Crop diseases are responsible for considerable yield losses worldwide and particularly in sub-Saharan Africa. To implement efficient disease control measures, detection of the pathogens and understanding pathogen spatio-temporal dynamics is crucial and requires the use of molecular detection tools, especially to distinguish different pathogens causing more or less similar symptoms. We report here the design a new molecular diagnostic tool able to simultaneously detect five bacterial taxa causing important diseases on rice in Africa: (1) Pseudomonas fuscovaginae, (2) Xanthomonas oryzae, (3) Burkholderia glumae and Burkholderia gladioli, (4) Sphingomonas and (5) Pantoea species. This new detection tool consists of a multiplex PCR, which is cost effective and easily applicable. Validation of the method is presented through its application on a global collection of bacterial strains. Moreover, sensitivity assessment for the detection of all five bacteria is reported to be at 0.5 ng DNA by μl. As a proof of concept, we applied the new molecular detection method to a set of 256 rice leaves collected from 16 fields in two irrigated areas in western Burkina Faso. Our results show high levels of Sphingomonas spp. (up to 100% of tested samples in one field), with significant variation in the incidence between the two sampled sites. Xanthomonas oryzae incidence levels were mostly congruent with bacterial leaf streak (BLS) and bacterial leaf blight (BLB) symptom observations in the field. Low levels of Pantoea spp. were found while none of the 256 analysed samples was positive for Burkholderia or Pseudomonas fuscovaginae. Finally, many samples (up to 37.5% in one studied field) were positive for more than one bacterium (co-infection). Documenting co-infection levels are important because of their drastic consequences on epidemiology, evolution of pathogen populations and yield losses. The newly designed multiplex PCR for multiple bacterial pathogens of rice is a significant improvement for disease monitoring in the field, thus contributing to efficient disease control and food safety.
Crop diseases are responsible for considerable yield losses worldwide and particularly in sub-Saharan Africa. To implement efficient disease control measures, detection of the pathogens and understanding pathogen spatio-temporal dynamics is crucial and requires the use of molecular detection tools, especially to distinguish different pathogens causing more or less similar symptoms. We report here the design a new molecular diagnostic tool able to simultaneously detect five bacterial taxa causing important diseases on rice in Africa: (1) Pseudomonas fuscovaginae, (2) Xanthomonas oryzae, (3) Burkholderia glumae and Burkholderia gladioli, (4) Sphingomonas and (5) Pantoea species. This new detection tool consists of a multiplex PCR, which is cost effective and easily applicable. Validation of the method is presented through its application on a global collection of bacterial strains. Moreover, sensitivity assessment for the detection of all five bacteria is reported to be at 0.5 ng DNA by μl. As a proof of concept, we applied the new molecular detection method to a set of 256 rice leaves collected from 16 fields in two irrigated areas in western Burkina Faso. Our results show high levels of Sphingomonas spp. (up to 100% of tested samples in one field), with significant variation in the incidence between the two sampled sites. Xanthomonas oryzae incidence levels were mostly congruent with bacterial leaf streak (BLS) and bacterial leaf blight (BLB) symptom observations in the field. Low levels of Pantoea spp. were found while none of the 256 analysed samples was positive for Burkholderia or Pseudomonas fuscovaginae. Finally, many samples (up to 37.5% in one studied field) were positive for more than one bacterium (co-infection). Documenting co-infection levels are important because of their drastic consequences on epidemiology, evolution of pathogen populations and yield losses. The newly designed multiplex PCR for multiple bacterial pathogens of rice is a significant improvement for disease monitoring in the field, thus contributing to efficient disease control and food safety.
Over the last 20 years, West Africa has specifically experienced a large surge in rice consumption, with average increase of 4.6% each year [1]. This is a consequence of demographic growth, but also of habit changes resulting from urbanization, where the people prefer fast-prepared food such as rice, compared to other cereals such as maize, millet or sorghum. With such a growing demand, local rice production, which accounted for 80% of the demand in the 1960s, has now dropped to only 60% [1]. In reaction to the 2008 food crisis, West African states are developing ambitious projects to increase local rice production and to decrease their dependency to worldwide rice market [2]. Areas cultivated with rice have increased dramatically and rice cultivation is intensifying [3, 4]. In Burkina Faso, rice-growing areas increased by three-fold between 2006 and 2010 (FAOSTAT database), thanks to the additional areas developed to grow rainfed lowland rice.The increase of rice-growing areas and intensification of rice production constitute major agricultural changes, and such modifications can make rice more vulnerable to several diseases [5]. According to Savary et al. 2019, global yield losses due to pathogens and pests in rice are estimated at 30% (range: 24.6–40.9%) worldwide and were even higher in sub-Saharan Africa [6]. In particular, several diseases caused by bacterial pathogens can significantly reduce rice yields.Major bacterial diseases of rice are Bacterial Leaf Blight (BLB) and Bacterial Leaf Streak (BLS), caused by two pathovars of Xanthomonas oryzae: X. oryzae pv. oryzae (Xoo) and X. oryzae pv. oryzicola (Xoc), respectively. Yield loss due to BLB may reach 50% in susceptible varieties under favorable environmental conditions [7]. In West Africa, BLB was first reported in Mali in 1979 [8]. BLS was first detected in Mali in 2003 [9] and 2009 in Burkina Faso [10] and is now considered as an emerging disease [11]. Promising sources of resistance to these bacterial diseases were identified [12] but the deployment of efficient control strategies based on genetic resistances relies on profound knowledge of the epidemiological situation in the targeted locations.In addition to X. oryzae, different species of Pantoea [13], and Sphingomonas [14] genera were recently described to be responsible for BLB-like symptoms in rice. Either Pantoea stewartii, P. ananatis and P. agglomerans were identified as causing leaf blight disease in different countries worldwide [15, 16] and in particular in Africa [17, 18]. The taxonomy of Sphingomonas species causing BLB-like symptoms have also been detected on rice seeds from eight African countries [14], but only a few isolates were described as plant pathogens. Sphingomonas and Pantoea spp. have been frequently isolated from rice seeds in India [19] and Africa [20]. The importance of Pantoea and Sphingomonas species as rice pathogens in West Africa, compared to the well-known devastating Xanthomonas bacteria, remains to be documented and specific molecular detection tools are critical to this purpose.The species Pseudomonas fuscovaginae is responsible for bacterial sheath brown rot of rice. However, other pathogens, such as Sarocladium oryzae and Fusarium spp., cause similar sheath rot symptoms [21]. Bacterial sheath brown rot due to P. fuscovaginae is seed-transmitted. It has so far not been reported in West Africa (CABI 2007, cited by [21]) and is generally associated with high elevation areas (Madagascar [22], East and Central Africa), but it was later found as well in lowlands [21-23].Burkholderia glumae causes bacterial panicle blight of rice, which is an increasingly important disease problem in global rice production [24], especially in the context of global warming and change in environmental conditions [25]. B. gladioli causes a very similar disease of the panicle [26], both species reducing root development, grain weight and inducing inflorescence sterility [27]. Presence of B. glumae on rice in Africa has been reported twice (Burkina Faso [28] and in South Africa [29]), but with no molecular data permitting to confirm the taxonomic affiliation. The high occurrence of B. glumae in Asia and Latin America, however, make the development of an efficient diagnostic tool to detect the disease urgent if it were to gain importance in Africa.Plant disease detection methods are essential for epidemiological surveillance and to facilitate effective management practices [30]. In rice, bacterial pathogens are mostly detected using specific molecular methods focusing on a single genus. In particular, efficient detection protocols are available for X. oryzae [31] and for Pantoea spp. [32]. Few recently introduced methods can simultaneously detect several rice pathogens. One targets three species/pathovars, Xoo, Xoc and B. glumae [33]. Another one focused on three bacterial seed-borne diseases caused by B. glumae, Xoo and Acidovorax avenae subsp. avenae [34]. A third one was designed for simultaneous detection of six bacterial pathogen of rice: Xoo, Xoc, P. fuscovaginae, B. glumae, B. gladioli and A. avenae subsp. avenae [35]. None of existing multiplex PCR assay have focused on the simultaneous detection of these pathogens in Africa. Also none of them included the two bacterial genera Pantoea and Sphingomonas that were recently shown to cause severe symptoms on rice, in West Africa [14, 17, 18], but also in other countries [36-38].We report here the design a simple multiplex PCR scheme, allowing the simultaneous detection of five bacterial taxa causing important diseases on rice in Africa: (1) Pseudomonas fuscovaginae, (2) Xanthomonas oryzae, (3) Burkholderia glumae and Burkholderia gladioli, (4) Sphingomonas and (5) Pantoea species. We validate the new method on a global collection of bacterial strains and we show an example of application with the estimation of incidence levels of three bacterial taxa in two irrigated areas in western Burkina Faso.
Material and methods
Development of new specific DNA primers for Pantoea, Sphingomonas and Burkholderia spp
Table 1 presents the set of primers used that were designed for the diagnostic test. We used various primers from the literature for the detection of X. oryzae [31] and P. fuscovaginae [35]. For other targeted pathogens, we designed new primers in a way that the different DNA fragments could be easily separated and identified by conventional agarose gel electrophoresis following their multiplex PCR amplification.
Table 1
List of the primers used for the multiplex PCR for the detection of multiple bacterial diseases in rice.
Targeted pathogen
Primer's name
Primer's sequences (5′–3′)
Fragment size (bp)
Reference
Pseudomonas fuscovaginae
Pfs207-F
CAGTTCGATGGTCTGGGAAT
710
Cui et al., 2016 [35]
Pfs207-R
GGGACTGGTAAAGCACGGTA
Burkholderia glumae and B. gladioli
toxB_F
GCATTTGAAACCGAGATGGT
508
G. Béna, this study
toxB_Rd
TCGCATGCAGATAACCRAAG
Sphingomonas spp.
Sphingo_KK_F1
CGGCTGCTAATACCGGATGAT
435
K. Kini, this study
Sphingo_KK_R1
AGGCAGTTCTGGAGTTGAGC
Xanthomonas oryzae
Xo3756F
CATCGTTAGGACTGCCAGAAG
331
Lang et al., 2010 [31]
Xo3756R
GTGAGAACCACCGCCATCT
Pantoea spp.
PAN_KK263F
GCGAGCCAATCGACATTA
263
K. Kini, this study
PAN_KK263R
CGAGTAACCTGAGTGTTCAG
For the design of Pantoea spp. specific primers, we targeted a region in the ATP synthase subunit beta AtpD (atpD) gene, which had been exploited for a diagnostic multiplex PCR scheme for three species of plant-pathogenic Pantoea species [32]. Similarly, Sphingomonas-specific primers were designed for the 16S rRNA gene, which had been used for diagnosis of several Sphingomonas species on symptomatic rice leaf samples from eight West African countries [14].Specific primers for both Burkholderia glumae and B. gladioli were designed within the toxoflavin biosynthesis operon. Toxoflavin is a phytotoxin and has been so far detected only in the two closely related species B. glumae and B. gladioli (Béna, pers. com.). It is encoded by a cluster of eleven genes, for both production and secretion of the toxin. We took advantage on the very low nucleotide diversity among all the genomes available so far to design primers within ToxB that is predicted to encode a GTP cyclohydrolase II. We selected one pair of primers with a nearly 100% identity among all sequences available in GenBank (one degenerated site in the reverse primer) resulting in the amplification of a 508 bp fragment.
Multiplex PCR assay optimization
Following the optimization, the final conditions for the multiplex PCR protocol were: 2 μl of DNA added to 23 μl master mix comprising 5 μl Hot Firepol Multiplex Mix ready to load 5X (Solis BioDyne,Tartu, Estonia), 1.25 μl (NH4)2SO4 (160 mM), 0.2 μl of each primers specific of P. fuscovaginae at 5 μM, 0.2 μl of each primers specific of B. glumae and B. gladioli at 100 μM, 0.3 μl of each primers specific of Pantoea spp. at 100 μM and 0.3 μl of each primers specific of X. oryzae at 10 μM and finally 0.1 μl of each primers specific of Sphingomonas spp. at 10 μM.DNA amplification was performed with an Applied Biosystems Veriti 96-Well Thermal Cycler and the following cycles were: 12 min activation at 95°C, 30 cycles of 94°C for 30 sec, 58°C for 30 sec and 72°C for 45 sec and a final extension of 7 min at 72°C. Aliquots (10 μl) of PCR-amplified DNA were analyzed by agarose gel electrophoresis at 100 V for 90 minutes in 0.5X TBE buffer. The size of amplified PCR products was determined by comparing to a 100 bp DNA ladder (Solis BioDyne, Tartu, Estonia). Positive (1 ng DNA of each bacteria) and negative (water) controls were included in each reaction. Multiplex PCR protocol is available at dx.doi.org/10.17504/protocols.io.bcpaivie.
Validation of the multiplex PCR assay by screening a bacterial collection
We applied the newly designed detection test for a collection of 42 isolates of bacteria from 12 different countries. The number of the tested bacterial strains and the countries from which they originated are shown in Table 2. The exhaustive list of isolates is given in S1 Table.
Table 2
Bacterial strains of each targeted taxon used to validate the detection protocol.
For each taxon, the strain used as reference strain for most validation tests appears in bold.
Viet-Nam (NCPPB3923); Japan (LMG2196, CFBP3831); Colombia (3252–8)
8
B. gladioli
Colombia (ABIP15, ABIP49, ABIP128, ABIP 173)
Bacterial strains of each targeted taxon used to validate the detection protocol.
For each taxon, the strain used as reference strain for most validation tests appears in bold.Bacterial isolates were grown on GlucoseYeast Peptone medium for 48 h. DNA extraction was performed on the obtained colonies using Wizard® Genomic DNA Purification Kit (Promega, Madison, Wisconsin, USA), following the manufacturer’s recommendations. Multiplex PCR was performed following the protocol described above. All experiments were repeated twice.
Applying multiplex PCR assay to a set of rice leaves samples from Burkina Faso
The newly designed detection test was applied to a collection of leaves sampled in 2016 in two irrigated rice-growing areas in western Burkina Faso: Banzon (GPS coordinates: N 11.31955; 04.80978) and Karfiguela (GPS coordinates: N 10.68347; W 04.81605). This sample collection follows up the prospections performed in 2015 and described in [39]. We visited all the fields between October 10 and November 30, when rice plants were at maximum number tillage or panicle initiation stage. A regular sampling strategy was adopted with the sampling of 16 plants per field, following a 4x4 grid within 20x20 meters fields. For each of the 16 plants (labelled from A1 to D4), we sampled three leaves (including symptomatic leaves if observed) and kept them dry using a plastic bag containing silica gel for subsequent molecular analyses. Symptom-based incidence was estimated in each field for BLB and BLS by carefully observing plants in the four cells along the diagonal of the 4x4 grid (obtained average incidence resulted from the average of recorded incidence levels over the four cells). Eight fields were studied at each site (16 fields in total over the two sites), the total number of sampled plants consequently being 256 (16 plants in each of eight studied fields at two sites). In every case, we obtained permission from the farmers to work and sample leaves in their fields.DNA extraction was performed for each sample with approximately 20 mg of dried leaves. Samples were ground using the Tissue Lyser II (Qiagen, Inc., Valencia, CA) until a fine powder was obtained. DNA extraction was carried out as described by Li et al. 2008 [40] except that the 2-mercaptoethanol was substituted by 0.5% sodium bisulfite and that the samples were put at -20° C during 30 min after adding isopropanol. We dissolved the pellet in 50 μL sterile water. Obtained DNA was diluted 1:2 and each reaction was performed with 2 μL of DNA. Nucleic acids extraction protocol is available at dx.doi.org/10.17504/protocols.io.bcntiven.Data were analysed using R software [41] and a map reporting diseases incidences was built using Qgis [42]. We used generalised linear mixed model (GLMM) with the library lme4 to test for an effect of the site (two distinct irrigated areas) on the presence/absence of Sphingomonas spp., including the considered field as random factor.
Results
Optimization of the molecular diagnostic protocol
The multiplex PCR protocol allowing for the simultaneous detection of P. fuscovaginae, X. oryzae, Burkholderia (both B. glumae and B. gladioli) as well as Sphingomonas and Pantoea spp. (Fig 1) was used.
Fig 1
Detection of the five bacterial taxa using the newly described multiplex PCR protocol.
L: molecular size marker, 100 bp DNA ladder ready to load, Solis Biodyne, Pfs: P. fuscovaginae strain UBP735, Bg: B. glumae strain NCPPB 3923, Sph: Sphingomonas strain V1-2, Xoc: X. oryzae pv. oryzicola strain BAI10, Pan: Pantoea strain ARC10, Mix: Equal amounts of all five DNA samples.
Detection of the five bacterial taxa using the newly described multiplex PCR protocol.
L: molecular size marker, 100 bp DNA ladder ready to load, Solis Biodyne, Pfs: P. fuscovaginae strain UBP735, Bg: B. glumae strain NCPPB 3923, Sph: Sphingomonas strain V1-2, Xoc: X. oryzae pv. oryzicola strain BAI10, Pan: Pantoea strain ARC10, Mix: Equal amounts of all five DNA samples.We first tested the specificity and the sensitivity of the molecular diagnostic protocol for the simultaneous detection of P. fuscovaginae, X. oryzae, Burkholderia (both B. glumae and B. gladioli) as well as Sphingomonas and Pantoea spp. (Fig 1). The concentration of (NH4)2SO4 (S1 Fig), number of PCR cycles and the annealing temperature were optimized to avoid nonspecific DNA amplification. Addition of 250 ng plant DNA to bacterial DNA did not change the amplification results.The sensitivity of the multiplex PCR was slightly lower than in simplex PCR under the same conditions (Fig 2). Multiplex PCR was able to detect B. glumae and B. gladioli at 50 pg/μl, while 0.5 ng/μl was required for the other four bacteria (P. fuscovaginae, Sphingomonas spp., X. oryzae and Pantoea spp., Fig 2).
Fig 2
Sensitivity of the newly described multiplex PCR method compared to the corresponding simplex PCR for each of the targeted bacterial taxon.
Every reaction was performed with six samples of corresponding control bacteria at different concentrations. Lane 1: 1 ng/μl, lane 2: 0.5 ng/μl, lane 3: 0.1 ng/μl, lane 4: 0.05 ng/μl and lane 5: 0.01ng/μl, lane 6: water control. a-b: P. fuscovaginae strain UBP735, c-d: B. glumae strain NCPPB 3923, e-f: Sphingomonas strain V1-2, g-h: X. oryzae pv. oryzae strain BAI10, i-j: Pantoea strain ARC10. a, c, e, g, i: simplex PCR with only one primer pair in each case. b, d, f, h, j: multiplex PCR including the five primer pairs.
Sensitivity of the newly described multiplex PCR method compared to the corresponding simplex PCR for each of the targeted bacterial taxon.
Every reaction was performed with six samples of corresponding control bacteria at different concentrations. Lane 1: 1 ng/μl, lane 2: 0.5 ng/μl, lane 3: 0.1 ng/μl, lane 4: 0.05 ng/μl and lane 5: 0.01ng/μl, lane 6: water control. a-b: P. fuscovaginae strain UBP735, c-d: B. glumae strain NCPPB 3923, e-f: Sphingomonas strain V1-2, g-h: X. oryzae pv. oryzae strain BAI10, i-j: Pantoea strain ARC10. a, c, e, g, i: simplex PCR with only one primer pair in each case. b, d, f, h, j: multiplex PCR including the five primer pairs.
Application of the molecular diagnostic on dried leaves collected in the field in western Burkina Faso
Nucleic acid extraction was performed on the 256 samples. The average concentration obtained was 271 ng/μL (minimum 33 ng/μL, maximum 932 ng/μL). Multiplex PCR was performed twice on all samples and the repeatability of the results was 91.5% (140 identical results over 153 positive results). We preferred to adopt a conservative approach and considered all the 13 ambiguous results as negative.P. fuscovaginae, B. glumae and B. gladioli were never detected in any of the 256 samples. On the other hand, Sphingomonas spp., X. oryzae and Pantoea spp. were found in 153 (59.8%), 22 (8.6%), and 5 (2.0%) of the 256 samples, respectively. Gel pictures of a few samples as examples appear in S2 Fig. Detailed incidences of the three pathogens are presented in Fig 3, Table 3 and S3 Fig. The average Sphingomonas spp. disease incidence varied between the two studied sites (“Site” effect, chi = 11.2, p < 0.001) with 78.9% of positive plants in Banzon compared to 40.6% in Karfiguela.
Fig 3
Incidence of targeted bacterial taxa in two irrigated areas located in western Burkina Faso.
On the left the irrigated area of Banzon and on the right the irrigated area of Karfiguela. For each studied field, the black dot correspond to the location of the field; incidences for Sphingomonas spp., X. oryzae, and Pantoea spp. are indicated by colored dots from left to right. Gradient of red color indicates increased frequency of positive samples (incidence).
Table 3
Obtained results in the 16 fields surveyed in Southern Burkina Faso: Pathogen incidences derived from the use of the developed molecular diagnostic tool on 16 sampled plants per field, and disease incidence estimated from symptom observations in four cells of the field’s diagonal.
Studied site
Molecular diagnostic results: Number of positive samples (percentage of studied plants)
Estimated disease incidence based on symptom observations
Sphingomonas spp.
Xanthomonas oryzae
Pantoea spp.
Multiple infection of at least 2 out of the 3 bacteria
Incidence of targeted bacterial taxa in two irrigated areas located in western Burkina Faso.
On the left the irrigated area of Banzon and on the right the irrigated area of Karfiguela. For each studied field, the black dot correspond to the location of the field; incidences for Sphingomonas spp., X. oryzae, and Pantoea spp. are indicated by colored dots from left to right. Gradient of red color indicates increased frequency of positive samples (incidence).BLB: Bacterial Leaf Blight symptoms; BLS: Bacterial Leaf StreakWe also assessed multiple infection levels and found that at least two of the three detected bacterial taxa were found in 23 (9.0%) out of the 256 samples, with Sphingomonas always one of the taxa detected. Two plants (0.8%) simultaneously presented all three taxa. Among the 153 samples detected as positive for Sphingomonas spp., 23 (15.0%) were also found positive for at least one other bacterium.Among the 256 plant samples, seven harbored BLS symptoms and five of them were positive for X. oryzae. At the field level, the two fields (KA01 and KA12) that had the highest BLS incidence estimated through symptom observation (95.3% and 40.0%) were also the fields with highest frequency of X. oryzae-positive samples among the 16 analyzed plants (43.8% and 25.0%, respectively, Table 3 and S4 Fig). Apart from these two fields, the highest Xo incidence levels (3/16 = 19%) were found in two fields (BZ06 and BZ12) also has relatively high symptom-based BLB estimates (ca 10%; Table 3 and S4 Fig). We found no clear relationship between BLB symptom-based incidence estimates and either Sphingomonas or Pantoea molecular incidence estimates (Table 3).
Discussion
In the present study, we designed an efficient multiplex PCR method allowing the rapid and simultaneous detection of several important bacterial rice pathogens. The method worked accurately either using bacterial cultures or rice leaves collected in the field. This new molecular detection test was validated on 42 strains of five bacterial taxa (Table 2). The simple and cost-effective CTAB-based protocol enabled extraction of good-quality DNA from rice leaves that was well-suited for subsequent PCR amplification. The designed multiplex PCR required only one reagent: a commercial MasterMix that is cheap and stable at ambient temperature. All this makes this protocol easy-to-use in different labs including those located in low-income countries. With a focus on the major bacterial rice diseases found in Africa, in particular the recently described Pantoea and Sphingomonas spp., this tool will complement already available detection protocols [31-35] for improved diagnostics of bacterial rice diseases and epidemiological surveillance in the field.As a proof of concept, we applied the new assay on a set of 256 samples of rice leaves collected in Burkina Faso rice fields in 2016. Neither Burkholderia glumae and gladioli nor Pseudomonas fuscovaginae were detected in any analyzed samples. The test being highly sensitive, we are confident that these two bacterial taxa were absent from our samples. The sampling protocol (three leaves collected at maximum tiller number / flowering initiation stage) may partly be responsible for these absences of sheat and grain-associated bacteria, although P. fuscovaginae was shown to behave as endophytic bacteria [43]. To date, P. fuscovaginae has not been reported in West Africa (CABI 2007, cited by [21]) and reports of B. glumae in Africa have not been confirmed through molecular data. Detecting any of these two taxa in our samples would consequently have been a surprise, but it was important to include them in the multiplex PCR scheme for further applications on any rice tissue.We found Sphingomonas spp. to be highly frequent, with almost 60% of the rice leaves being positive. However, contrasting average incidence results were obtained in the two studied sites for this pathogen, with higher incidence in the irrigated area of Banzon (78.9%) than that of Karfiguela (40.6%). Further work is required to infer the drivers of this spatial heterogeneity. In addition, the genus Sphingomonas and its pathogenicity remain poorly investigated. Preliminary 16S sequencing analyses of eight African strains showed their membership to the genus Sphingomonas, as they belong to a phylogenetic group that includes many type strains including S. paucimobilis, S. melonis and S. zeae [14]. Further work is required to describe Sphingomonas phylogeny and identify pathogenic species on rice and other crops.Analysis of microbial content of 1916 rice seed samples originating from eleven African countries and received at the Plant Quarantine Unit of AfricaRice Research Station between 2013 and 2016 [20] revealed a high incidence of Pantoea and Sphingomonas (in Benin for example, average 27% and 18.5% infected seeds respectively were detected). Although seed pathogen loads were not tested in this study, we are confident that the newly developed tool will be useful for evaluating the sanitary status of rice seeds.Molecular-based incidence estimates of X. oryzae are globally congruent with symptom observations. Indeed, the two fields presenting the highest molecular-based incidence (KA01 and KA12) were also the ones where we found highest symptom-based incidence for BLS (Table 3 and S4 Fig). BLS symptoms, caused by Xoc, are more specific and easy-to-diagnose than those of BLB, which can be due to Xoo, but also due to Sphingomonas or Pantoea spp. Our results suggest that part of the BLB symptoms may be due to Xoo in several fields (Table 3 and S4 Fig), but additional work is required to decipher relative importance of the other bacterial taxa causing BLB in Africa. Here, the newly designed detection test will certainly be extremely helpful.Although only three out of the five targeted bacterial taxa were detected in analyzed field samples, levels of co-infection were found to be relatively high. Indeed, the samples that were positive for at least two bacteria represented 8% of the total dataset, and up to 37.5% in one particular studied field. Co-infection can significantly affect symptom expression and within-plant pathogen multiplication, as well as epidemiology and the evolution of pathogen populations [44, 45]. Epidemiological survey of bacterial diseases in rice in Burkina Faso will allow a better understanding of the epidemiology of each disease taken separately but also to decipher the interactions between pathogens and their consequences on yield losses and epidemiology.With the ongoing global climate and trade changes, risks of crop disease outbreaks increase and make it even more crucial to have efficient disease detection protocols for the major diseases of important staple crops such as rice. Targeting multiple pathogens at once is a fast and cost-effective strategy to get an exhaustive view on infection status of a sample. Besides this multi-bacteria detection tool, perspectives include the addition of viral and/or fungal primers (into the same or a second multiplex PCR scheme) in order to get a more global information. Such diagnostic tools are key components of a global epidemiological surveillance system for crop diseases [46], which is required to implement effective control strategies contributing to food safety.
Characteristics of all tested bacterial isolates.
(XLSX)Click here for additional data file.
Raw data for the application of the detection test to a set of 256 rice leaves samples collected in western Burkina Faso in 2016.
(XLSX)Click here for additional data file.
Effect of the addition of (NH4)2SO4 the on the sensitivity of the multiplex PCR method.
a: multiplex PCR with (NH4)2SO4; b: multiplex PCR without (NH4)2SO4. Every reaction was performed with a mix of six samples of each control bacterial strain (Pseudomonas fuscovaginae strain UBP735, Burkholderia glumae strain NCPPB 3923, Sphingomonas spp. strain V1-2, Xanthomonas oryzae pv. oryzae strain BAI10, Pantoea ssp. strain ARC10) at different concentrations. Lane 1: 5 ng/μl, lane 2: 1 ng/μl, lane 3: 0.5 ng/μl, lane 4: 0.1 ng/μl and lane 5: 0.05ng/μl, lane 6: water control.(TIF)Click here for additional data file.
Results of the detection method for a few field-collected leaves samples.
Example of detection of different bacterial taxa from field samples. Six samples were chosen to present the different possibilities obtained. L: molecular size marker, 100pb DNA ladder ready to load, Solis Biodyne. M: all five bacterial DNA samples.(TIF)Click here for additional data file.Each panel corresponds to one of the targeted bacterial taxa. For each of the two studied irrigated areas (Sites: Banzon and Karfiguela), both the boxplot, as well as the points corresponding to incidence estimates for each field, are given.(TIF)Click here for additional data file.
Relationship between Xanthomonas oryzae (Xo) incidences derived from the use of the developed molecular diagnostic tool on 16 sampled plants per field, and Bacterial Leaf Blight (BLB) and Bacterial Leaf Streak (BLS) disease incidence estimated from symptom observations in four cells of the field’s diagonal.
Each point corresponds to one field, with BLS incidence estimate based on symptom observations on the x-axis and Xo incidence based on molecular detection on the y-axis (the red dotted line representing the linear regression between the two variables). Color of the points reflects BLB incidence estimate based on symptom observations.(TIF)Click here for additional data file.(PDF)Click here for additional data file.28 Jan 2020PONE-D-19-32664Design of a new multiplex PCR assay for rice pathogenic bacteria detection and its application to infer disease incidence and detect co-infection in rice fields in Burkina FasoPLOS ONEDear Dr Tollenaere,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.We would appreciate receiving your revised manuscript by Mar 13 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Kandasamy UlaganathanAcademic EditorPLOS ONEJournal Requirements:1. When submitting your revision, we need you to address these additional requirements.Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.3. Thank you for stating the following in your Competing Interests section:NoPlease complete your Competing Interests on the online submission form to state any Competing Interests. If you have no competing interests, please state "The authors have declared that no competing interests exist.", as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-nowThis information should be included in your cover letter; we will change the online submission form on your behalf.Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Partly**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: N/A**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: This work is valuable and well written. Authors combined the development of a comprehensive diagnostic tool with field surveys to validate field application and for epidemiological studies. I recommend acceptance with very minor revision.Line33: Were congruent with35: Was P. fuscovaginae expected to be observed on leaves? Since it’s seed/sheath associated?45: average increase of 4.6% each year62: Xanthomonas oryzae: X. oryzae pv. oryzae (Xoo) and X. oryzae pv. oryzicola (Xoc)79: Consider expanding a bit here on the importance of avoiding misidentification of less critical pathogens. Further, since X. oryzae are highly regulated and even considered select agents in the United States, the application of these tools are widely needed.93: Faso [27] – space needed95-96: Latin America, however, make the development of an efficient diagnostic tool to detect the disease urgent if it were to gain importance in Africa.130: selected one pair of199: Perhaps in the discussion you can propose why the sensitivity levels were higher for B. gladioli and glumae271: allow a better understandingCould this assay be converted to Real Time? Likely so, I think authors should discuss this transition and propose as future work for countries and companies with that capability.Table 3: Formatting could be improved for readabilityReviewer #2: Reviewer Comments:The manuscript entitled “Design of a new multiplex PCR assay for rice pathogenic bacteria detection and its application to infer disease incidence and detect co-infection in rice fields in Burkina Faso” by Bangratz M. et al., indicate multiplexing technique used for identification of bacterial pathogen in the rice field. The authors have identified unique refence primers for identification of five texa of plant pathogens viz. Pseudomonas, Xanthomonas, Burkholderia, Sphingomonas, and Pantoea species. The authors standardized PCR condition for multiplexing and used the method to identify bacterial infestation in rice field at Burkina Faso. However, there are some severe concerns about the manuscript that need to be addressed for manuscript to meet applicable standards for publication.Major comments:1. The authors claim that infestation of Sphingomonas or Pantoea spp. leads to bacterial leaf blight (BLB) like phenotype. However, there are not clear evidences to claim it. Please provide some images of leaves showing such BLB like phenotype. It will be good if authors can provide images of phenotype and indicate in which leaf which bacteria/s were observed. Xanthomonas oryzae pv. oryzae is known to cause BLB symptom (disease lesion in the mid-vein). Did the authors perform leaf-clip inoculation experiment and seen the similar BLB like phenotype with Sphingomonas or Pantoea spp.?2. The multiplex PCR is the major finding of this manuscript. However, there is not even a single gel image indicating to diagnose this in the field/infected plants. A figure (gel picture) in main text must be added where template genomic DNA is from the infected plant samples (This should be shown for at least KA02 and KA09: where 3 pathogens have been detected).3. Authors detected only 3 pathogens in the field samples. Is it because of sensitivity of the assay or absence of the pathogen?Authors should infect plants with the pathogen individually, pool the infected parts, isolate genomic DNA and perform the multiplex PCR.4. Line 32-33 and 261-262 and Table 3 data: The data in Table 3 indicates the BLB phenotype is majorly because of Sphingomonas spp. As most of the fields showing BLB phenotype are negative for Xanthomonas in molecular diagnostic (Table 3). In the abstract (lines 32-33) and discussion (Lines 261-262) it is reported that “Xanthomonas oryzae incidence levels were in congruence with bacterial leaf streak (BLS) and bacterial leaf blight (BLB) symptom observations in the field” .5. In Table 3, BLB and BLS column values (such as 17, 95 and 40) are not clear. If 16 plants were observed in the field, what these numbers represent?6. Reduce size of introduction. Precisely reduce the part where details of all diseases is provided (line 61-96). In the last paragraph of introduction, add little details of findings of this manuscript.7. Why there is such a huge variation in primer concentration used for different species?Minor comments1. Line 230; mention ‘42 strains of five bacterial texa’.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: Yes: Jillian M. LangReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.Submitted filename: Reviewer Comments.docxClick here for additional data file.4 Mar 2020Dear,Please find below the reviewer’s comments in black, and our reponses in blue and bold. Line numbers refer to the manuscript with no track changes.Reviewer #1:This work is valuable and well written. Authors combined the development of a comprehensive diagnostic tool with field surveys to validate field application and for epidemiological studies. I recommend acceptance with very minor revision.LineL33: Were congruent withDone.L35: Was P. fuscovaginae expected to be observed on leaves? Since it’s seed/sheath associated?We agree with the reviewer that Pseudomonas fuscovaginae induces specific symptoms on sheath and grain, and not on the leaves. However, the bacterium was shown to be epiphytic and endophytic, and could be detected in rice roots, sheath and leaves (Adorada et al 2015 Plant pathology). We consequently added this reference and discussed this point in the discussion section of the manuscript: L251-254.45: average increase of 4.6% each yearDone.62: Xanthomonas oryzae: X. oryzae pv. oryzae (Xoo) and X. oryzae pv. oryzicola (Xoc)Done.79: Consider expanding a bit here on the importance of avoiding misidentification of less critical pathogens. Further, since X. oryzae are highly regulated and even considered select agents in the United States, the application of these tools are widely needed.We completed the sentence to clarify our point. See L77-79: “The importance of Pantoea and Sphingomonas species as rice pathogens in West Africa, compared to the well-known devastating Xanthomonas bacteria, remains to be documented and specific molecular detection is critical tool to this purpose.”93: Faso [27] – space neededDone.95-96: Latin America, however, make the development of an efficient diagnostic tool to detect the disease urgent if it were to gain importance in Africa.Done.130: selected one pair ofDone.199: Perhaps in the discussion you can propose why the sensitivity levels were higher for B. gladioli and B. glumaeWe don’t have convincing explanation for the higher sensitivity level for B. glumae and B. gladioli compared to other targeted pathogens, so we preferred not to raise this point in the discussion.271: allow a better understandingDone.Could this assay be converted to Real Time? Likely so, I think authors should discuss this transition and propose as future work for countries and companies with that capability.We agree with the reviewer that many detection methods are now involving real time PCR and that it could have been added to the discussion.However, the assay presented here could hardly be converted to real time using the same primers. Indeed, our amplicon size range between 263 and 710, while small amplicons (150 or 200bp at maximum) are required for real-time PCR. Consequently, and because we keep with our goal to design detection methods easily applicable in less equipped labs of southern countries (with INERA lab in Burkina Faso as an example), we preferred not to add this information in the discussion.Table 3: Formatting could be improved for readabilityWe slightly changed the format and feel the readability is improved.Reviewer #2:The manuscript entitled “Design of a new multiplex PCR assay for rice pathogenic bacteria detection and its application to infer disease incidence and detect co-infection in rice fields in Burkina Faso” by Bangratz M. et al., indicate multiplexing technique used for identification of bacterial pathogen in the rice field. The authors have identified unique reference primers for identification of five taxa of plant pathogens viz. Pseudomonas, Xanthomonas, Burkholderia, Sphingomonas, and Pantoea species. The authors standardized PCR condition for multiplexing and used the method to identify bacterial infestation in rice field at Burkina Faso. However, there are some severe concerns about the manuscript that need to be addressed for manuscript to meet applicable standards for publication.Major comments:1. The authors claim that infestation of Sphingomonas or Pantoea spp. leads to bacterial leaf blight (BLB) like phenotype. However, there are not clear evidences to claim it. Please provide some images of leaves showing such BLB like phenotype. It will be good if authors can provide images of phenotype and indicate in which leaf which bacteria/s were observed. Xanthomonas oryzae pv. oryzae is known to cause BLB symptom (disease lesion in the mid-vein). Did the authors perform leaf-clip inoculation experiment and seen the similar BLB like phenotype with Sphingomonas or Pantoea spp.?The work presented did not aim to show the symptom expression of any of the studied bacterial disease, nor to make a new disease report of BLB caused by Sphingomonas or Pantoea spp in Burkina Faso. Instead, we follow-up previously published work showing that Pantoea and Sphingomonas spp are phytopathogenic for rice in Africa (including Burkina Faso) and that the symptoms are BLB-likes.In particular, three articles cited in the manuscript (see the references below, numbers 14, 15 and 18 in the reference list) present some pictures of Pantoea or Sphingomonas infected leaves :Doni F, Suhaimi NSM, Mohamed Z, Ishak N, Mispan MS. Pantoea: a newly identified causative agent for leaf blight disease in rice. Journal of Plant Diseases and Protection. 2019;126(6):491-4. doi: 10.1007/s41348-019-00244-6.Kini K, Agnimonhan R, Dossa R, Soglonou B, Gbogbo V, Ouedraogo I, et al. First report of Sphingomonas sp. causing bacterial leaf blight of rice in Benin, Burkina Faso, The Gambia, Ivory Coast, Mali, Nigeria, Tanzania and Togo. New Disease Reports. 2017;35:32. doi: 10.5197/j.2044-0588.2017.035.032.Kini TK, Agnimonhan R, Afolabi O, Soglonou B, Silue D, Koebnik R. First Report of a New Bacterial Leaf Blight of Rice Caused by Pantoea ananatis and Pantoea stewartii in Togo. Plant Disease. 2017;101(1):241-2. doi: 10.1094/pdis-06-16-0939-pdn.In addition to this, below are some citations of articles describing the symptoms associated with Pantoea or Sphingomonas infected leaves :1) “Lesions appeared first as water-soaked stripes or light brown-to-slightly reddish spots on the upper blades of the leaves, ultimately causing leaf blight” (Lee et al 2010 First Report of leaf blight caused by Pantoea agglomerans on rice in Korea. Plant Disease. 94: 1372–1372).2) “The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis” (Mondal KK, et al 2011. A New leaf blight of rice caused by Pantoea ananatis in India. Plant Disease;95: 1582–1582).3) “we collected leaf samples from Oryza sativa with clear symptoms of severe leaf blight in experimental fields” (González et al 2014 First report of Pantoea agglomerans causing rice leaf blight in Venezuela. Plant Disease. 99: 552–552)4) “The biochemical and molecular analysis revealed that the causal agent was not Xanthomonas oryzae pv oryzae, but a new species of bacterium namely Pantoea stewartii subsp. indolegenes.” (Vinodhini et al 2017 Characterization of new bacterial leaf blight of rice caused by Pantoea stewartii subsp. indologenes in Southern Districts of Tamil Nadu. IJEAB. 2: 239027.)5) “Symptoms included yellow-brown discolourations along one of the two leaf blades, turning brown to dark-brown with age (Fig. 1). Severely affected leaves developed necrotic patches and died” […] “Initial disease symptoms appeared five days after inoculation (DAI), the leaf blade turned yellowish above the inoculation point and this progressed towards the leaf tip (Fig. 3). Blighted leaves, brown to dark-brown necrosis on the entire leaves above and sometimes below the inoculation point, were observed 15-21 DAI on susceptible rice accessions” (Kini K, Agnimonhan R, Dossa R, Soglonou B, Gbogbo V, Ouedraogo I, et al. First report of Sphingomonas sp. causing bacterial leaf blight of rice in Benin, Burkina Faso, The Gambia, Ivory Coast, Mali, Nigeria, Tanzania and Togo. New Dis Reps. 2017;35: 32–32)Based on this literature review, we argue in the article that Pantoea sp and Sphingomonas sp are phytopathogenic bacteria of rice and that associated symptoms may be confounded with those caused by X. oryzae pv oryzae (Xoo), and so that the symptoms can be referred to as bacterial leaf blight (BLB)-like.We modified the introduction part to make the point more clear (L70-79) and we added two references (Lee et al 2010 Plant Disease, and González et al 2014 Plant Disease) to complement the literature review.2. The multiplex PCR is the major finding of this manuscript. However, there is not even a single gel image indicating to diagnose this in the field/infected plants. A figure (gel picture) in main text must be added where template genomic DNA is from the infected plant samples (This should be shown for at least KA02 and KA09: where 3 pathogens have been detected).We agree it would improve the manuscript to include a gel image showing the PCR multiplex applied on field samples from Burkina Faso. However, since we already have two figures of gel images in main text, we preferred to put the additional figure as supplementary material (S2Fig).In this new figure, we show as exemples six field samples representing each obtained cases: 1) no bacteria, 2) Sphingomonas spp, Xanthomonas oryzae, and Pantoea spp. 3) Sphingomonas spp. only, 4) Sphingomonas spp and Xanthomonas oryzae, 5) Sphingomonas spp and Pantoea spp and 6) Xanthomonas oryzae only. Reference to this figure appears L215 in the main text.3. Authors detected only 3 pathogens in the field samples. Is it because of sensitivity of the assay or absence of the pathogen?Authors should infect plants with the pathogen individually, pool the infected parts, isolate genomic DNA and perform the multiplex PCR.We are confident in the sensitivity of our method (see Figure 2) and consequently, we think that Pseudomonas fuscovaginae and Burkholderia glumae are not present in the 256 analysed leaf samples. We clarified this point in the discussion (L250-251).As pointed out by reviewer 1, Pseudomonas fuscovaginae leads to specific symptoms on sheath and grain, and not on the leaves. However, the bacterium was shown to be epiphytic and endophytic, and could be detected in rice roots, sheath and leaves (Adorada et al 2015 Plant pathology). Actually, Pseudomonas fuscovaginae is known to be present in 31 countries (BABI 2007 cited in Bigirimana et al 2015 Frontiers in Plant Science), but not any of these 31 countries are in West Africa. Consequently, it was actually quite unlikely to find P. fuscovaginae in our field samples from Burkina Faso.Similarly, Burkholderia glumae and B. gladioli have been mostly isolated from infected panicle. Only two studies reported these bacteria in Africa and none of them includes molecular data. So it would also have been a surprise to find Burkholderia glumae and B. gladioli in our field samples from Burkina Faso.We add a paragraph discussing these points in the manuscript: L249-258.We performed preliminary experimental infections and analysis of infected leaf samples for Xanthomonas oryzae, the bacteria we have been mostly working with in our lab and it worked with no problem. We did not follow-up this methodology but instead compared the DNA obtained from bacterial cultures to DNA from bacterial culture with addition of plant DNA and sensitivity did not change. This is stated in the manuscript L199-200: “Addition of 250 ng plant DNA to bacterial DNA did not change the amplification results.”4. Line 32-33 and 261-262 and Table 3 data: The data in Table 3 indicates the BLB phenotype is majorly because of Sphingomonas spp. As most of the fields showing BLB phenotype are negative for Xanthomonas in molecular diagnostic (Table 3). In the abstract (lines 32-33) and discussion (Lines 261-262) it is reported that “Xanthomonas oryzae incidence levels were in congruence with bacterial leaf streak (BLS) and bacterial leaf blight (BLB) symptom observations in the field”.We do not agree with the following assertion “The data in Table 3 indicates the BLB phenotype is majorly because of Sphingomonas spp. As most of the fields showing BLB phenotype are negative for Xanthomonas in molecular diagnostic (Table 3)”. Indeed, among the 16 studied field, 11 fields had BLB symptom observations but in four of them the incidence estimate is very low (1%), and if considering the seven fields with more than 2% BLB incidence estimate, four of them (more than half) had some plants positive for Xanthomonas oryzae in multiplex PCR. Three of these four fields had no BLS symptoms and consequently Xo molecular detection is likely attributed to Xanthomonas oryzae pv oryzae.We tried to make this point on the relationship between molecular detection and symptoms more clear in the manuscript by adding a new additional figure (S3 Figure). Also, the text has been updated to be clearer on the point of relationship between symptoms and molecular detection results: see in the results section L228-232: “Apart from these two fields, the highest Xo incidence levels (3/16 = 19%) were found in two fields (BZ06 and BZ12) also has relatively high symptom-based BLB estimates (ca 10%; Table 3 and S3 Fig). We found no clear relationship between BLB symptom-based incidence estimates and either Sphingomonas or Pantoea molecular incidence estimates (Table 3).” We added a reference to the new additional figure in the discussion part (see the paragraph on this topic L274-282).Finally, we agree with the reviewer that molecular detection data and symptom observations were not perfectly congruent and we consequently slightly changed the sentence in the abstract (L33), we changed “were congruent” by “were mostly congruent”.5. In Table 3, BLB and BLS column values (such as 17, 95 and 40) are not clear. If 16 plants were observed in the field, what these numbers represent?The incidence estimates are based on symptom observation in four (5meters*5meters) cells of the diagonal of the grid. This is mentioned in the material and methods section L171-173: “Symptom-based incidence was estimated in each field for BLB and BLS by carefully observing plants in the four cells along the diagonal of the 4x4 grid (obtained average incidence resulted from the average of recorded incidence levels over the four cells).”We complemented the legend of Table 3 to make it clearer, see L329-332: “Table 3: Obtained results in the 16 fields surveyed in Southern Burkina Faso: pathogen incidences derived from the use of the developed molecular diagnostic tool on 16 sampled plants per field, and disease incidence estimated from symptom observations in four cells of the field’s diagonal”.6. Reduce size of introduction. Precisely reduce the part where details of all diseases is provided (line 61-96). In the last paragraph of introduction, add little details of findings of this manuscript.We agree with the reviewer that the part of the introduction describing the targeted bacterial diseases was quite long and we followed the recommendation to reduce it. In particular, various sentences were shortened, and one was removed (“The genus Burkholderia comprises several rice pathogenic bacteria, while the sister genus Paraburkholderia includes phytobeneficial species”). See L61-93.Also, as recommended, we add two sentences stating the major findings of the manuscript at the end of the introduction, see L107-112.7. Why there is such a huge variation in primer concentration used for different species?We agree with the reviewer that there is important variation in primer concentration. The primer concentration presented in the article are the result of a gradual empirical adjustment of relative concentrations to obtain comparable sensitivity for each taxa.Minor comments1. Line 230; mention ‘42 strains of five bacterial texa’.Done.Submitted filename: reviewers_reponses.docxClick here for additional data file.8 Apr 2020Design of a new multiplex PCR assay for rice pathogenic bacteria detection and its application to infer disease incidence and detect co-infection in rice fields in Burkina FasoPONE-D-19-32664R1Dear Dr. Tollenaere,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Kandasamy UlaganathanAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: Yes: Jillian M. Lang15 Apr 2020PONE-D-19-32664R1Design of a new multiplex PCR assay for rice pathogenic bacteria detection and its application to infer disease incidence and detect co-infection in rice fields in Burkina FasoDear Dr. Tollenaere:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Kandasamy UlaganathanAcademic EditorPLOS ONE
Authors: Z Cui; M R Ojaghian; Z Tao; K U Kakar; J Zeng; W Zhao; Y Duan; C M Vera Cruz; B Li; B Zhu; G Xie Journal: J Appl Microbiol Date: 2016-05 Impact factor: 3.772
Authors: Jillian M Lang; John P Hamilton; Maria Genaleen Q Diaz; Marie Anne Van Sluys; Ma Ruby G Burgos; Casiana M Vera Cruz; C Robin Buell; Ned A Tisserat; Jan E Leach Journal: Plant Dis Date: 2010-03 Impact factor: 4.438
Authors: Mohamad Syazwan Ngalimat; Erneeza Mohd Hata; Dzarifah Zulperi; Siti Izera Ismail; Mohd Razi Ismail; Nur Ain Izzati Mohd Zainudin; Noor Baity Saidi; Mohd Termizi Yusof Journal: Microorganisms Date: 2021-03-26