhl(phd3:eGFP) genotype analysed in this study. Time is shown in days. Siblings n = 30; arnt1; vhl(phd3:eGFP) n = 8. The Log-rank (Mantel-Cox) test was used for statistical analysis. arnt1; vhl(phd3:eGFP) vs. siblings: **P < 0.0027. C. RTqPCR analysis performed on arnt1 siblings (n = 10; 3 repeats) and arnt1-/- (n = 10; 3 repeats) larvae at 5 dpf, using egln3 as probe. Statistical analysis was performed on ΔΔCt values, whereas data are shown as fold change values. Ordinary Two-way ANOVA followed by Dunnett’s multiple comparison test (***P <0.001;****P < 0.0001). D. Representative picture of head, liver and tail areas selected in each larva to quantify the phd3:eGFP-related brightness via mean grey value quantification (Fiji, ImageJ software). (TIF) Click here for additional data file.

GC target genes expression in the presence of high, moderately upregulated and suppressed HIF signalling pathway.

Schematic view of RTqPCR analysis on il6st, pck1 and lipca (GC target genes) expression performed on the following mutant lines: vhl(phd3:eGFP), arnt1;vhl(phd3:eGFP) and arnt1(phd3:eGFP). Statistical analysis performed on ΔΔCt values; data are shown as fold change values for RTqPCR analysed samples; ordinary Two-way ANOVA followed by Dunnett’s multiple comparison test (*P < 0.05; **P < 0.01; ***P <0.001; ****P < 0.0001). (TIF) Click here for additional data file.

gr; vhl larvae showed a reduced phd3:eGFP brightness and a partially rescued Vhl phenotype.

A-D’. Representative pictures of WISH performed on DMSO and BME [30 μM] treated arnt1 mutant line, at 5 dpf, using cyp17a2 as probe. A-A’) arnt1 wt DMSO treated larvae (n = 26/28) showed normal cyp17a2 expression, whereas 2/28 larvae showed a weaker one; B-B’) arnt1 wt BME treated larvae (n = 28/30) showed downregulated cyp17a2 expression, whereas 2/30 larvae showed a normal one. C-C’) In contrast, arnt1-/- DMSO treated larvae (n = 24/28) showed upregulated cyp17a2 expression, whereas 4/28 larvae showed a weaker one. D-D’) arnt1-/- BME treated larvae (n = 25/29) showed downregulated cyp17a2 expression, whereas 4/29, showed a normal one. Chi-square test (****P < 0.0001). Scale bar 200 μm. E-H’. Representative pictures of WISH performed on DMSO and BME [30 μM] treated vhl mutant line, at 5 dpf, using cyp17a2 as probe. E-E’) DMSO treated vhl siblings (n = 18/21) showed normal cyp17a2 expression, whereas 3/21 larvae showed a weaker one; F-F’) BME treated vhl siblings (n = 28/30) showed downregulated cyp17a2 expression, whereas 2/30 larvae showed a normal one. G-G’) On the other hand, vhl-/- DMSO treated larvae (n = 27/28) showed weak cyp17a2 expression, whereas 1/28 larvae showed a normal one. H-H’) vhl-/- BME treated larvae (n = 30/30) showed downregulated cyp17a2 expression. Chi-square test (****P < 0.0001). Scale bar 200 μm. I-I’. Representative picture of the colour threshold area calculation method (ImageJ software’s tool) used to quantify the area occupied by the cyp17a2 WISH staining both in arnt1 siblings (n = 9) and arnt1-/- (n = 9). I’. unpaired t-test (****P <0.0001). (TIF) Click here for additional data file.

gr; vhl larvae showed a reduced phd3:eGFP brightness and a partially rescued vhl phenotype.

A. Statistical analysis performed on mean gray value quantification (at the level of the head, liver and tail), after phenotypic analysis on 5dpf DMSO and BME [30μM] treated gr;vhl(phd3:eGFP) x gr; vhl(phd3:eGFP) derived larvae (n = 600). vhl DMSO treated n = 9 larvae: head 186 ± 15.12 (mean ± s.e.m); liver 177.01 ± 20.85 (mean ± s.e.m); tail 62.34 ± 7.27 (mean ± s.e.m). gr;vhl DMSO treated n = 7 larvae: head 106.96 ± 3.21 (mean ± s.e.m); liver 60.75 ± 2.56 (mean ± s.e.m); tail 30.67 ± 1.27 (mean ± s.e.m). vhl BME treated n = 14 larvae: head 224.32 ± 6.83 (mean ± s.e.m); liver 244.07 ± 5.31 (mean ± s.e.m); tail 80.51 ± 5.49 (mean ± s.e.m). gr;vhl BME treated n = 9 larvae: head 125.85 ± 3.6 (mean ± s.e.m); liver 63.56 ± 2.91 (mean ± s.e.m); tail 33.67 ± 1.02 (mean ± s.e.m). Ordinary One-way ANOVA followed by Sidak’s multiple comparison test (*P < 0.05; **P < 0.01; ***P <0.001; ****P < 0.0001). B. Kaplan-Meier survival curves of the zebrafish gr; vhl(phd3:eGFP) genotype analysed in this study. Time is shown in days. Wild-types n = 20; gr; vhl n = 20; gr; vhl(phd3:eGFP) n = 5. The Log-rank (Mantel-Cox) test was used for statistical analysis. gr; vhl(phd3:eGFP) vs. gr; vhl, ****P < 0.0001; gr; vhl(phd3:eGFP) vs. wt, ****P < 0.0001. (TIF) Click here for additional data file.

gr;arnt1;vhl showed an even more reduced phd3:eGFP brightness.

Statistical analysis performed on mean gray values quantification (at the level of the head, liver and tail), after phenotypic analysis on 5dpf gr;arnt1vhl(phd3:eGFP) incross-derived GFP+ larvae (n = 488). vhl n = 5 larvae: head 125.82 ± 13.05 (mean ± s.e.m); liver 98.52 ± 3.8 (mean ± s.e.m); tail 37.43 ± 2.45 (mean ± s.e.m). gr;arnt1;vhl n = 5 larvae: head 40.24 ± 2.46 (mean ± s.e.m); liver 26.07 ± 1.31 (mean ± s.e.m); tail 11.22 ± 0.47 (mean ± s.e.m); unpaired t-test (***P = 0.0002; ****P < 0.0001). (TIF) Click here for additional data file.

CRISPR/Cas9 injection per se does not affect HIF signalling.

A-D. Representative pictures of 5 dpf CRISPANT mutants created by redundantly targeting lamb1b gene via co-injection of 4x gRNAs in vhl(phd3:eGFP) incross-derived embryos (n = 400). Uninjected embryos were used as control (n = 470). Fluorescence, exposure = 991,4 ms. Scale bar 500 μm. E. Statistical analysis performed on mean grey values quantification (at the level of the head, liver and tail), after phenotypic analysis on 5 dpf lamb1b 4x gRNAs injected and uninjected vhl(phd3:eGFP) incross-derived larvae. vhl uninjected n = 24 larvae: head 54.83 ± 3.68 (mean ± s.e.m); liver 77.86 ± 6.46 (mean ± s.e.m); tail 19.56 ± 1.43 (mean ± s.e.m). vhl injected n = 25 larvae: head 59.74 ± 4.05 (mean ± s.e.m); liver 83.23 ± 5.92 (mean ± s.e.m); tail 19.9 ± 1.38 (mean ± s.e.m); unpaired t-test (all panels: *P < 0.05; **P < 0.01; ***P <0.001; ****P < 0.0001). (TIF) Click here for additional data file. 9 Dec 2019 Dear Dr Marchi, Thank you very much for submitting your Research Article entitled 'Bidirectional crosstalk between Hypoxia-Inducible Factor and glucocorticoid signalling in zebrafish larvae.' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review again a much-revised version. We cannot, of course, promise publication at that time. Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see our guidelines. Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions. Yours sincerely, Daniel A. Gorelick, Ph.D. Guest Editor PLOS Genetics Gregory P. Copenhaver Editor-in-Chief PLOS Genetics The reviewers were enthusiastic about the interesting results presented in your manuscript, showing that HIF signaling regulates responses to glucocorticoids. However, all reviewers were concerned about the readability and organization of the manuscript, making it difficult to appreciate the high quality results. A revised manuscript should pay particular attention to improving the organization and the writing to maximize clarity, in addition to addressing the specific reviewer comments below. Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: See attachment Reviewer #2: The manuscript by Marchi et al, “Bidirectional crosstalk between Hypoxia-Inducible Factor and glucocorticoid signaling in zebrafish larvae” provides new information about the crosstalk of hypoxia and glucocorticoid signaling in vivo. In addition to the scientific conclusions presented, the authors have produced another GR (nr3c1) mutant allele (currently 9 listed on zfin.org) and a new HIF1B (arnt) mutant (5 listed on ZFIN). Many of the nr3c1 alleles are similar to the new allele, but potentially published after initiation of this work. The arnt alleles represent mass deposited alleles from Sanger or the NIH, which likely were not studied, and are therefore not certain loss of function or nulls. My primary concern is that the organization and presentation of the data in the current version of this manuscript is cumbersome. The figures have multiple panels that when printed are not legible as the fonts are far too small. In some cases they are even hard to see on my monitor zoomed to greater than 200%. This made the key elements of this paper difficult to readily grasp. However, the key findings are important. With a significant overhaul of presentation, including perhaps rethinking figure organization would greatly improve both the impact and reach of the science presented by the authors. Below I have listed some additional major/minor concerns. Other Major concerns: QRT data shows mixed results (by gene target) which are not brought into the model or discussion. Why is BME, a GR agonist not able to increase expression of GR target genes? For some of these targets the mutant background appears to change basal expression levels and the BME still increases expression but not to the same degree as in wild type. Is the ratio of the increase from baseline to BME rates similar? This is difficult to see in figures. Figure 2F and genotyping of mutants. The methods do not detail how mutants were genotyped. To do the cortisol assays in 2F the genotype of the larvae would have to be known prior to collection as a group for the ELISA. How was this done, is this indeed basal cortisol or acute stress, etc. (Minor) why is this expressed per 150 embryos on the y-axis? Figure 3B image is poor, data is not new per se so could be mentioned (not shown) or moved to supplemental to make room for key novel data. Fig 3B’ these images do not readily demonstrate changes in expression. Loss of MR in crispant appears to more severely impact HIF-reporter line than GR. How well do the guides target MR in Crispants (no molecular data is shown for Crispant efficiency)? How does the model reflect or change with the possibility that MR is potentially a major mediator of HIF:GC interactions, rather than GR? This is a really interesting observation that would be better studied in a MR mutant background however, I do not think that is a reasonable ask your manuscript has provided a lot of great data. However, discussing this outcome and possible meaning for future research is necessary. Minor comments: The authors use a HIF-reporter line, eGFP driven by the phd3 promoter, and a previously published Von Hippel Lindau (VHL) mutant that increases HIF function and activates EGFP in the HIF-reporter line. When scoring GFP changes they quantify within the head, liver, and tail. A single image showing how these regions were scored would be helpful. In both Figure 1 and Figure 2 the gene map is presented in reverse (as if looking at a whole genome map). However, there is no reason not to orient the single genes from 5’ to 3’ in these figures. For Figure 2 the arrow that indicates the mutation site is pointing at exon 4 and not exon 3. There could be more subpanel designators in figures. For example, Figure 1 has insets without designators, and this makes it more difficult to find what the author is referencing in the text. There are some locations in the text and figures (including supplemental) that use hif1ßsh544, arnt1sh544 and at least one artn1sh544. In Figure 2A and FigS2 the Y-axes range is large due to BME treatment and thus it becomes difficult to see physiological response in the absence of GR agonist. In situ hybridization is difficult to get quantitative data from, though qualitatively as shown it is observed to be higher or lower expression. Could QRT of the same target genes (pomc and cyp17a2) provide better quantification? Figure 3C. No direct comparison to vhl-/-, which is in other locations, but comparing GFP that is not side by side is not always easy. Overall, I’m wondering if GFP quantification data should be primary and images backing that up (sometimes in supplemental). Would this help create room in figures to help with legible presentation? Figure 4. Were all images taken then genotyped? Seems that levels of GFP would be difficult to simply sort and verify. These details are not in methods. Figure 6. MR was shown to not have a role in rapid non-genomic behaviors that required HPA axis signaling in zebrafish (Lee et al, Genes Brain Behavior 2018). This is contrary to Faught & Vijayan manuscript published at the same time and referenced herein. The clarity of the paper will depend on clear definitions and use of terms. For example, GC response can be a lot of things, but I think in the discussion model it refers to GR transcriptional regulation. Suppressed HIF/upregulated HIF is generally tied to the HIF-reporter, so again is a transcriptional activity. In the models in Fig 2, there is no “cortisol” step as in the discussion model, so GC response could mean cortisol release there and maybe does? This should be clear and word choice around glucocorticoids (e.g. cortisol) and GR and GR transcriptional activity should be clear. The final model should be worked up a little bit to not only show what you think is happening but perhaps point to supporting data in figures (again figures need better subpanels to make that easier). The study uses Betamethasone, a glucocorticoid receptor (GR) agonist that has been used clinically for decades and your group recently (2017) showed can activate HIF. Although this GR agonist primarily interacts with GR there is some minimal crosstalk with mineralocorticoid receptor (MR), but this small crosstalk may have biological relevance. Reviewer #3: This manuscript looks at the interaction between glucocorticoids and the HIF pathway. It generates and employs some useful genetic mutants and presents an important addition to the growing field of integration of different stress pathways on physiology. At times it is rather convoluted and complicated, and lacks clear logical explanations at parts. If the authors can present the conclusions in a clearer model, the paper would be much improved. The authors use the term “attenuated” to describe the partially elevated HIF signaling in the vhl;arnt1 double mutants, which is a little confusing as it is only attenuated with respect to vhl single mutants and not with respect to the WT groundstate. I know what the authors mean, but I suggest they replace this throughout with the term “moderately upregulated” or similar for clarity. For the statement that “In contrast, when the HIF pathway was suppressed (arnt1-/-), BME was able to further upregulate mainly the expression of fkbp5” the authors need to show the fold upregulation and associated ANOVA Post-test comparing the upregulation of fkbp5, il6st and pck1 in the arnt1 mutants with and without BME treatment as well as with sibs treated with BME. Figure 2B’ is confusing as it implies mutation of arnt1 inhibits suppression of Hif. This pathway needs to be presented in a more standard manner ie Hif--| GC-->GR--| pomca Similarly the Figure 2C' complicates matters. I appreciate that in the case of increased Hif signalling, a different mechanism is being employed but this seems to contradict Fig2B’. Could the two be combined into one clear model? Upregulation of cyp17a2 in arnt1 mutants is claimed, but not decisively shown. The insitu image does not convincingly demonstrate upregulation Figure 3C’ is too small. I cannot see it properly but it appears that arnt1-/-;vhl-/- double mutants have more egln3, and vegfab than the vhl-/- mutants alone. Is that correct on the graph? That seems odd and contrary to my understanding of the hif pathway logic. The CRISPANT approach was developed by Burger et al 2016, not Wu et al 2018. The former should be cited rather than the latter. Given that the authors have previously shown that GR activates the Hif pathway by degrading VHL (Vettori et al 2017), how do they explain the rescue of vhl mutants by GR mutation, which should be hypostatic to vhl. “Consequently, we speculate that in an arnt1 knock-out scenario, pomca downregulation occurs as a consequence of glucocorticoid induced negative feedback loop (aimed to shutdown cortisol biosynthesis). In contrast, as upregulated HIF levels appear to repress pomca expression, we speculate that this occurs in a way that resembles the GR-mediated negative feedback loop.” – I cannot make sense of this statement and needs to be written with much more clarity. The latter sentence invokes the same feedback loop as for arnt1 knockout. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Karl J. Clark Reviewer #3: No Submitted filename: review.docx Click here for additional data file. 10 Feb 2020 Submitted filename: Response to reviwers_DMFvE_07-02-2020.docx Click here for additional data file. 20 Mar 2020 * Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. * Dear Dr Marchi, Thank you very much for submitting your Research Article entitled 'Bidirectional crosstalk between Hypoxia-Inducible Factor and glucocorticoid signalling in zebrafish larvae.' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some aspects of the manuscript that should be improved. We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer. In addition we ask that you: 1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. 2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images. We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] Please let us know if you have any questions while making these revisions. Yours sincerely, Daniel A. Gorelick, Ph.D. Guest Editor PLOS Genetics Gregory P. Copenhaver Editor-in-Chief PLOS Genetics Thank you for responding to the reviewer's comments. The revised manuscript is substantially improved. We feel that the revised manuscript is potentially suitable for publication, pending your response to the reviewer's comments. Please pay particular attention to comments regarding Figure 2, in which there are different results in the revised manuscript versus the original submission. We look forward to seeing a revised version of your manuscript. Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: The authors have addressed most of the issues that I raised and have significantly improved the manuscript. However, I still have a few concerns, which mainly concern the data presented in Figure 2, the description of these results and the part of the Discussion that deals with these results. Most importantly, I think the authors should be more careful with their interpretation of the data, which is at times speculative. - To my big surprise, the data in Fig.2A’ are different from the results that were originally presented for this experiment. Why were these data substituted? And why were the data from the double mutant removed? - The authors use the qPCR data to prove that HIF signaling induces a glucocorticoid-resistant state. However, I do not think these data are entirely convincing, because the glucocorticoid response in the siblings is highly variable, as well as the basal expression levels in the mutant (why for example the fold change upon BME treatment in the (allegedly glucocorticoid resistant) vhl mutant is higher than in wild type). The authors should at least be more careful with statements about the glucocorticoid resistant state since it is solely based on these data. - In Fig.2G, the arrow from low pomca to high cortisol in the arnt1 mutant is still difficult to explain, although the increased GC/GR response could play a role, as the authors suggest. They should be a bit more carefl here as well, and at least make clear that the combination high cortisol/low pomca is very rare and difficult to explain (and that this combination may change over the course of development). - The altered response to BME should be incorporated in the top panel of Fig.2G, by drawing a direct arrow from HIF to GC/GR response (with BME next to that arrow). Now it looks like the increased response to BME is a result of HIF acting through pomca and cortisol. - Minor points: - Page 6, line 18: Hif-1β is not a nuclear receptor. - Page 7, line 5: please mention that the levels are still higher than the wild type, and preferably also why these levels are not shown in Fig.1K (I assume because they are undetectable?). - In the figures, sometime controls are labeled ‘sibs’ and sometimes ‘wt’. If there is no particular reason for this difference, please make it consistent. Reviewer #2: The revised manuscript by March et al has been vastly improved by the responses of the authors to the reviewers. There remain some minor typos. Example from abstract "...both the glucocorticoid receptor (Gr) responsiveness and the endogenous cortisol..." could be "...both glucocorticoid receptor (Gr) responsiveness and endogenous cortisol...". Also, in reference to Gr and Mr the authors state "Together they act as a transcription factor, which can function in either a genomic or in non-genomic way". This is confusing because in their role as a transcription factor that is by definition a genomic response by changing transcription. However both, particularly GR, are likely involved in other cell signaling that does not involve it's conventional role as a transcription factor and this is referred to as non-genomic. Overall, this paper which by its very nature can be complicated is vastly improved. Thank you for your efforts. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Karl J. Clark 31 Mar 2020 Submitted filename: Response to reviwers_DMFvE_22-03-2020.docx Click here for additional data file. 3 Apr 2020 Dear Dr Marchi, We are pleased to inform you that your manuscript entitled "Bidirectional crosstalk between Hypoxia-Inducible Factor and glucocorticoid signalling in zebrafish larvae." has been editorially accepted for publication in PLOS Genetics. Congratulations! Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional accept, but your manuscript will not be scheduled for publication until the required changes have been made. Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org. In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. If you have a press-related query, or would like to know about one way to make your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics! Yours sincerely, Daniel A. Gorelick, Ph.D. Guest Editor PLOS Genetics Gregory P. Copenhaver Editor-in-Chief PLOS Genetics www.plosgenetics.org Twitter: @PLOSGenetics ---------------------------------------------------- Comments from the reviewers (if applicable): ---------------------------------------------------- Data Deposition If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website. The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-19-01743R2 More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support. Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present. ---------------------------------------------------- Press Queries If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org. 29 Apr 2020 PGENETICS-D-19-01743R2 Bidirectional crosstalk between Hypoxia-Inducible Factor and glucocorticoid signalling in zebrafish larvae Dear Dr Marchi, We are pleased to inform you that your manuscript entitled "Bidirectional crosstalk between Hypoxia-Inducible Factor and glucocorticoid signalling in zebrafish larvae" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards, Matt Lyles PLOS Genetics On behalf of: The PLOS Genetics Team Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom plosgenetics@plos.org | +44 (0) 1223-442823 plosgenetics.org | Twitter: @PLOSGenetics
  80 in total

Review 1.  HIF transcription factors, inflammation, and immunity.

Authors:  Asis Palazon; Ananda W Goldrath; Victor Nizet; Randall S Johnson
Journal:  Immunity       Date:  2014-10-16       Impact factor: 31.745

2.  Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish.

Authors:  Alexander Hruscha; Peter Krawitz; Alexandra Rechenberg; Verena Heinrich; Jochen Hecht; Christian Haass; Bettina Schmid
Journal:  Development       Date:  2013-11-20       Impact factor: 6.868

Review 3.  Hypoxia-responsive transcription factors.

Authors:  Eoin P Cummins; Cormac T Taylor
Journal:  Pflugers Arch       Date:  2005-07-09       Impact factor: 3.657

4.  Stages of embryonic development of the zebrafish.

Authors:  C B Kimmel; W W Ballard; S R Kimmel; B Ullmann; T F Schilling
Journal:  Dev Dyn       Date:  1995-07       Impact factor: 3.780

5.  Glucocorticoids promote Von Hippel Lindau degradation and Hif-1α stabilization.

Authors:  Andrea Vettori; David Greenald; Garrick K Wilson; Margherita Peron; Nicola Facchinello; Eleanor Markham; Mathavan Sinnakaruppan; Laura C Matthews; Jane A McKeating; Francesco Argenton; Fredericus J M van Eeden
Journal:  Proc Natl Acad Sci U S A       Date:  2017-08-29       Impact factor: 11.205

Review 6.  Genomic and non-genomic effects of glucocorticoids: implications for breast cancer.

Authors:  Irma B Mitre-Aguilar; Alberto J Cabrera-Quintero; Alejandro Zentella-Dehesa
Journal:  Int J Clin Exp Pathol       Date:  2015-01-01

Review 7.  Zebrafish and steroids: what do we know and what do we need to know?

Authors:  Janina Tokarz; Gabriele Möller; Martin Hrabě de Angelis; Jerzy Adamski
Journal:  J Steroid Biochem Mol Biol       Date:  2013-01-30       Impact factor: 4.292

8.  Development of the corticosteroid stress axis and receptor expression in zebrafish.

Authors:  Derek Alsop; Mathilakath M Vijayan
Journal:  Am J Physiol Regul Integr Comp Physiol       Date:  2007-12-12       Impact factor: 3.619

9.  Dexamethasone impairs hypoxia-inducible factor-1 function.

Authors:  A E Wagner; G Huck; D P Stiehl; W Jelkmann; T Hellwig-Bürgel
Journal:  Biochem Biophys Res Commun       Date:  2008-05-21       Impact factor: 3.575

10.  The mineralocorticoid receptor is essential for stress axis regulation in zebrafish larvae.

Authors:  Erin Faught; Mathilakath M Vijayan
Journal:  Sci Rep       Date:  2018-12-27       Impact factor: 4.379

View more
  10 in total

Review 1.  Zebrafish-An Optimal Model in Experimental Oncology.

Authors:  Iwona Kwiatkowska; Justyna Magdalena Hermanowicz; Zaneta Iwinska; Krystyna Kowalczuk; Jolanta Iwanowska; Dariusz Pawlak
Journal:  Molecules       Date:  2022-06-30       Impact factor: 4.927

2.  Rational construction of a reversible arylazo-based NIR probe for cycling hypoxia imaging in vivo.

Authors:  Yuming Zhang; Wenxuan Zhao; Yuncong Chen; Hao Yuan; Hongbao Fang; Shankun Yao; Changli Zhang; Hongxia Xu; Nan Li; Zhipeng Liu; Zijian Guo; Qingshun Zhao; Yong Liang; Weijiang He
Journal:  Nat Commun       Date:  2021-05-13       Impact factor: 14.919

3.  Reprogramming of glucocorticoid receptor function by hypoxia.

Authors:  Tineke Vanderhaeghen; Steven Timmermans; Deepika Watts; Ville Paakinaho; Melanie Eggermont; Jolien Vandewalle; Charlotte Wallaeys; Lise Van Wyngene; Kelly Van Looveren; Louise Nuyttens; Sylviane Dewaele; Joke Vanden Berghe; Kelly Lemeire; Joey De Backer; Laura Dirkx; Wim Vanden Berghe; Guy Caljon; Bart Ghesquière; Karolien De Bosscher; Ben Wielockx; Jorma J Palvimo; Rudi Beyaert; Claude Libert
Journal:  EMBO Rep       Date:  2021-10-26       Impact factor: 8.807

4.  Vitamin E Deficiency Disrupts Gene Expression Networks during Zebrafish Development.

Authors:  Brian Head; Stephen A Ramsey; Chrissa Kioussi; Robyn L Tanguay; Maret G Traber
Journal:  Nutrients       Date:  2021-01-30       Impact factor: 5.717

Review 5.  Glucocorticoid-Mediated Developmental Programming of Vertebrate Stress Responsivity.

Authors:  Ian M Gans; James A Coffman
Journal:  Front Physiol       Date:  2021-12-21       Impact factor: 4.566

6.  Zebrafish Mutant Lines Reveal the Interplay between nr3c1 and nr3c2 in the GC-Dependent Regulation of Gene Transcription.

Authors:  Alberto Dinarello; Annachiara Tesoriere; Paolo Martini; Camilla Maria Fontana; Davide Volpato; Lorenzo Badenetti; Francesca Terrin; Nicola Facchinello; Chiara Romualdi; Oliana Carnevali; Luisa Dalla Valle; Francesco Argenton
Journal:  Int J Mol Sci       Date:  2022-02-28       Impact factor: 5.923

7.  Hyperactivation of Wnt/β-catenin and Jak/Stat3 pathways in human and zebrafish foetal growth restriction models: Implications for pharmacological rescue.

Authors:  Giovanni Risato; Rudy Celeghin; Raquel Brañas Casas; Alberto Dinarello; Alessandro Zuppardo; Andrea Vettori; Kalliopi Pilichou; Gaetano Thiene; Cristina Basso; Francesco Argenton; Silvia Visentin; Erich Cosmi; Natascia Tiso; Giorgia Beffagna
Journal:  Front Cell Dev Biol       Date:  2022-08-16

Review 8.  Bidirectional Crosstalk Between Hypoxia Inducible Factors and Glucocorticoid Signalling in Health and Disease.

Authors:  Tineke Vanderhaeghen; Rudi Beyaert; Claude Libert
Journal:  Front Immunol       Date:  2021-06-04       Impact factor: 7.561

Review 9.  If it's not one thing, HIF's another: immunoregulation by hypoxia inducible factors in disease.

Authors:  Ffion R Hammond; Amy Lewis; Philip M Elks
Journal:  FEBS J       Date:  2020-07-20       Impact factor: 5.622

Review 10.  Homeostatic Regulation of Glucocorticoid Receptor Activity by Hypoxia-Inducible Factor 1: From Physiology to Clinic.

Authors:  Davide Marchi; Fredericus J M van Eeden
Journal:  Cells       Date:  2021-12-07       Impact factor: 6.600

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.