Literature DB >> 32377717

Puerarin improves graft bone defect through microRNA‑155‑3p‑mediated p53/TNF‑α/STAT1 signaling pathway.

Yang Zhou1, Hongyu Lian2, Kexin Liu2, Deli Wang3, Xuelian Xiu1, Zhang Sun1.   

Abstract

Bone graft defects may lead to dysfunction of bone regeneration and metabolic disorders of bone mesenchymal stem cells (BMSCs). Puerarin has demonstrated pharmacological activities in the treatment of human metabolic diseases. The purpose of the present study was to investigate the role of puerarin and to explore its possible protective mechanism of action in rats with bone grafts. A bone graft rat model was established using bone grafting surgery and the rats received puerarin or PBS. Reverse transcription‑quantitative PCR, western blot, TUNEL, immunofluorescence and immunohistochemistry assays were used to analyze the beneficial effects of puerarin on bone repair. The results demonstrated that puerarin effectively ameliorated pathological graft bone defects, decreased bone loss and apoptosis of BMSCs, promoted BMSC proliferation and differentiation, and increased bone mass and the parameters of bone formation in rats with bone grafts. Puerarin decreased the levels of pro‑inflammatory cytokines [tumor necrosis factor (TNF)‑α, interleukin (IL)‑1β, IL‑17A, IL‑6 and transforming growth factor (TGF)‑β1] and increased the levels of anti‑inflammatory cytokines (IL‑2 and IL‑10) in the serum compared with the PBS group. Puerarin treatment was associated with lower serum alanine transaminase, glutamic oxaloacetic transaminase, γ‑glutamyl transferase, alkaline phosphatase, direct bilirubin and total bilirubin levels compared with those in the PBS group in experimental rats. The expression of microRNA‑155‑3p (miR‑155‑3p) was upregulated, whereas that of p53, TNF‑α and signal transducer and activator of transcription (STAT)1 was downregulated in BMSC cultures of puerarin‑treated rats. In vitro assay demonstrated that knockdown of miR‑155‑3p increased p53, TNF‑α and STAT1 expression in BMSCs, and blocked puerarin‑regulated p53/TNF‑α/STAT1 signaling. Most importantly, miR‑155‑3p knockdown inhibited puerarin‑regulated apoptosis, proliferation and differentiation of BMSCs. Moreover, the results demonstrated that puerarin regulated vascular endothelial growth factor expression via the miR‑155‑3p signaling pathway. In conclusion, the results of the present study demonstrated that the upregulation of miR‑155‑3p induced by puerarin promoted BMSC differentiation and bone formation and increased bone mass in rats with bone grafts, thereby supporting the potential application of puerarin in the prevention of bone graft defects.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32377717      PMCID: PMC7255454          DOI: 10.3892/ijmm.2020.4595

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   4.101


Introduction

Bone graft defect is the most common complication among patients undergoing bone grafting, resulting in the increasing risk of infection, delayed bone union, fracture or disability (1-3). A series of cellular repair programs are involved in bone tissue defects, such as the infiltration of host reparative cells into the damaged sites, the proliferation and differentiation of the cells, and the signal transduction of extracellular molecules (4-6). Macrophages secrete a wide range of inflammatory and chemotactic mediators, including tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6 and IL-17, which can further initiate the loss of bone mesenchymal stem cells (BMSCs) and suppress bone formation (7). Anti-inflammatory cytokine expression, including IL-10 and IL-2, inhibits bone resorption by suppressing osteoclast differentiation and activity, and/or enhancing osteoblast differentiation, function, collagen synthesis and bone formation (7). Studies have indicated that the serum levels of alanine transaminase (ALT), glutamic oxaloacetic transaminase (AST), γ-glutamyl trans-ferase (γ-GT), alkaline phosphatase (ALP), direct bilirubin (DBIL) and total bilirubin (TBIL) are associated with osteoradionecrosis and deficient bone consolidation (8-10), which may reflect the function of BMSCs (11). The rapid recruitment of BMSCs in bone defects plays a crucial role in efficient bone regeneration (12). BMSCs are a promising strategy for healing of large bone defects, reconstruction and regeneration, indicating the ability of BMSCs to promote bone union and regeneration (13). However, the possible mechanisms underlying the role of BMSCs in the bone regeneration process in bone graft defects are incompletely understood. Puerarin, a traditional Chinese medicine, is a flavanone glycoside with anti-inflammatory, antioxidant, anti-apoptotic, cardioprotective, anticancer and antidiabetic properties (14). The multiple functions of puerarin have been applied for the treatment of several human diseases, including myocardial infarction, diabetes mellitus, arthritis and Parkinson's disease (14-18). Evidence has demonstrated that puerarin dissolved in collagen matrix increases new bone formation in bone graft defect sites, which can be used for repair of bone grafting and bone regeneration after surgery (19). The p53 pathway is associated with bone and proper skeletal development, and it is a novel regulator of osteoblast differentiation, osteoblast-dependent osteoclastogenesis and bone remodeling (20). The decrease of p53-mediated apoptosis in osteoblastic cells enhanced the reduction of bone formation in the tibiae of ApoE−/− mice fed with a high-fat diet (21). Evidence has demonstrated that regulating p53 function can modulate cell cycle arrest of chondrocytes and regulate the timing of jaw cartilage maturation and ossification (22). In addition, TNF-α can induce osteoclastogenesis and promote apoptosis by activating signal transducer and activator of transcription (STAT)1 and shifting activation from TNF receptor-associated death domain to caspase-3 signaling (23). Furthermore, puerarin stimulates osteoblastic proliferation and promotes bone formation in cultured rat osteoblasts by upregulation of the phosphoinositide 3-kinase/Akt pathway (24). Moreover, puerarin contributes to the induction of osteoblast proliferation and differentiation, resulting in bone formation through the induction of bone morphogenetic protein (BMP)-2 and nitric oxide (NO) synthesis (25). However, the associations between puerarin and the miR-155-3p-mediated p53/TNF-α/STAT1 pathway in BMSCs in the bone regeneration process have not been elucidated. miR-155-3p is one of the best characterized miRNAs and it has been demonstrated to play a key role in various physiological and pathological processes, including apoptosis, inflammation, immunity, cancer and cardiovascular disease (26). Reports demonstrate that the p53/TNF-α/STAT1 pathway is involved in osteoclastogenesis and osteocyte apoptosis during osteoclast formation and bone restoration (23). The aim of the present study was to investigate the role of puerarin in bone graft defects and to determine whether puerarin regulates BMSC proliferation and differentiation via regulation of miR-155-3p expression. The cell molecular p53/TNF-α/STAT1 signaling mediated by miR-155-3p was also investigated to elucidate the possible mechanisms of action of puerarin in BMSCs in rats with bone grafts. This study also aimed to determine whether puerarin treatment can promote bone tissue repair in a bone graft rat model.

Materials and methods

Animal study

A total of 20 male Sprague-Dawley rats, aged 8 weeks, weighing 320-350 g, were used to generate an osteogenesis transplantation animal model according to a previous report (27). All surgical procedures were performed under general anesthesia by intramuscular injection with a combination of sumianxin II (0.25 ml/kg) and pentobarbital sodium (18 mg/kg). The rats were housed (n=3 per cage) on a 12-h light/dark cycle at constant temperature (23±2°C) with easy access to food and water. After osteogenesis induction by bone grafting, the rats were randomly assigned to two groups (n=10 per group), the PBS and puerarin (2 mg/kg) groups. All treatments were performed using intravenous injection once per day under aseptic conditions. The treatments continued for 4 weeks. Animal health and behavior were monitored every day and all rats were healthy during the experimental period. Two rats were used to isolate BMSCs on day 4 after osteogenesis transplantation. At the end of experiment, the rats were anesthetized with intraperitoneal xylazine (3 mg/kg) and ketamine HCl (90 mg/kg) and sacrificed by decapitation.

ELISA

On week 4, blood samples (1 ml) were collected through cardiac puncture during sacrifice and serum was separated using centrifugation at 10,000 × g for 5 min at 4°C. Serum levels of TNF-α (ab100747, Abcam), IL-1β (ab100705, Abcam), IL-17A (ab199081, Abcam), IL-6 (ab100712, Abcam), TGF-β1 (ab118557, Abcam), IL-2 (ab223588, Abcam), IL-10 (ab33471, Abcam), ALT (ab234579, Abcam), AST (ab263882, Abcam), γ-GT (ab134640, Abcam), ALP (ab256583, Abcam), DBIL (ab34139, Abcam) and TBIL (ab37068, Abcam) were measured by using rat-specific sandwich ELISA (Abcam) according to the manufacturer's protocol.

Bone formation and trabecular bone score analysis

The area of bone formation around the osteogenesis induced by bone grafting was analyzed at 4 weeks after the operation. The mice were sacrificed on week 4 and the bone tissues were obtained and fixed in 4% paraformaldehyde for 2 h at 37°C. The bone formation was measured using micro-CT scanning (n=3, SkyScan-1172; Skyscan) according to the manufacturer's instructions (9-micron voxel size, 35 kV energy and 220 mA intensity). Bone calcium and phosphorus were measured at a standard site and at the fracture site, as described previously (28). Bone surface/tissue volume (mm3/mm2) and bone mineral density (BMD, mg/cm3), were calculated based on reconstructed images determined by CTVol software v.2.2.1 (Bruker Micro-CT). Histopathological score was analyzed using a semi-quantitative scoring system and measured using the image analysis program Cell-sens 1.5® (Olympus Corporation), as described previously (29).

Isolation and culture of BMSCs

BMSCs were isolated from rats undergoing osteogenesis transplantation, as described previously (30). The BMSCs were cultured in α-MEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), 1% penicillin and streptomycin (Gibco; Thermo Fisher Scientific, Inc.) and maintained at 37°C with 5% CO2. The BMSCs were used in all experiments.

Cell transfection

BMSCs were seeded into 6-well plates at a density of 5×104 cells per well and cultured at 37°C and 5% CO2. miR-155-3p inhibitor negative control (miR-NC inhibitor, 5′-CAGUACUUUUGUGUAGUACAA-3′) and miR-155 inhibitor (5′-ACCCCUAUCACGAUUAGCAUUAA-3′) were purchased form RiboBio. After 12 h of culture, BMSCs were washed with PBS and transfections were conducted using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Cells were harvested after 72 h for further analyses.

Reverse transcription-quantitative PCR (RT-qPCR) analysis

BMSCs were harvested and total RNA was extracted using RNA easy total RNA kit (Takara Bio, Inc.) according to the manufacturer's instructions. RNA was reverse-transcribed into cDNA at 42°C for 2 h using the PrimeScript RT Master Mix kit (Perfect Real Time, cat. no. RR036A; Takara Bio, Inc.). The primers are listed in Table I. RT-qPCR was performed using the SYBRR Premix Ex TaqTMII kit (TilRNaseH Plus, cat. no. RR820A; Takara Bio, Inc.) on an iQ5 PCR cycler (Bio-Rad Laboratories, Inc.). The PCR thermocycling conditions were as follows: 52°C for 2 min and 95°C for 5 min, followed by 45 cycles at 95°C for 15 sec and 58°C for 60 sec. The relative mRNA expression levels were calculated using the 2−ΔΔCq method (31). Expression was normalized to β-actin.
Table I

Primers in reverse transcription-quantitative PCR assay.

GeneForward (5′-3′)Reverse (5′-3′)
miR-155CCAGCTACACTGGGCAGCAGCAATTCATGTTTCTCAACTGGTGTCGTGGA
Caspase-3CATGATTAGCAAGTTACAGTGATGCCACAGTCTTAAGTGGGGGGA
Caspase-9CGTTCTATGGTTACCGACATGACGGTTCCATAGTCATTGAGCATTGTG
BMP-2AACCTGCAACAGCCAACTGCTCAGTGTAGCCCAGGAT
M-CSFATAAGTTTGTCGTCTTTTCACAGGAGGTTCTGTCTCTGACC
P53TGCGTGTGGAGTATTTGGATGTGGTACAGTCAGAGCCAACCAG
TNF-αCAATCCCTTTATTACCCGTCTTCTCAAGTCCTGC
STAT1CACTGCCTCCCAGGAATCAATGATCATTGATTCCTGGGAGGCAGTG
β-actinCGGAGTCAACGGATTTGGTCAGCCTTCTCCATGGTCGTGA

BMP, bone morphogenetic protein; CSF, colony-stimulating factor; TNF, tumor necrosis factor; STAT, signal transducer and activator of transcription.

Cell viability, proliferation and differentiation

BMSCs transfected with miR-NC inhibitor or miR-155 inhibitor were seeded in 6-well plates (1×104 cells/well) and cultured with or without 50 mM puerarin for 7 days. Images were captured using a Leica DM 4000 microscope at a magnification of ×100 (Leica Microsystems GmbH) and cell viability was determined by refractive index at 450 nm using a Bio-Rad 680 spectrophotometric microplate reader (Bio-Rad Laboratories, Inc.). To determine BMSC proliferation, cells were fixed with 4% (v/v) paraformaldehyde for 30 min at room temperature, and then stained with 100 μl Apollo® staining reaction solution (RiboBio) for 15 min at room temperature. The BMSCs were incubated with Triton X-100 (0.5%) for 5 min and stained with 1X Hoechst reaction solution (500 μl). After three washes in PBS, images were captured using a fluorescence microscope at a magnification of ×100 (Olympus Corporation). The percentage of EdU-labeled cells was calculated from at least six randomly selected fields in each well. For differentiation, BMSCs were cultured for 21 days and subjected to Oil Red O staining. Cells were washed with PBS three times and images were captured at a magnification of ×100 with a Leica DM 4000 microscope.

Western blot analysis

BMSCs transfected with miR-NC inhibitor or miR-155 inhibitor were seeded in 6-well plates (1×104 cells/well) and cultured with or without 50 mM puer-arin for 144 h. BMSCs were lysed using RIPA buffer (P0013B, Beyotime Institute of Biotechnology) and centrifuged at 12,000 × g for 10 min at 4°C. The protein concentration was determined by a bicinchoninic acid assay (Beyotime Institute of Biotechnology). Protein (40 μg per lane) was loaded on 12% SDS-PAGE and subsequently transferred to PVDF membranes (Abcam) followed by blocking with 5% BSA (Sigma-Aldrich; Merck KGaA) and incubation with primary antibodies [anti-caspase-3 (1:1,000, ab13847), anti-caspase-9 (1:1,000, ab202068), anti-VEGF (1:1,000, ab53465), anti-p53 (1:1,000, ab131442), anti-TNF-α (1:1,000, ab6671), anti-STAT1 (1:1,000, ab2071, Abcam), anti-pSTAT1 (1:1,000, ab30645), anti-BMP-2 (1:1,000, ab214821), anti-macrophage colony-stimulating factor (M-CSF, 1:1,000, ab52846) and anti-β-actin (1:1,000, ab8226); all from Abcam] for 12 h at 4°C. After washing with PBST (0.5% Tween-20), the proteins were incubated with goat anti-rabbit IgG antibody (1:5,000, ab6721, Abcam) at room temperature for 2 h. All bands were visualized with an ECL system kit (MultiSciences). Band densities were analyzed by ImageJ software, version 4.6 (National Institutes of Health).

DPPH and ABTS scavenging assay

The ABTS scavenging assay was applied to evaluate the antioxidant activity of puerarin as described previously (32). The DPPH scavenging activity of puerarin was evaluated using a spectrophotometer (Genesis 5, Spectronic Instruments) following the method described previously (33). Briefly, BMSCs were lysed in PBS and the absorbance of the solution was measured using a spectrophotometer (Genesis 5, Spectronic Instruments) at 734 and 515 nm for ABTS and DPPH, respectively. The antioxidant capacity of puerarin was determined by calculating its half maximal inhibitory concentration (IC50).

Oil red O and hematoxylin and eosin (H&E) staining

Bone tissues were obtained from experimental rats, fixed in 4% paraformaldehyde, embedded in paraffin and then cut into 5-μm sections. Tissue sections were stained with filtered Oil red O solution (Sigma Aldrich; Merck KGaA) at room temperature for 30 min. For the evaluation of bone regeneration, specimens were stained with H&E for 10 min at room temperature. Images were captured using a Leica DM 4000 microscope at a magnification of ×100 to observe the morphology of the bone transplant.

Immunohistochemistry (IHC) assay

The expression levels of p53, TNF-α and STAT1 were evaluated using IHC. Tissues sections were incubated with primary antibody against p53, TNF-α and STAT1 (Abcam) for 12 h at 4°C. Following incubation with secondary antibody, the sections were stained with a diaminobenzidine staining system (D7679MSDS, Sigma-Aldrich; Merck KGaA) according to manufacturer's protocol. Images of the sections were captured at a magnification of ×100.

TUNEL assay

TUNEL assay was used to determine the percentage of cell apoptosis in bone tissue and BMSCs. For bone tissue, three specimens in each group were deparaffinized and stained with TUNEL (Roche Diagnostics) following the manufacturer's instructions. For BMSCs, miR-NC inhibitor-transfected or miR-155 inhibitor-transfected cells were seeded in 6-well plates (1×104 cells/well) and cultured with or without 50 mM puerarin for 144 h. Cells were immersed in 50 μl TUNEL reaction fluid in a humid environment at 37°C for 1 h. After washing with PBS three times, the cells were incubated with DAPI at 37°C for 30 min. Finally, the samples were washed with PBS three times and then captured at a magnification of ×100 with a Leica DM 4000 microscope. The apoptosis rate was calculated using Developer XD 1.2 software (Definiens AG).

Statistical analysis

Data are expressed as the mean ± standard deviation. All statistical analyses were performed using SPSS 17.0 (SPSS, Inc.). Statistical differences were analyzed by two-tailed Student's t-test or one-way ANOVA followed by Tukey's multiple comparison post hoc tests. Non-parametric data were analyzed using Mann-Whitney U tests. Each experiment was repeated at least three times. P<0.05 was considered to indicate statistically significant differences.

Results

Puerarin ameliorates pathological bone graft defects in rats

The benefits of puerarin in the repair of bone graft defects were studied in rats. Puerarin administration ameliorated pathological bone graft defect determined by histopathological score compared with the PBS group (Fig. 1A). Administration of puerarin decreased bone loss and increased bone mass compared with the PBS group in rats with bone graft defects (Fig. 1B and C). Puerarin stimulated new bone growth around the bone defect site determined by micro-CT scanning, with a significant difference from the PBS control group (Fig. 1D). Puerarin administration improved the parameters of bone formation, bone calcium and bone phosphorus in rats with bone grafts (Fig. 1E-G). Body weight and BMD were also increased by puerarin administration compared with the PBS group (Fig. 1H and I). These results indicate that puerarin was beneficial for the recovery of bone graft defects.
Figure 1

Effects of puerarin on improvement of pathological bone graft defects in rats. (A) Improvement of pathological bone defect determined by histopathological score between the puerarin and PBS groups in a rat model of bone graft defect. (B) BSD and (C) BVF in bone tissues of rats with bone graft defect. (D) Micro-CT images of bone growth around the bone defect site. (E) Bone formation determined by Oil red O and H&E staining, (F) bone calcium and (G) bone phosphorus in rats with bone grafts. Magnification, ×100. (H) Body weight and (I) bone mineral density of rats with bone grafts. Arrows indicate the defect site. Data are expressed as the mean ± standard deviation. Each experiment was repeated at least three times. Student's t-test was used to evaluate the statistical significance of differences between two groups. *P<0.05 and **P<0.01 vs. PBS. BSD, bone surface density; BVF, bone volume fraction; CT, computed tomography; ns, non-significant.

Puerarin exerts anti-inflammatory and antioxidant effects in rats with bone graft defects

The anti-inflammatory and antioxidant activities of puerarin were analyzed in rats with bone graft defects. The levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-17A, IL-6 and TGF-β1) were decreased and those of anti-inflammatory cytokines (IL-2 and IL-10) were increased by puerarin compared with PBS in rats with bone grafts (Fig. 2A and B). Puerarin administration decreased serum ALT, AST, γ-GT, ALP, DBIL and TBIL levels compared with the PBS group in experimental rats (Fig. 2C). Puerarin exhibited more potent antioxidant activity compared with the control group as determined by DPPH and ABTS assays (Fig. 2D). These results indicated that puerarin demonstrates anti-inflammation and antioxidant activities in rats with bone graft defects.
Figure 2

Anti-inflammatory and antioxidant activities of puerarin in rats with bone graft defects. (A) Pro-inflammatory cytokines TNF-α, IL-1β, IL-17A, IL-6 and TGF-β1 in the serum of rats with bone grafts following treatment with puerarin or PBS. (B) Anti-inflammatory cytokines IL-2 and IL-10 in the puerarin and PBS groups in rats with bone grafts following treatment with puerarin or PBS. (C) Puerarin administration decreased serum ALT, AST, γ-GT, ALP, DBIL and TBIL levels in experimental rats. (D) Antioxidant activity in bone tissue of rats with bone graft defects following treatment with puerarin or PBS. Data are expressed as the mean ± standard deviation. Each experiment was repeated at least three times. Student's t-test was used to evaluate the statistical significance of differences between two groups. *P<0.05 and **P<0.01 vs. PBS. TNF, tumor necrosis factor; IL, interleukin; TGF, transforming growth factor; ALT, alanine transaminase; AST, glutamic oxaloacetic transaminase; γ-GT, γ-glutamyl transferase; ALP, alkaline phosphatase; DBIL, direct bilirubin; TBIL, total bilirubin.

Effects of puerarin on BMSC viability, proliferation, differentiation and apoptosis

To evaluate the effects of puerarin on the improvement of bone graft defects, BMSCs were isolated from rats with bone graft defects not receiving treatment. The viability, proliferation, differentiation and apoptosis of BMSCs were measured in vitro. As shown in Fig. 3A, puerarin increased the viability of BMSCs compared with the control group. The proliferation and differentiation of BMSCs were stimulated by puerarin (Fig. 3B and C). These data explain the beneficial effect of puerarin treatment on bone graft defects. Administration of puerarin also decreased the apoptosis of BMSCs induced by H2O2 as determined by TUNEL assay (Fig. 3D). RT-qPCR and western blot analyses demonstrated that puerarin decreased the expression of caspase-3 and caspase-9, and increased the expression of BMP-2 and M-CSF in BMSCs (Fig. 3E and F). These results indicate that puerarin increases the viability, proliferation and differentiation and decreases apoptosis of BMSCs in vitro.
Figure 3

Puerarin increased the viability, proliferation and differentiation and decreased apoptosis of BMSCs. (A) Viability, (B) proliferation, (C) differentiation and (D) apoptosis of BMSCs following puerarin administration. (E) mRNA and (F) protein expression of caspase-3, caspase-9, BMP-2 and M-CSF in BMSCs. Arrows indicate the apoptotic cells. Scale bars, 50 μm. Data are expressed as the mean ± standard deviation. Each experiment was repeated at least three times. Student's t-test was used to evaluate the statistical significance of differences between two groups. *P<0.05 and **P<0.01 vs. PBS. **P<0.01 vs. control. BMSCs, bone mesenchymal stem cells; BMP, bone morphogenetic protein; M-CSF, macrophage colony-stimulating factor.

Puerarin regulates miR-155-3p-mediated p53/TNF-α/STAT1 signaling in BMSCs

A previous study has indicated that miR-155-3p mediates TNF-α-inhibited cementoblast differentiation (34). Therefore, the effects of puerarin on miR-155-3p-mediated p53/TNF-α/STAT1 signaling were analyzed in bone tissue in vitro and in BMSCs in vitro. The expression of miR-155-3p was found to be higher in the puerarin group compared with that un the PBS group (Fig. 4A). IHC assay demonstrated that the expression of p53, TNF-α and STAT1 was downregulated in the puerarin group compared with that in the PBS group in bone tissue (Fig. 4B). The in vitro assay revealed that miR-155-3p expression was increased by puerarin in BMSCs (Fig. 4C). The gene and protein expression of p53, TNF-α and STAT1 was down-regulated in puerarin-treated BMSCs (Fig. 4D and E). The results demonstrated that miR-155-3p decreased miR-155-3p and increased p53, TNF-α and STAT1 mRNA expression in BMSCs (Fig. 4F). Interestingly, miR-155-3p upregulated p53, TNF-α and STAT1 expression in BMSCs, and blocked the puerarin-induced decrease p53, TNF-α and STAT1 expression (Fig. 4G). These results indicate that puerarin can regulate miR-155-3p-mediated p53/TNF-α/STAT1 signaling in BMSCs.
Figure 4

Puerarin regulated miR-155-3p-mediated p53/TNF-α/STAT1 signaling in BMSCs. (A) Expression of miR-155-3p in bone tissue in rats with bone graft defects. (B) IHC assay analyzed the expression of p53, TNF-α and STAT1 in bone tissue in the puerarin and PBS groups. (C) Expression of miR-155-3p in BMSCs. (D) Gene and (E) protein expression of p53, TNF-α and STAT1 in BMSCs. (F) Effects of miR-155 inhibitor on miR-155, p53, TNF-α and STAT1 mRNA expression in BMSCs. (G) Effect of miR-155 inhibitor on p53, TNF-α and STAT1 protein expression in BMSCs. Scale bars, 50 μm. Data are expressed as the mean ± standard deviation. Each experiment was repeated at least three times. Student's t-test was used to evaluate the statistical significance of differences between two groups and one-way ANOVA followed by Tukey's test were performed for multiple groups. **P<0.01 vs. control. TNF, tumor necrosis factor; STAT, signal transducer and activator of transcription; BMSCs, bone mesenchymal stem cells; IHC, immunohistochemistry; ns, non-significant.

Puerarin regulates the proliferation and differentiation of BMSCs via the miR-155-3p signaling pathway

The proliferation and differentiation of BMSCs was analyzed following miR-155-3p knockdown. Knockdown of miR-155-3p suppressed the proliferation and differentiation of BMSCs (Fig. 5A and B). The puerarin-induced proliferation and differentiation of BMSCs was partially abolished by miR-155-3p knockdown. Similarly, miR-155-3p knockdown reversed the upregulation of BMP-2 and M-CSF expression stimulated by puerarin in BMSCs (Fig. 5C and D). These results indicate that puerarin induces proliferation and differentiation of BMSCs via the miR-155-3p pathway.
Figure 5

Puerarin regulated the proliferation and differentiation of BMSCs via the miR-155-3p signaling pathway. Effects of miR-155 inhibitor on the (A) proliferation and (B) differentiation of BMSCs stimulated by puerarin. Effects of miR-155 inhibitor on the BMP-2 and M-CSF (C) gene and (D) protein expression in BMSCs stimulated by puerarin. Scale bars, 50 μm. Data are expressed as the mean ± standard deviation. Each experiment was repeated at least three times. One-way ANOVA followed by Tukey's test were performed for multiple groups. **P<0.01 vs. control. BMSCs, bone mesenchymal stem cells; BMP, bone morphogenetic protein; M-CSF, macrophage colony-stimulating factor; ns, non-significant.

Puerarin regulates apoptosis of BMSCs via the miR-155-3p signaling pathway

The effects of puerarin on miR-155-3p-mediated p53/TNF-α/STAT1 signaling were analyzed in bone tissue and BMSCs. The results demonstrated that puerarin decreased apoptosis of osteocytes compared with the PBS group in experimental mice (Fig. 6A). The results also revealed that miR-155-3p knockdown decreased puerarin-regulated apoptosis of BMSCs (Fig. 6B). RT-qPCR and western blot assays also demonstrated that cleaved caspase-3 and caspase-9 expression induced by puerarin was inhibited by miR-155-3p knockdown in BMSCs (Fig. 6C and D). These results indicate that puerarin regulates apoptosis of BMSCs via the miR-155-3p signaling pathway.
Figure 6

Puerarin regulated apoptosis of BMSCs via the miR-155-3p signaling pathway. (A) Apoptosis of osteocytes in bone tissue in the puerarin and PBS groups of experimental animals. (B) Effects of miR-155 inhibitor on puerarin-regulated apoptosis of BMSCs. (C and D) Effects of miR-155 inhibitor on the (C) gene and (D) protein expression of caspase-3 and caspase-9 stimulated by puerarin in BMSCs. Scale bars, 50 μm. Data are expressed as the mean ± standard deviation. Each experiment was repeated at least three times. Arrows indicate the apoptotic cells. Student's t-test was used to evaluate the statistical significance of differences between two groups and one-way ANOVA followed by Tukey's test were performed for multiple groups. *P<0.05 and **P<0.01 vs. control. BMSCs, bone mesenchymal stem cells; ns, non-significant.

Knockdown of miR-155-3p abolishes puerarin-mediated VEGF pathway in BMSCs

It was previously reported that VEGF is involves in angiogenesis during bone regeneration (35). Thus, the present study investigated the role of puerarin in the VEGF pathway in BMSCs. In vivo assay revealed that puerarin was associated with higher VEGF expression in bone tissue compared with that in the PBS group (Fig. 7A). Puerarin administration increased VEGF expression in BMSCs compared with the control (Fig. 7B and C). Similarly, miR-155-3p knockdown abolished the puerarin-induced increase in VEGF expression in BMSCs (Fig. 7D and E). These data indicate that puerarin activates the VEGF pathway via miR-155-3p in BMSCs.
Figure 7

Puerarin regulated the VEGF pathway via miR-155-3p in BMSCs. (A) Puerarin upregulated VEGF expression in bone tissues of rats with bone graft defects. Effects of puerarin administration on VEGF (B) gene and (C) protein expression in BMSCs. Effects of miR-155 inhibitor on VEGF (D) gene and (E) protein expression regulated by puerarin in BMSCs. Scale bars, 50 μm. Data are expressed as the mean ± standard deviation. Each experiment was repeated at least three times. Student's t-test was used to evaluate the statistical significance of differences between two groups and one-way ANOVA followed by Tukey's test were performed for multiple groups. **P<0.01 vs. PBS. VEGF, vascular endothelial growth factor; BMSCs, bone mesenchymal stem cells; ns, non-significant.

Discussion

Bone graft defect at the implant site following reconstruction frequently leads to slow healing of the lesions (36). Puerarin was shown to decrease oophorectomy-induced bone loss, which indicates the potential application of puerarin in the treatment of bone graft defects (37). The aim of the present study was to evaluate the bone regenerative and anti-apoptotic activity of puerarin in a rat model of bone graft defect. The use of puerarin for the bone graft defect may represent a useful strategy for increasing bone mass, stimulate new bone growth around the bone defect site, increase body weight and bone mineral density, and improve the pathological bone graft defect. Specifically, puerarin administration protected BMSCs against apoptosis, stimulated their proliferation and differentiation, and promoted bone calcium and bone phosphorus restoration and bone formation. Furthermore, it was previously demonstrated that miR-155 regulates the inflammatory state of the bone marrow niche and affects the development of myeloproliferative disorders (38). Thus, taking into account the role of miR-155, the use of puerarin is recognized as a novel strategy that benefits the metabolism of BMSCs through targeting miR-155. The findings of the present study demonstrated that puerarin may protect BMSCs against apoptosis via miR-155, which may be beneficial for patients after bone transplantation. BMSCs enhance functional recovery of spinal cord injury partly by promoting axonal regeneration, suggesting that BMSC-based therapy may be a viable therapeutic strategy for the treatment of bone injury by promoting axonal regeneration and repair (12). Data in the present study demonstrated that stimulation of BMSC proliferation and differentiation was achieved by puerarin in vitro as well as in vitro. In particular, BMSCs stimulate bone regeneration by regulation of the BMP/Smad signaling pathway (39). Furthermore, the use of puerarin increased BMP and VEGF expression in bone tissues and BMSCs. It was previously reported that pre-treatment of BMSCs with N-acetyl-L cysteine can promote bone regeneration via enhancing resistance to oxidative stress-induced apoptosis at the transplant site (40). The results of the present study demonstrated that puerarin administration exhibited anti-inflammatory and antioxidant activities in rats with bone graft defects. Notably, protection of BMSCs against H2O2-induced apoptosis contributes to the improvement of bone mass in rats with glucocorti-coid-induced osteoporosis (41). Our data demonstrated that puerarin not only inhibited apoptosis of osteocytes at the sites of bone graft defects, but also decreased apoptosis of BMSCs induced by H2O2 in vitro. A previous study demonstrated that the proliferation and differentiation of BMSCs increases osteogenic activity, promotes bone repair and bone remodeling (42). In the present study, it was observed that puerarin promoted proliferation and differentiation of BMSCs, which may be an important factor favoring bone repair and fracture healing. However, the role of puerarin was examined in BMSCs in order to analyze bone regeneration, but its function in other types of bone cells was not investigated. Bone graft defects occur due to the apoptosis of BMSCs (43). A previous study reported that miR-155-3p mediates TNF-α-inhibited cementoblast differentiation via β-catenin-mediated transcriptional activation (34). In addition, p53 loss increases the osteogenic differentiation of BMSCs (44). TNF-α also affects osteoblast metabolism through regulation of M-CSF expression during the progression of bone destruction (45). Furthermore, STAT1 is involved in osteoblast differentiation that is regulated by miR-194 (46). As expected, puerarin upregulated miR-155-3p, and downregulated p53, TNF-α and STAT1 expression in bone tissues and in BMSCs. Consistently, miR-155-3p knockdown reversed the puerarin-induced decrease in p53, TNF-α and STAT1 expression in BMSCs, which further explains the potential mechanism of action of puerarin in the regulation of the p53/TNF-α/STAT1 pathway. Of note, the data of this study indicated that puerarin regulates the proliferation, differentiation and apoptosis of BMSCs via miR-155-3p-mediated p53/TNF-α/STAT1 signaling. This was also confirmed in bone tissue in a puerarin-treated osteogenesis transplantation animal model. However, further study on the various signaling pathways in BMSCs and other bone cells during bone regeneration induced by puerarin is required to further elucidate the potential mechanism underlying bone graft defects. It was previously reported that quercetin increases alkaline phosphatase activity in MC3T3-E1 cells in vitro and has the effect of forming new bone across bone defects in vivo (47). The data of the present study revealed that puerarin decreased bone defects, increased bone mass, and improved the parameters of bone formation, bone calcium and bone phosphorus levels in rats with bone grafts, which further elucidated the therapeutic effect of puerarin on osteogenesis transplantation animals. Puerarin affects osteoblast proliferation and differentiation, and promotes new bone formation in osteoblast implants by increasing alkaline phosphatase and mineralization (48). Consistently, our data confirmed previous results and further demonstrated that puerarin increased body weight and body mass index, and improved the parameters of bone formation, bone calcium and bone phosphorus levels in rats with bone grafts. However, this study also found that puerarin increased VEGF and regulated apoptosis of BMSCs via the miR-155-3p signal pathway in BMSCs. In conclusion, the findings of the present study demonstrated that puerarin exerts beneficial effects on bone regeneration and may be used for the treatment of bone graft defects. Puerarin administration appears to improve bone graft defects through downregulation of miR-155-3p-mediated p53/TNF-α/STAT1 signaling. Although these data explain the possible mechanism of action of puerarin in bone graft defects, further research is required to optimize the dose and to gain a better understanding of its bone regenerative properties.
  48 in total

1.  Preconditioning of bone marrow-derived mesenchymal stem cells with N-acetyl-L-cysteine enhances bone regeneration via reinforced resistance to oxidative stress.

Authors:  Jun Watanabe; Masahiro Yamada; Kunimichi Niibe; Maolin Zhang; Takeru Kondo; Minoru Ishibashi; Hiroshi Egusa
Journal:  Biomaterials       Date:  2018-09-04       Impact factor: 12.479

2.  Znf385C mediates a novel p53-dependent transcriptional switch to control timing of facial bone formation.

Authors:  Tatiana Hochgreb-Hägele; Daniel E S Koo; Marianne E Bronner
Journal:  Dev Biol       Date:  2015-01-28       Impact factor: 3.582

3.  Effect of puerarin on bone formation.

Authors:  R Wong; B Rabie
Journal:  Osteoarthritis Cartilage       Date:  2007-03-26       Impact factor: 6.576

4.  Puerarin prevents diabetic cardiomyopathy in vivo and in vitro by inhibition of inflammation.

Authors:  Mao-Shan Yin; Yi-Chi Zhang; Shu-Hong Xu; Jing-Jing Liu; Xiao-Hui Sun; Chen Liang; Yan Wang; Jie Li; Fu-Wen Wang; Qing-Li Wang; Yan-Ling Mu
Journal:  J Asian Nat Prod Res       Date:  2018-01-11       Impact factor: 1.569

5.  MicroRNA-194 promotes osteoblast differentiation via downregulating STAT1.

Authors:  Jun Li; Xijing He; Wenzhi Wei; Xiaobo Zhou
Journal:  Biochem Biophys Res Commun       Date:  2015-03-19       Impact factor: 3.575

6.  VEGF-activated angiogenesis during bone regeneration.

Authors:  Johannes Kleinheinz; Udo Stratmann; Ulrich Joos; Hans-Peter Wiesmann
Journal:  J Oral Maxillofac Surg       Date:  2005-09       Impact factor: 1.895

Review 7.  Regulation of the MIR155 host gene in physiological and pathological processes.

Authors:  Terry S Elton; Helina Selemon; Shane M Elton; Narasimham L Parinandi
Journal:  Gene       Date:  2012-12-14       Impact factor: 3.688

8.  Genetics of the Akp-2 locus for alkaline phosphatase of liver, kidney, bone, and placenta in the mouse. Linkage with the Ahd-1 locus on chromosome 4.

Authors:  F H Wilcox; B A Taylor
Journal:  J Hered       Date:  1981 Nov-Dec       Impact factor: 2.645

9.  Skeletal Site-specific Effects of Zoledronate on in vivo Bone Remodeling and in vitro BMSCs Osteogenic Activity.

Authors:  Xue Gong; Wanlu Yu; Hang Zhao; Jiansheng Su; Qing Sheng
Journal:  Sci Rep       Date:  2017-01-31       Impact factor: 4.379

10.  Effect of quercetin on preosteoblasts and bone defects.

Authors:  R W K Wong; A B M Rabie
Journal:  Open Orthop J       Date:  2008-03-10
View more
  6 in total

1.  Neohesperidin promotes the proliferation and osteogenic differentiation of BMSCs via BMP2-Wnt/β-catenin pathway.

Authors:  Shuai Yuan; Chuanxin Zhang; Bo Wang
Journal:  Cell Cycle       Date:  2021-12-17       Impact factor: 4.534

Review 2.  miR-155-3p: processing by-product or rising star in immunity and cancer?

Authors:  Owen Dawson; Anna Maria Piccinini
Journal:  Open Biol       Date:  2022-05-25       Impact factor: 7.124

Review 3.  Flavonoids: Classification, Function, and Molecular Mechanisms Involved in Bone Remodelling.

Authors:  Priyanka Ramesh; Rahul Jagadeesan; Saravanan Sekaran; Anuradha Dhanasekaran; Selvaraj Vimalraj
Journal:  Front Endocrinol (Lausanne)       Date:  2021-11-23       Impact factor: 5.555

4.  Anticancer Effect of Puerarin on Ovarian Cancer Progression Contributes to the Tumor Suppressor Gene Expression and Gut Microbiota Modulation.

Authors:  Yongju Ye; Yang Gao; Yuan Fang; Lixia Xu; Fule He
Journal:  J Immunol Res       Date:  2022-07-28       Impact factor: 4.493

5.  Effect of Puerarin on Osteogenic Differentiation in vitro and on New Bone Formation in vivo.

Authors:  Yanran Yang; Daiyun Chen; Yilin Li; Jinghua Zou; Ruiqi Han; Hongkun Li; Jun Zhang
Journal:  Drug Des Devel Ther       Date:  2022-08-27       Impact factor: 4.319

6.  Effects of Puerarin Combined with PLGA/TCP/Puerarin on Osteocalcin and Sialoprotein of Mandibular Defects.

Authors:  Ying Guo; Qianqian Zhang; Nu Mi; Chunmei Li; Xuechao Lv; Hong Wang
Journal:  Contrast Media Mol Imaging       Date:  2022-09-06       Impact factor: 3.009

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.