Literature DB >> 32332737

Uncoupling of invasive bacterial mucosal immunogenicity from pathogenicity.

Simona P Pfister1,2, Olivier P Schären1,2, Luca Beldi1, Andrea Printz1, Matheus D Notter1,2, Mohana Mukherjee1,2, Hai Li3, Julien P Limenitakis3, Joel P Werren1,2, Disha Tandon1,2, Miguelangel Cuenca1, Stefanie Hagemann1, Stephanie S Uster1, Miguel A Terrazos1, Mercedes Gomez de Agüero3, Christian M Schürch4,5,6, Fernanda M Coelho1, Roy Curtiss7, Emma Slack8, Maria L Balmer9, Siegfried Hapfelmeier10.   

Abstract

There is the notion that infection with a virulent intestinal pathogen induces generally stronger mucosal adaptive immunity than the exposure to an avirulent strain. Whether the associated mucosal inflammation is important or redundant for effective induction of immunity is, however, still unclear. Here we use a model of auxotrophic Salmonella infection in germ-free mice to show that live bacterial virulence factor-driven immunogenicity can be uncoupled from inflammatory pathogenicity. Although live auxotrophic Salmonella no longer causes inflammation, its mucosal virulence factors remain the main drivers of protective mucosal immunity; virulence factor-deficient, like killed, bacteria show reduced efficacy. Assessing the involvement of innate pathogen sensing mechanisms, we show MYD88/TRIF, Caspase-1/Caspase-11 inflammasome, and NOD1/NOD2 nodosome signaling to be individually redundant. In colonized animals we show that microbiota metabolite cross-feeding may recover intestinal luminal colonization but not pathogenicity. Consequent immunoglobulin A immunity and microbial niche competition synergistically protect against Salmonella wild-type infection.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32332737      PMCID: PMC7181798          DOI: 10.1038/s41467-020-15891-9

Source DB:  PubMed          Journal:  Nat Commun        ISSN: 2041-1723            Impact factor:   14.919


Introduction

Mounting a functional anti-microbial adaptive immune response depends on concomitant induction of an innate immunogenic response through pattern recognition receptor (PRR) activation[1]. PRRs sense conserved microbial molecular structures, such as bacterial lipopolysaccharide (LPS), peptidoglycan, and flagellin, that are conserved across pathogenic and non-pathogenic microorganisms[2]. Pathogen-specific virulence factors such as type 3 secretion system (T3SS) components[3] and intracellular toxin action have also been shown to be specifically sensed by PRRs[4,5]. The integration of diverse PRR signals is believed to regulate immune responses according to the nature of the microbial threat[6,7]. Natural and artificial PRR signaling agonists are consequently exploited pharmaceutically as pro-immunogenic additives or adjuvant components of vaccines[8]. Besides the immunogenic response, PRR activation by pathogens may also drive inflammation and innate anti-microbial defense. This arm of the innate immune system is important for the control of primary pathogen infection, but is also responsible for the adverse effects of inflammation and defense that damage host tissue and symbiotic microbiota, which may be exploited by some mucosal pathogens[9]. The intestinal mucosal membranes are colonized continuously with a diverse symbiotic microbiota and are guarded by a complex mucosal immune system. The mucosa is well adapted to stable symbiosis with non-pathogenic microbes. Multiple physical and chemical barriers as well as active immune tolerance avoid the unnecessary activation of immune defense mechanisms by harmless symbiotic microbes or food antigens[10]. Only virulent mucosal pathogens normally induce inflammatory responses. Avirulent, fully attenuated pathogens are inefficient at driving inflammation, but also tend to induce less effective adaptive immunity than virulent pathogens[11,12]. It is consequently difficult to induce protective mucosal immunity safely with adequately attenuated live vaccines—this compromises vaccination efforts in developing countries for which safe, effective, and easy-to-administer oral vaccines are urgently needed[13,14]. While there is a clear difference between the immune responses induced by virulent and non-virulent variants of a pathogenic bacterium, it is unclear which aspects of bacterial virulence may be differentially sensed by the immune system to induce efficacious adaptive immunity. Virulence factors enable pathogens to colonize privileged body sites, overgrow host defenses, and consequently damage host tissue architecture and function. Inactivated (killed) pathogenic microbes are avirulent, because they are sterile and most virulence mechanisms (apart from, for example, stable exotoxins) are dependent on bacterial viability. Our question was whether a pathogen that combines sterility and viability, which expresses molecularly functional virulence factors in vivo but is unable to replicate, still retains its mucosal immunogenicity. To address this question, we apply a quantitative Salmonella enterica serovar Typhimurium (STm) infection model in germ-free mice in which live bacterial replication in vivo is blocked. We use auxotrophic mutants of STm (STmAux) that are genetically engineered to be fully replication incompetent in germ-free animals and host tissues. As we previously established in non-pathogenic enterobacteria[15,16], STmAux colonization in germ-free mice is limited by the quantity of the bacterial inoculum and fully transient, allowing the germ-free host to return to germ-free status. Using germ-free mice, this experimental approach allows us to rigorously test the following issues. First, whether the mucosal immunogenic response can distinguish between virulence factor proficient and deficient intestinal bacteria also in the absence of an acute inflammatory response and pathology. Secondly, whether the remaining immunogenic response would depend on similar PRR signaling pathways as the innate immune defense. These fundamental studies are carried out in a germ-free setting, to avoid the possible confounding effect of auxotrophic metabolite crossfeeding by bacteria of the gut microbiota in vivo. Extending our results into colonized mice, we move on to show that indeed crossfeeding by the microbiota can recover efficient intestinal colonization, but not pathogenicity of STmAux. Strictly confined by the mucosal barrier it then combines virulence factor-dependent immunogenicity and avirulence with the added benefit of pathogen niche competition.

Results

Proliferation-incompetent STmAux induces functional immunity

Mucosal tissue invasion and virulence of STm are mediated by two type 3 secretions systems (T3SS) encoded on Salmonella pathogenicity islands, SPI1 and SPI2 (refs. [3,17-19]). Activity of the SPI1-encoded T3SS induces early mucosal inflammation[20,21]. As the invading and tissue-overgrowing virulent bacteria responsible are subject to pronounced population bottle necks[3,22], we hypothesized that a strain of live STm encoding functional virulence factors would retain its invasiveness with associated adaptive immunogenicity, despite being unable to replicate and overall avirulent. To test this hypothesis we generated an auxotrophic STm strain (STmAux) that strictly requires supplementation with the essential peptidoglycan constituents d-alanine (d-Ala) and meso-diaminopimelic acid (m-Dap) to grow and survive cell division (Supplementary Fig. 1A, B). Like the homologous model in commensal Escherichia coli developed previously[15,16], STmAux colonized the gastrointestinal tract of germ-free mice only transiently, allowing rapid and full recovery to germ-free status, as neither host metabolism nor diet could substitute the auxotrophic requirement for these metabolites (Fig. 1a, b). Salmonella T3SS competence or deficiency had no effect on STmAux colonization kinetics. Bacterial quantitation in small intestinal (Supplementary Fig. 2A) and cecal (Supplementary Fig. 2B) contents at early time points revealed small intestinal transit of STmAux in quantities similar to wild-type STm until 2.5 h following inoculation. At 4.5 h, STmAux had transited from the small intestine into cecum without evidence for replication (Supplementary Fig. 2A, B; compare STmAux numbers between small intestine at 2.5 h and cecum at 4.5 h), whereas wild-type STm populations had begun to expand in the cecum. By 34 h after inoculation wild-type STm stably colonized all intestinal segments, whereas STmAux densities had sharply declined. No spontaneous d-Ala/m-Dap-independent revertants have been isolated ex vivo during these experiments.
Fig. 1

Transient colonization of GF mice with STmAux.

a Mice were inoculated at day 0 with 1010 CFU of either auxotrophic (Aux; red symbols) or non-auxotrophic control (black symbols) STm strains that were either type 3 secretion competent (STm/STmAux, filled symbols) or isogenic type 3 secretion-deficient mutants (STmT3SS−/STmAux T3SS−, open symbols). b Time course of viable bacteria of each strain recoverable from feces (STmAux n = 32, STmAux T3SS− n = 15, STmT3SS− n = 12, STm n = 11, animals examined over nine independent experiments). c Lipocalin-2 concentration in cecal contents at 9 h after inoculation (STmAux n = 5, STmT3SS− n = 5, STm n = 5 animals). d Cecal histopathology score at 9 h after inoculation. Each symbol represents one individual (STmAux n = 5, STmT3SS− n = 5, STm n = 5 animals). e Cecal histology at 9 h after inoculation with indicated STm strains. H&E staining. Scale bar: 100 μm (STmAux n = 5, STmT3SS− n = 5, STm n = 5 animals). f Organ loads of T3SS-proficient STmAux and STm in mLN, liver, and spleen on day 1 (mLN: STmAux n = 18, STm n = 3; liver: STmAux n = 6, STm n = 2; spleen: STmAux n = 9, STm n = 3 animals examined over four independent experiments) and 3 (mLN: STmAux n = 2, STm n = 3; liver: STmAux n = 2, STm n = 3; spleen: STmAux n = 2, STm n = 3 animals examined over two independent experiments) post inoculation. g Immunofluorescence of HeLa cells infected for 2 h with wild type (STm), SPI1 T3SS-deficient (STmΔ), auxotrophic SPI1 T3SS-proficient (STmAux), and auxotrophic SPI1 T3SS-deficient (STmAux Δ) STm. Cells were stained with DAPI (DNA/nuclei, blue), and with anti-STm group B antiserum and labeled secondary antibodies consecutively before, and after membrane permeabilization to differentiate extracellular (red + green) and intracellular (green only) STm. Scale bar: 10 µm (six samples were examined over two independent experiments for each condition). h Quantification of gentamicin-protected intracellular STmAux ΔinvC (black open circles, n = 6 wells examined over two independent experiments), STmΔinvC (black filled circles, n = 6 wells examined over two independent experiments), STmAux (red open triangles, n = 6 wells examined over two independent experiments), and STmΔinvC (red filled triangles, n = 6 wells examined over two independent experiments) in HeLa cells 2 h after infection. Statistics: bars indicate mean (c, f, h) or median (d) values. Horizontal dotted lines indicate the lower limit of detection (b, c, f, h). Panel c was analyzed with ordinary one-way ANOVA and Tukey’s test for multiple comparison. Panel d was analyzed with a two-sided multicomparison Kruskal–Wallis test and Dunn’s post hoc test. Panel f was analyzed with unpaired two-tailed t-test for each day. Panel h was analyzed with two-way ANOVA (virulence and auxotrophy as the two factors) and Sidak multiple comparison correction. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file.

Transient colonization of GF mice with STmAux.

a Mice were inoculated at day 0 with 1010 CFU of either auxotrophic (Aux; red symbols) or non-auxotrophic control (black symbols) STm strains that were either type 3 secretion competent (STm/STmAux, filled symbols) or isogenic type 3 secretion-deficient mutants (STmT3SS−/STmAux T3SS−, open symbols). b Time course of viable bacteria of each strain recoverable from feces (STmAux n = 32, STmAux T3SS− n = 15, STmT3SS− n = 12, STm n = 11, animals examined over nine independent experiments). c Lipocalin-2 concentration in cecal contents at 9 h after inoculation (STmAux n = 5, STmT3SS− n = 5, STm n = 5 animals). d Cecal histopathology score at 9 h after inoculation. Each symbol represents one individual (STmAux n = 5, STmT3SS− n = 5, STm n = 5 animals). e Cecal histology at 9 h after inoculation with indicated STm strains. H&E staining. Scale bar: 100 μm (STmAux n = 5, STmT3SS− n = 5, STm n = 5 animals). f Organ loads of T3SS-proficient STmAux and STm in mLN, liver, and spleen on day 1 (mLN: STmAux n = 18, STm n = 3; liver: STmAux n = 6, STm n = 2; spleen: STmAux n = 9, STm n = 3 animals examined over four independent experiments) and 3 (mLN: STmAux n = 2, STm n = 3; liver: STmAux n = 2, STm n = 3; spleen: STmAux n = 2, STm n = 3 animals examined over two independent experiments) post inoculation. g Immunofluorescence of HeLa cells infected for 2 h with wild type (STm), SPI1 T3SS-deficient (STmΔ), auxotrophic SPI1 T3SS-proficient (STmAux), and auxotrophic SPI1 T3SS-deficient (STmAux Δ) STm. Cells were stained with DAPI (DNA/nuclei, blue), and with anti-STm group B antiserum and labeled secondary antibodies consecutively before, and after membrane permeabilization to differentiate extracellular (red + green) and intracellular (green only) STm. Scale bar: 10 µm (six samples were examined over two independent experiments for each condition). h Quantification of gentamicin-protected intracellular STmAux ΔinvC (black open circles, n = 6 wells examined over two independent experiments), STmΔinvC (black filled circles, n = 6 wells examined over two independent experiments), STmAux (red open triangles, n = 6 wells examined over two independent experiments), and STmΔinvC (red filled triangles, n = 6 wells examined over two independent experiments) in HeLa cells 2 h after infection. Statistics: bars indicate mean (c, f, h) or median (d) values. Horizontal dotted lines indicate the lower limit of detection (b, c, f, h). Panel c was analyzed with ordinary one-way ANOVA and Tukey’s test for multiple comparison. Panel d was analyzed with a two-sided multicomparison Kruskal–Wallis test and Dunn’s post hoc test. Panel f was analyzed with unpaired two-tailed t-test for each day. Panel h was analyzed with two-way ANOVA (virulence and auxotrophy as the two factors) and Sidak multiple comparison correction. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file. d-Ala/m-Dap auxotrophic bacteria depleted of d-Ala or m-Dap, analogous to wild-type bacteria exposed to beta-lactam antibiotics, remain active until self-destruction by programmed autolytic cell death occurring at the onset of cell division[16,23]. Accordingly, d-Ala- and m-Dap-depleted STmAux displayed normal cell invasiveness, as demonstrated by immunofluorescence microscopy and gentamicin protection assay (Fig. 1g, h). In germ-free mice, following enteral administration of 1010 colony-forming units (CFU) of STmAux by gavage, the invasive auxotroph was found to be completely avirulent. In contrast to wild-type STm, STmAux was rarely recoverable from mesenteric lymph nodes (mLN), liver, or spleen (Fig. 1f). It no longer induced detectable levels of typhocolitis (inflammation of the cecum, the main enteric histopathology in the non-typhoidal invasive salmonellosis mouse model[24]) as determined either by quantification of cecal luminal inflammation marker lipocalin-2 (Fig. 1c) or by histopathologic scoring (Fig. 1d, e). Quantification of early mRNA markers of chemokine and other innate activation signals in total cecum tissue supported the conclusion that STmAux is avirulent (Supplementary Fig. 2C). Transitory intestinal mucosal conditioning by live STmAux bacteria (Fig. 2a) induced an adaptive immune response highly protective against the re-challenge of the germ-free animals with non-auxotrophic wild-type STm. While immunity had no effect on the large intestinal luminal load of the challenge strain (Fig. 2b), it protected against its intestinal pathogenesis (Fig. 2c, d) and limited penetration to the mLNs, liver, and spleen (Fig. 2e). Protective immunity was associated with high STm-specific titers of intestinal secretory IgA measured by live bacterial flow cytometry[25] (Fig. 2f, g), and was abolished in B cell- and antibody-deficient JH−/− mice (Fig. 2h–j). B and T cell-deficient RAG-deficient mice phenocopied JH-deficient mice (Supplementary Fig. 3A–D). Hence, B cell immunity is functionally required for STmAux-induced intestinal protective immunity. The live STmAux dose–response relationship was examined by comparing the mucosal conditioning with doses of 1010, 108, and 106 live STmAux, which revealed that induction of functional immunity required doses greater than 108 live STmAux (see extended dataset in Supplementary Fig. 4A–G). Thus, STmAux allowed us to probe mucosal immunity in a strictly dose-dependent manner. This data showed the threshold effects of STmAux conditioning in germ-free mice, which would not be achievable with conventional non-auxotrophic bacteria that would exponentially expand rapidly to reach high intestinal densities independently of inoculum size.
Fig. 2

Intestinal conditioning of GF mice with STmAux induces B cell dependent functional intestinal immunity.

a Germ-free mice were enterally conditioned with six doses of 1010 CFU of STmAux (red triangles, n = 5 animals) or were left untreated (gray-filled circles, n = 5 animals). Four weeks after the first treatment (day 0) mice were challenged with wild-type STm (105 CFU) and analyzed 2 days later. Each symbol represents one individual. b Shedding of wild-type STm in feces 1 day after challenge. c Cecal histopathology score at day 2 after challenge. Each symbol represents one individual. d Lipocalin-2 concentration in cecal contents at day 2 after challenge. e Bacterial burden of wild-type STm in mLNs, spleens, and livers at day 2 after challenge. f Intestinal secretory IgA was isolated at day 2 after challenge. IgA binding to wild-type Salmonella was quantified at different antibody concentrations by live bacterial flow cytometry. Connected symbols represent one individual. g STm-specific titer (−logEC50) calculated from the STm-IgA titration curve plotted in Fig. S4J. h Experimental design: Germ-free Jh−/− (open symbols, n = 5 animals) and wild-type control mice (filled symbols, n = 4 animals) were enterally conditioned three times with 1010 CFU of live STmAux. Thirty-three days after the first treatment (day 0) all mice were challenged with of wild-type STm (103 CFU). i Bacterial burden of wild-type STm in mLNs, spleens, and livers at day 3 after challenge. j Lipocalin-2 concentration in cecal contents at day 3 after challenge. Statistics: bars indicate mean (b, d, e, g, i, j) or median (c) values. Horizontal dotted lines indicate the detection limit. Panel c was analyzed with a two-sided Mann–Whitney U-test. Panels d, e, g, i and j were analyzed with the unpaired two-tailed t-test. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file.

Intestinal conditioning of GF mice with STmAux induces B cell dependent functional intestinal immunity.

a Germ-free mice were enterally conditioned with six doses of 1010 CFU of STmAux (red triangles, n = 5 animals) or were left untreated (gray-filled circles, n = 5 animals). Four weeks after the first treatment (day 0) mice were challenged with wild-type STm (105 CFU) and analyzed 2 days later. Each symbol represents one individual. b Shedding of wild-type STm in feces 1 day after challenge. c Cecal histopathology score at day 2 after challenge. Each symbol represents one individual. d Lipocalin-2 concentration in cecal contents at day 2 after challenge. e Bacterial burden of wild-type STm in mLNs, spleens, and livers at day 2 after challenge. f Intestinal secretory IgA was isolated at day 2 after challenge. IgA binding to wild-type Salmonella was quantified at different antibody concentrations by live bacterial flow cytometry. Connected symbols represent one individual. g STm-specific titer (−logEC50) calculated from the STm-IgA titration curve plotted in Fig. S4J. h Experimental design: Germ-free Jh−/− (open symbols, n = 5 animals) and wild-type control mice (filled symbols, n = 4 animals) were enterally conditioned three times with 1010 CFU of live STmAux. Thirty-three days after the first treatment (day 0) all mice were challenged with of wild-type STm (103 CFU). i Bacterial burden of wild-type STm in mLNs, spleens, and livers at day 3 after challenge. j Lipocalin-2 concentration in cecal contents at day 3 after challenge. Statistics: bars indicate mean (b, d, e, g, i, j) or median (c) values. Horizontal dotted lines indicate the detection limit. Panel c was analyzed with a two-sided Mann–Whitney U-test. Panels d, e, g, i and j were analyzed with the unpaired two-tailed t-test. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file.

Optimal protective efficacy of STmAux is viability dependent

We next addressed how relevant STmAux viability is for the induction of functional intestinal immunity. The replication incompetency of live STmAux in germ-free mice allowed us to quantitatively compare the functional effects of mucosal exposure to live versus killed STm: both live and killed STmAux cells are sterile entities in germ-free mice. Parallel groups of germ-free mice were intestinally conditioned by gavage with STmAux inocula administered either live or following inactivation by peracetic acid (PAA) treatment. PAA killing is highly effective and has been shown to preserve mucosally protective STm surface B cell epitopes[26,27]. Naïve germ-free animals served as negative controls. Four weeks after the first treatment, the germ-free animals of all three groups were challenged orally with virulent wild-type STm and studied at days 1 and 4 after the challenge, respectively (Fig. 3a). Compared to live STmAux-conditioned mice, PAA-killed STmAux-induced STm-specific IgA titers were reduced at day 1 of challenge (Fig. 3b, Supplementary Fig. 5). Yet, by day 4 this difference was no longer apparent. However, while pretreatment with either PAA killed or live STmAux were similarly protective against early wild-type STm-induced mucosal inflammation at day 1 after challenge, only live STmAux preconditioning provided effective protection from intestinal pathology and organ infection until day 4 (Fig. 3c–g). Notably, live STmAux-induced immunity not merely delayed the onset of disease, but protected the germ-free mice from lethal STm infection. Live STmAux-conditioned germ-free mice that were followed up for 3 weeks following challenge remained free of macroscopic evidence of severe infection and were recovering at the time of sacrifice (Supplementary Fig. 6). None of these effects were explained by differences in fecal or cecal luminal colonization levels of the challenge strain, which were similar across all experimental groups (Fig. 3h, i, Supplementary Fig. 6B).
Fig. 3

Optimal mucosal efficacy of STmAux is viability dependent.

a Germ-free mice were enterally conditioned with four doses of 1010 CFU STmAux (filled red triangles, n = 10 animals), PAA-killed STmAux (filled blue diamonds, n = 11 animals), or were left untreated (gray-filled circles, n = 10 animals). Four weeks after the first treatment (day 0) mice were challenged with wild-type STm (104 CFU). Mice were sacrificed at day 1 and day 4 after challenge with wild-type STm, respectively. Each symbol represents one individual. b STm-specific titer (logEC50) of intestinal secretory IgA determined by live bacterial flow cytometry. c, d Lipocalin-2 concentration in feces (c) and cecal content (d) at day 0–4 after challenge. (e) Cecal histopathology score at days 1 and 4 after challenge, respectively. Each symbol represents one individual. Data points depicted with an arrow are shown in panel f. f Cecal histology at day 1 and day 4 after challenge, respectively. H&E staining of cryosections. Scale bar = 100 μm. g Bacterial burden of wild-type STm in mLNs, spleens, and livers at days 1 and 4 after challenge, respectively. h Fecal colonization of wild-type STm at days 0–4 after challenge (inset graph: quantification of STmAux in feces at day 0 confirming germ-free status at day 0). i Cecal luminal colonization of wild-type STm at day 4 after challenge. Statistics: bars indicate mean (b–d, g–i) or median values (e). Horizontal, dotted lines indicate the detection limit (b–d, g–i). Panel b was analyzed with an unpaired two-tailed t-test (control group excluded from test). Panels c, d, and g were analyzed with ordinary one-way ANOVA and Dunnett’s post hoc test (comparison to control group). Panel e was analyzed with a two-sided multicomparisons Kruskal–Wallis test and Dunn’s post hoc test. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file.

Optimal mucosal efficacy of STmAux is viability dependent.

a Germ-free mice were enterally conditioned with four doses of 1010 CFU STmAux (filled red triangles, n = 10 animals), PAA-killed STmAux (filled blue diamonds, n = 11 animals), or were left untreated (gray-filled circles, n = 10 animals). Four weeks after the first treatment (day 0) mice were challenged with wild-type STm (104 CFU). Mice were sacrificed at day 1 and day 4 after challenge with wild-type STm, respectively. Each symbol represents one individual. b STm-specific titer (logEC50) of intestinal secretory IgA determined by live bacterial flow cytometry. c, d Lipocalin-2 concentration in feces (c) and cecal content (d) at day 0–4 after challenge. (e) Cecal histopathology score at days 1 and 4 after challenge, respectively. Each symbol represents one individual. Data points depicted with an arrow are shown in panel f. f Cecal histology at day 1 and day 4 after challenge, respectively. H&E staining of cryosections. Scale bar = 100 μm. g Bacterial burden of wild-type STm in mLNs, spleens, and livers at days 1 and 4 after challenge, respectively. h Fecal colonization of wild-type STm at days 0–4 after challenge (inset graph: quantification of STmAux in feces at day 0 confirming germ-free status at day 0). i Cecal luminal colonization of wild-type STm at day 4 after challenge. Statistics: bars indicate mean (b–d, g–i) or median values (e). Horizontal, dotted lines indicate the detection limit (b–d, g–i). Panel b was analyzed with an unpaired two-tailed t-test (control group excluded from test). Panels c, d, and g were analyzed with ordinary one-way ANOVA and Dunnett’s post hoc test (comparison to control group). Panel e was analyzed with a two-sided multicomparisons Kruskal–Wallis test and Dunn’s post hoc test. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file.

Salmonella type 3 secretion signifies robust immunogenicity

We next asked whether or not the viability-dependency of functional mucosal immunogenicity of STmAux is virulence factor related. We hypothesized that host interaction through Salmonella T3SSs (whose function is energy and viability dependent) signifies the functional immunogenicity of live STmAux. If this was true, T3SS deficiency would diminish the mucosal efficacy of live STmAux. We tested this hypothesis by comparing the protective effect of the enteral conditioning of germ-free mice with matching doses of live T3SS-competent and isogenic T3SS-deficient mutant strains of STmAux (STmAux T3SS−). Two different isogenic STmAux T3SS− mutants were tested: a complete SPI1 and SPI2 genomic island deletion mutant (ΔSPI1 ΔSPI1) devoid of T3SS genes entirely[28], and a ΔinvC ΔssaV mutant expressing defective T3SSs[29,30]. Mice treated with equivalent doses of PAA-killed STmAux or naïve mice served as controls. Four weeks after the first treatment, the germ-free animals were enterally challenged with wild-type STm, and studied at days 1 and 3 after challenge (Fig. 4a). Analysis of the severity of challenge infection and mucosal pathology at day 3 revealed that live, T3SS-deficient STmAux strains induced less robust functional protective immunity than T3SS-competent STmAux, and their efficacy against intestinal mucosal pathology (Fig. 4b, c) and bacterial penetration to mLN (Fig. 4d) was no longer significantly better than that of PAA-killed STmAux. Genetic deletion of the three most important SPI1 effector protein genes (sopE, sopE2, and sipA) required for early SPI1 T3SS-mediated intestinal STm pathogenesis[31] also resulted in reduced efficacy (Supplementary Fig. 7). This suggests that not merely immune recognition of a functional T3SS apparatus but rather mucosal pathogenesis-related type 3 effector protein functions are driving the superior immunogenicity of the T3SS-competent STmAux strain.
Fig. 4

Salmonella type 3 secretion signifies robust live STm mucosal immunogenicity.

a Germ-free mice were enterally conditioned with three successive doses of 1010 CFU of live STmAux (red upright triangles, n = 6 animals examined over two independent experiments), live T3SS-double-deficient STmAux (STmAux Δ, orange squares, n = 6 animals examined over two independent experiments), a live STmAux T3SS-double-deficient SPI1/SPI2 double-deletion mutant (STmAux ΔSPI1 ΔSPI2; purple inverted triangles, n = 6 animals examined over two independent experiments), PAA-killed STmAux (blue diamonds, n = 6 animals examined over two independent experiments), or PBS vehicle only (ctrl; gray circles, n = 6 animals examined over two independent experiments). Four weeks after the first treatment (day 0) all mice were challenged with wild-type STm (103 CFU). Mice were analyzed on day 3 after challenge. Each symbol represents one individual. b Lipocalin-2 concentration in cecal contents at day 3 after challenge. c Cecal histopathology score at day 3 after challenge. Each symbol represents one individual. d Bacterial burden of wild-type STm recoverable from mLNs at day 3 after challenge. e STm-specific titer of intestinal secretory IgA at days 1 and 3 after challenge determined by live bacterial flow cytometry. f Rough STm-specific titer of intestinal secretory IgA at day 3 after challenge determined by live bacterial flow cytometry. Statistics: bars indicate mean (b, d, e) or median values (c). Horizontal, dotted lines indicate the detection limit (b, d, e). Panels b, d, and e were analyzed with ordinary one-way ANOVA and Dunnett’s post hoc test (comparison to STmAux group). Panel c was analyzed with a two-sided multicomparisons Kruskal–Wallis test and Dunn’s post hoc test. The data were pooled from three independent experiments. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file.

Salmonella type 3 secretion signifies robust live STm mucosal immunogenicity.

a Germ-free mice were enterally conditioned with three successive doses of 1010 CFU of live STmAux (red upright triangles, n = 6 animals examined over two independent experiments), live T3SS-double-deficient STmAux (STmAux Δ, orange squares, n = 6 animals examined over two independent experiments), a live STmAux T3SS-double-deficient SPI1/SPI2 double-deletion mutant (STmAux ΔSPI1 ΔSPI2; purple inverted triangles, n = 6 animals examined over two independent experiments), PAA-killed STmAux (blue diamonds, n = 6 animals examined over two independent experiments), or PBS vehicle only (ctrl; gray circles, n = 6 animals examined over two independent experiments). Four weeks after the first treatment (day 0) all mice were challenged with wild-type STm (103 CFU). Mice were analyzed on day 3 after challenge. Each symbol represents one individual. b Lipocalin-2 concentration in cecal contents at day 3 after challenge. c Cecal histopathology score at day 3 after challenge. Each symbol represents one individual. d Bacterial burden of wild-type STm recoverable from mLNs at day 3 after challenge. e STm-specific titer of intestinal secretory IgA at days 1 and 3 after challenge determined by live bacterial flow cytometry. f Rough STm-specific titer of intestinal secretory IgA at day 3 after challenge determined by live bacterial flow cytometry. Statistics: bars indicate mean (b, d, e) or median values (c). Horizontal, dotted lines indicate the detection limit (b, d, e). Panels b, d, and e were analyzed with ordinary one-way ANOVA and Dunnett’s post hoc test (comparison to STmAux group). Panel c was analyzed with a two-sided multicomparisons Kruskal–Wallis test and Dunn’s post hoc test. The data were pooled from three independent experiments. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file. As in the previous experiment (Fig. 3b) killed STmAux- as well as STmAux T3SS−-preconditioned mice displayed reduced STm-specific IgA titers at day 1 of challenge (Fig. 4e, Supplementary Fig. 8). Yet, by day 3 mice of all three treatment groups had similar intestinal IgA titers. Immunoglobulin repertoire sequencing analysis of small intestine and mLN revealed overlapping IgA repertoires following mucosal conditioning with live T3SS-competent STmAux- versus T3SS-incompetent STmAux that clustered separately from those of naïve germ-free control mice (Supplementary Fig. 9). Repertoire overlap was measured by calculating the geometric mean of relative overlap frequencies between CDR3 amino acid sequence usage (see Methods section). Preprocessed clonotype amino acid sequences and metadata description are available as supplementary data files (Supplementary Data 1–21). O-serotype specific IgA has been shown previously to be a necessary component of any intestinal immune protection induced by killed or live STm[12,26,27]. O-antigen is a dominant polysaccharide antigen and in binding assays tends to mask other surface epitopes from antibody recognition, which is the basis of O-serotyping. To specifically study O-serotype-independent Salmonella surface binding IgA, germ-free mice were preconditioned with STmAux but challenged with the different Salmonella serotype Enteritidis (SEn) (Supplementary Fig. 10A). The resulting intestinal IgA had reduced surface reactivity towards O-antigen-deficient (rough) STm compared to wild-type (smooth) STm, as expected (Supplementary Fig. 10B, C). However, the non-O-antigen-specific IgA cross-reacted between rough STm and rough SEn (Supplementary Fig. 10B, C). It also cross-reacted with smooth wild-type SEn, suggesting that it contributes to serotype-independent Salmonella surface reactivity (Supplementary Fig. 10B, C). Although the O-serotype-independent IgA component alone is insufficient[12,26,27], it may complement O-antigen-specific IgA in protective mucosal immunity. Supporting this idea, we found that, although both killed and T3SS-deficient STmAux preconditioning at day 3 of challenge resulted in robust IgA titers towards smooth STm (Fig. 4e, panel Day 3), IgA binding to rough STm was significantly reduced (Fig. 4f). These data show that Salmonella T3SS-dependent virulence functions signify the mucosal immunogenic efficacy of life STmAux in absence of inflammation. The underlying T3SS-dependent IgA B cell response is characterized by a less O-antigen-restricted bacterial surface reactivity.

PRR signaling redundancy in induction of immunity

Innate pathogen recognition through PRRs is critical in the defense against primary STm infection. MYD88 knockout mice lacking TLR and IL1R family downstream signaling are consequently severely impaired in innate immunity against mucosal STm infection[17,19]. Canonical Caspase-1-dependent and non-canonical Caspase-11 (Caspase-4 in humans)-dependent inflammasome activation have also been implicated in innate immune control of STm infection[32]. The NLRC4 inflammasome is activated by the SPI1 T3SS needle complex proteins and therefore may mediate innate recognition of T3SS-competent intestinal STm specifically[3]. Moreover, the NOD1/NOD2 nodosome has been reported to respond to bacterial pathogenicity by sensing the cytoplasmic activities of Salmonella SPI1 T3SS-1 effector proteins[4]. Are these also factors individually important for the induction of functional adaptive immunity in the absence of an inflammatory response? To address this we tested the hypothesis that deficiencies for innate recognition pathways critical in innate immune defense also affect induction of functional adaptive immunity by live STmAux. Mice deficient in (i) TLR/IL1R family adaptor proteins MYD88 and TRIF, (ii) Caspase-1 and Caspase-11, (iii) NLRC4, and (iv) NOD1 and NOD2 were derived germ free and compared with innate immunocompetent control mice for their adaptive immune responses towards live STmAux. Using STmAux avoids bacterial overgrowth of severely innate immunodeficient hosts that lack control and containment of intestinal microbes, leading to increased mucosal penetration also of attenuated, avirulent, and commensal bacteria. In MYD88/TRIF double-deficient mice this has been shown to result in abnormally high systemic exposure to gut commensals and consequent compensatory B cell immunity. Involvement of redundant innate signaling pathways triggered by massively increased microbial loads has been postulated to be responsible but has not been characterized further[33]. The STmAux model in germ-free mice, however, uniquely fixes the bacterial load per animal and consequently avoids bacterial overgrowth to skew immune activation. First, germ-free MYD88/TRIF double-deficient and wild-type control mice were enterally conditioned with live STmAux. Four weeks after the first treatment all mice were challenged orally with wild-type STm harboring an intracellularly inducible GFP reporter plasmid (pM973)[17] and studied at day 3 after the challenge (Fig. 5a). Control groups of both genotypes were challenged but without STmAux preconditioning. Quantification of cecal mucosal (Fig. 5b, Supplementary Fig. 11A), mLN, liver, and spleen (Fig. 5c) burdens of STm[pM973] revealed that the induction of functional immunity by live STmAux was robust even in the highly susceptible MYD88/TRIF double-deficient mice. At day 3 post challenge, bacterial loads in mLN, livers, and spleens of STmAux-treated MYD88/TRIF-deficient mice were similar to, and in cecal mucosal tissues even lower than, those in the STmAux-treated wild-type animals. In accordance with this relatively greater effect of STmAux treatment in mutant than wild-type mice, a two-way ANOVA revealed a significant interaction between the effects of genotype and STmAux treatment (p < 0.0001 for all panels; for detailed statistical metrics see Statistical Analysis file  available as Supplementary Information). Quantitation of cecal luminal lipocalin-2 and histopathology scores both confirmed the protective effects of STmAux treatment within each mouse genotype (Supplementary Fig. 11B, C), although these two readouts themselves are MYD88/TRIF-dependent[17,34] and should therefore be compared between both mouse genotypes with caution.
Fig. 5

Mucosal induction of adaptive immunity by live STmAux is robust in MYD88/TRIF double-deficient mice.

a Germ-free MYD88−/−TRIFlps/lps mice (open symbols) and wild-type control mice (filled symbols) were enterally conditioned with three doses of 1010 CFU of live STmAux (red triangles, n = 7 MYD88/TRIF KO animals and n = 9 wild-type animals examined over two independent experiments) or left untreated as controls (gray circles, n = 6 MYD88/TRIF KO animals and n = 10 wild-type animals examined over two independent experiments). Twenty-seven days after the first treatment (day 0) mice were challenged with wild-type STm (103 CFU) harboring ssag::eGFP reporter plasmid pM973. The mice were studied at day 3 after challenge. Each symbol represents one individual. b Quantification of intracellular wild-type STm expressing eGFP in the cecal mucosa. c Bacterial burden of wild-type STm recoverable from mLN, spleen, and liver at day 3 after challenge. Statistics: bars indicate mean (b, c). Horizontal, dotted lines indicate the lower detection limit (b, c). Panels b and c were analyzed with two-way ANOVA (host genotype and treatment as factors) and Sidak multiple comparison correction. The data were pooled from two independent experiments. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file.

Mucosal induction of adaptive immunity by live STmAux is robust in MYD88/TRIF double-deficient mice.

a Germ-free MYD88−/−TRIFlps/lps mice (open symbols) and wild-type control mice (filled symbols) were enterally conditioned with three doses of 1010 CFU of live STmAux (red triangles, n = 7 MYD88/TRIF KO animals and n = 9 wild-type animals examined over two independent experiments) or left untreated as controls (gray circles, n = 6 MYD88/TRIF KO animals and n = 10 wild-type animals examined over two independent experiments). Twenty-seven days after the first treatment (day 0) mice were challenged with wild-type STm (103 CFU) harboring ssag::eGFP reporter plasmid pM973. The mice were studied at day 3 after challenge. Each symbol represents one individual. b Quantification of intracellular wild-type STm expressing eGFP in the cecal mucosa. c Bacterial burden of wild-type STm recoverable from mLN, spleen, and liver at day 3 after challenge. Statistics: bars indicate mean (b, c). Horizontal, dotted lines indicate the lower detection limit (b, c). Panels b and c were analyzed with two-way ANOVA (host genotype and treatment as factors) and Sidak multiple comparison correction. The data were pooled from two independent experiments. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file. We next tested the ability of live STmAux to induce adaptive immunity in NOD1/NOD2-double-knockout mice (Fig. 6a–c), NLRC4-deficient mice, and Caspase-1/11 double-deficient mice (Fig. 6d–f), all of which at day 3 of challenge were found to have no deficiency in mounting functional mucosal immunity towards live STmAux conditioning (two-way ANOVA, for detailed statistical metrics see Statistical Analysis file available in the Supplementary Information).
Fig. 6

NOD1/2, NLRC4 and Caspase-1/11 are individually redundant for mucosal induction of adaptive immunity by live STmAux.

a Germ-free NOD1/2-double-deficient mice (open symbols) and wild-type control mice (filled symbols) were either enterally conditioned with three doses of 1010 CFU of STmAux (red triangles, n = 11 NOD1/2 KO animals and n = 5 wild-type animals examined over two independent experiments) or left untreated (gray circles, n = 11 NOD1/2 KO animals and n = 6 wild-type animals examined over two independent experiments). Twenty-seven days after the first treatment (day 0) all mice were challenged with wild-type STm (103 CFU) and sacrificed at day 3 after challenge. b Bacterial burden of wild-type STm recoverable from mLN, spleen, and liver at day 3 after challenge. c Lipocalin-2 concentration in cecal contents at day 3 after challenge. d Germ-free NLRC4−/− mice (open diamonds), Caspase-1/11−/− mice (CASP1/11−/−, open triangles), and control mice (CASP1/11+/− NLRC4+/+ littermate control mice; filled triangles) were either enterally conditioned with three doses of 1010 CFU of STmAux (red symbols, n = 7 NLRC4−/− animals, n = 7 Caspase-1/11−/−, and n = 7 Caspase-1/11+/− animals examined over two independent experiments) or left untreated (gray symbols, n = 5 NLRC4−/− animals, n = 8 Caspase-1/11−/−, and n = 7 Caspase-1/11+/− animals examined over two independent experiments). Twenty-seven days after the first treatment (day 0) mice were challenged with wild-type STm (103 CFU) and sacrificed at day 3 after challenge. e Bacterial burden of wild-type STm recoverable from mLN, spleen, and liver at day 3 after challenge. f Lipocalin-2 concentration in cecal contents at day 3 after challenge. Each symbol represents one individual. Statistics: bars indicate mean (b, c, e, f). Horizontal, dotted lines indicate the lower detection limit. Panels b, c, e, f were analyzed with a two-way ANOVA (host genotype and treatment as factors) and Sidak multiple comparison correction. The data were pooled from two independent experiments. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file.

NOD1/2, NLRC4 and Caspase-1/11 are individually redundant for mucosal induction of adaptive immunity by live STmAux.

a Germ-free NOD1/2-double-deficient mice (open symbols) and wild-type control mice (filled symbols) were either enterally conditioned with three doses of 1010 CFU of STmAux (red triangles, n = 11 NOD1/2 KO animals and n = 5 wild-type animals examined over two independent experiments) or left untreated (gray circles, n = 11 NOD1/2 KO animals and n = 6 wild-type animals examined over two independent experiments). Twenty-seven days after the first treatment (day 0) all mice were challenged with wild-type STm (103 CFU) and sacrificed at day 3 after challenge. b Bacterial burden of wild-type STm recoverable from mLN, spleen, and liver at day 3 after challenge. c Lipocalin-2 concentration in cecal contents at day 3 after challenge. d Germ-free NLRC4−/− mice (open diamonds), Caspase-1/11−/− mice (CASP1/11−/−, open triangles), and control mice (CASP1/11+/− NLRC4+/+ littermate control mice; filled triangles) were either enterally conditioned with three doses of 1010 CFU of STmAux (red symbols, n = 7 NLRC4−/− animals, n = 7 Caspase-1/11−/−, and n = 7 Caspase-1/11+/− animals examined over two independent experiments) or left untreated (gray symbols, n = 5 NLRC4−/− animals, n = 8 Caspase-1/11−/−, and n = 7 Caspase-1/11+/− animals examined over two independent experiments). Twenty-seven days after the first treatment (day 0) mice were challenged with wild-type STm (103 CFU) and sacrificed at day 3 after challenge. e Bacterial burden of wild-type STm recoverable from mLN, spleen, and liver at day 3 after challenge. f Lipocalin-2 concentration in cecal contents at day 3 after challenge. Each symbol represents one individual. Statistics: bars indicate mean (b, c, e, f). Horizontal, dotted lines indicate the lower detection limit. Panels b, c, e, f were analyzed with a two-way ANOVA (host genotype and treatment as factors) and Sidak multiple comparison correction. The data were pooled from two independent experiments. Source data are provided as a Source Data file. Detailed statistical metrics are available in the Supplementary Statistical Analysis file. These results show that MYD88/TRIF, Caspase-1/Caspase-11 inflammasome, and NOD1/NOD2 nodosome signaling were individually redundant for the induction of adaptive immunity by live STmAux in the absence of inflammation. Their role in complementing adaptive immunity in pathogen clearance at later stages of secondary infection is likely functionally important, although not apparent at day 3 of challenge.

Microbiota-dependent colonization and niche competition

So far, the fully reversible germ-free mouse model uniquely had allowed the quantitative study of the immunogenicity of different phenotypes of STmAux in a very clean system. However, in real-life situations STmAux would interact also with the indigenous gut microbiota, which we hypothesized to provide crossfeeding of the required cell wall metabolites in vivo. This may delay STmAux intestinal luminal clearance in colonized mice. We tested this hypothesis using a well-established gnotobiotic mouse model that is stably colonized with 12 representative murine intestinal taxa [stable defined moderately diverse mouse microbiota (sDMDMm)[35]] all of which are fully sequenced and openly available as pure cultures from the “Deutsche Sammlung von Mikroorganismen und Zellkulturen” (DSMZ)[36,37]. The sDMDMm model has proven merit for the study of intestinal STm infection and its interaction with the commensal microbiota without the need for harsh antibiotic treatments, and shows relevant phenotypic effects such as limiting the colonization of STm[38]. Following a single inoculation with 107 STmAux by gavage, sDMDMm mice showed efficient and stable colonization of STmAux, reaching luminal densities similar to those of isogenic non-auxotrophic strains, including partly attenuated SPI2 TTSS-deficient (ΔssaV) and avirulent SPI1/SPI2 double-deficient (ΔinvC ΔssaV) STm (Fig. 7a). STmAux did not revert to lose its auxotrophic phenotype during these experiments (no recovery of STm growth from ex vivo intestinal samples in non-supplemented control medium). Even STmAux re-isolated from an sDMDMm mouse after 8 months colonized germ-free mice fully reversibly. Following gavage of 1010 CFU of either the 8-month re-isolate or the original lab strain, all mice (n = 5 per group) had recovered to germ-free status at day 2 post inoculation.
Fig. 7

Efficient colonization and immune induction by auxotrophic STm in microbiota-associated mice.

a sDMDMm mice were gavaged with a single dose of 107 CFU of either STmAux (blue open circles, n = 21), STmT3SS− (green squares, n = 9), STmΔssaV (black triangles, n = 5), or wild-type STm (red triangles, n = 6). Time course of viable bacteria of each strain recoverable from feces. b Lipocalin-2 concentration in cecal contents at day 2, 4, and 28 after inoculation with the indicated STm strains. Pictures show representative H&E stainings of ceca at day 4 post inoculation with either STmWT or STmAux. c Representative cecal histology on day 4 after colonization with STmAux, H&E staining, scale bar 100 µm. d Bacterial burden of indicated STm strains recoverable from mLN, spleen, and liver at day 2, 4, and 28 after initial colonization. e Confocal immunofluorescence microscopy of cecum tissue showing an epithelial cell invaded by STmAux. Green, STmAux harboring ssag::eGFP reporter plasmid pM973; blue, DNA (DAPI); gray, F-actin (phalloidin). Dotted yellow lines outline the border of the epithelium facing the intestinal lumen (Lu) and lamina propria (Lp), respectively. Scale bar = 10 µm (n = 6 animals). f Bacterial burden of indicated STm strains recoverable from mLN, liver, and spleen at day 3 post inoculation in MYD88/TRIF double KO mice (n = 3 animals per treatment group). g Wild-type STm-specific titer of intestinal IgA at day 24 post inoculation of sDMDMm mice with either STmAux (blue open circles, n = 3 animals) or STmAux T3SS− (green open squares, n = 5 animals). h sDMDMm mice were inoculated by gavage with a single dose of 107 CFU of either STmAux (blue open circles, n = 5 animals), STmAux T3SS− (green open squares, n = 3 animals), STmAux ΔssaV (black open triangles, n = 4 animals), or left untreated (n = 5 animals), and at day 28 challenged with 107 CFU wild-type STm (red open triangles). Mice were studied 4 days after challenge (day 32). i Lipocalin-2 concentration in cecal contents quantified at day 32 (4 days after challenge). j Bacterial burden of wild-type STm recoverable from mLN, liver, and spleen at day 32. Each symbol represents on individual. Statistics: connecting lines connect means (a, f), bars indicate mean (b–e, g, h). Horizontal dotted lines indicate the lower detection limit (a–h). Panels b–d, g, h were analyzed with a one-way ANOVA and Dunnett’s post hoc test or unpaired two-tailed t-test (b, c, e). Data shown in a–d are pooled from four independent internally controlled experiments. Data shown in h–j were obtained from the same experiment. Source data are provided as a Source Data file. Detailed statistical metrics are reported in the Supplementary Statistical Analysis file.

Efficient colonization and immune induction by auxotrophic STm in microbiota-associated mice.

a sDMDMm mice were gavaged with a single dose of 107 CFU of either STmAux (blue open circles, n = 21), STmT3SS− (green squares, n = 9), STmΔssaV (black triangles, n = 5), or wild-type STm (red triangles, n = 6). Time course of viable bacteria of each strain recoverable from feces. b Lipocalin-2 concentration in cecal contents at day 2, 4, and 28 after inoculation with the indicated STm strains. Pictures show representative H&E stainings of ceca at day 4 post inoculation with either STmWT or STmAux. c Representative cecal histology on day 4 after colonization with STmAux, H&E staining, scale bar 100 µm. d Bacterial burden of indicated STm strains recoverable from mLN, spleen, and liver at day 2, 4, and 28 after initial colonization. e Confocal immunofluorescence microscopy of cecum tissue showing an epithelial cell invaded by STmAux. Green, STmAux harboring ssag::eGFP reporter plasmid pM973; blue, DNA (DAPI); gray, F-actin (phalloidin). Dotted yellow lines outline the border of the epithelium facing the intestinal lumen (Lu) and lamina propria (Lp), respectively. Scale bar = 10 µm (n = 6 animals). f Bacterial burden of indicated STm strains recoverable from mLN, liver, and spleen at day 3 post inoculation in MYD88/TRIF double KO mice (n = 3 animals per treatment group). g Wild-type STm-specific titer of intestinal IgA at day 24 post inoculation of sDMDMm mice with either STmAux (blue open circles, n = 3 animals) or STmAux T3SS− (green open squares, n = 5 animals). h sDMDMm mice were inoculated by gavage with a single dose of 107 CFU of either STmAux (blue open circles, n = 5 animals), STmAux T3SS− (green open squares, n = 3 animals), STmAux ΔssaV (black open triangles, n = 4 animals), or left untreated (n = 5 animals), and at day 28 challenged with 107 CFU wild-type STm (red open triangles). Mice were studied 4 days after challenge (day 32). i Lipocalin-2 concentration in cecal contents quantified at day 32 (4 days after challenge). j Bacterial burden of wild-type STm recoverable from mLN, liver, and spleen at day 32. Each symbol represents on individual. Statistics: connecting lines connect means (a, f), bars indicate mean (b–e, g, h). Horizontal dotted lines indicate the lower detection limit (a–h). Panels b–d, g, h were analyzed with a one-way ANOVA and Dunnett’s post hoc test or unpaired two-tailed t-test (b, c, e). Data shown in a–d are pooled from four independent internally controlled experiments. Data shown in h–j were obtained from the same experiment. Source data are provided as a Source Data file. Detailed statistical metrics are reported in the Supplementary Statistical Analysis file. Despite efficient luminal colonization and evidence for epithelial invasion of STmAux (Fig. 7e), neither deep mucosal penetration to mLN and systemic organs nor mucosal pathology were evident in either wild type (Fig. 7b–d) or MYD88/TRIF-deficient (Fig. 7f) sDMDMm mice. Thus, while crossfeeding by sDMDMm organisms can rescue gut luminal colonization, it was insufficient to recover pathogenicity of STmAux, which is consistent with the local intestinal luminal confinement of the crossfeeding microbiota and the activity of d-amino acid degrading enzymes in host tissues and intestinal mucus[39]. Nevertheless, induction of STm-specific IgA was seen after 4 weeks of colonization, which, in contrast to colonization efficiency, was dependent on SPI1 T3SS competence (Fig. 7g, Supplementary Fig. 12). As an added host benefit, stably colonizing STmAux further provided robust niche competition to a subsequent oral challenge by wild-type STm (Fig. 7h blue symbols, and Supplementary Fig. 13B). Notably, pre-colonization with SPI1 T3SS-incompetent STmAux Δ provided only partial niche competition (Fig. 7h, black symbols, Supplementary Fig. 13B). SPI1/SPI2 double-deficient STmAux T3SS− showed the exact same phenotype (Fig. 7h, green symbols, Supplementary Fig. 13B), supporting the conclusion that SPI1 T3SS-dependent virulence factors are mainly responsible. In RAG knockout mice also T3SS-competent STmAux showed inefficient intestinal niche competition (Supplementary Fig. 14A–D). These findings are consistent with the interpretation that STmAux-induced host immunity synergizes with niche competition by STmAux in protection against wild-type STm challenge. Measurements of cecal luminal lipocalin-2 and challenge bacterial burden in mLN, liver, and spleen at day 4 of wild-type STm challenge support this conclusion (Fig. 7i, j, Supplementary Fig. 14D). In a second context, streptomycin pre-treated conventional mice, a widely used mouse model for nontyphoid invasive salmonellosis[9,24,40], were also permissive for extended gut luminal colonization of STmAux (Supplementary Fig. 13C). These data show that in the colonized mouse model, microbiota-syntrophic STmAux more closely mimics the natural pathogen in terms of intestinal luminal colonization and virulence factor-driven induction of IgA immunity[12]. Thus, independently of germ-free conditions, also stable intestinal STmAux colonization allows uncoupling of intestinal immunogenicity from pathogenicity, with the added benefit of luminal pathogen niche competition.

Discussion

Fully attenuated or inactivated pathogens have long been noted to be poorly protective mucosal immunogens compared to more virulent strains[11-13,41]. This has been attributed mainly to the capacity of virulent pathogens to induce more vigorous innate immune responses[6] and to penetrate into and overgrow inductive sites of the mucosal immune system[11]. Here we show specifically that invasive Salmonella cells expressing live type 3 secretion systems are recognized by the immunogenic response, independently of their propensity to deeply penetrate and replicate as live organisms inside host tissues or the induction of a marked mucosal inflammatory response. These data suggest that the mucosal immune system reacts not only to a damaging infection but can also recognize stereotypic activities of pathogens more directly, and thus potentially more sensitively and rapidly. Consequently, a small number of highly transient mucosal exposures with virulence factor-competent STmAux robustly induce highly effective immunity in germ-free mice, in the absence of an inflammatory response. The underlying B cell response induced by live, virulence factor-competent STmAux is characterized by the production of intestinal IgA with increased O-serotype-independent Salmonella surface reactivity. Additional future work will be required to address which effector T cell activities may additionally contribute to STmAux-induced immunity[42]. It has been described previously that bacterial viability itself is an important determinant of bacterial immunogenicity, independent of pathogenicity and replication competence[43]. Live apathogenic bacteria are more immunogenic live than killed when administered parenterally[43]. This difference was revealed to be mediated by innate immune recognition of bacterial messenger RNA (mRNA), highly unstable, hence normally viability-associated, molecules. The underlying sensing pathway for bacterial mRNA was shown to be dependent on TLR8 and TRIF in humans, and on TRIF, Caspase-1 and Caspase-11 in mice[43-45]. Here we observed only a minor difference in intestinal mucosal immunogenicity between avirulent live and killed STmAux (see Fig. 4), which may be mediated by the same mechanism. Virulence factor-competent invasive STmAux, however, was much more efficacious. Its epithelial invasiveness may increase subepithelial live antigen delivery and consequently prime immunity more efficiently by delivering live bacteria into the tissues. However, its immunogenicity was robust even in MYD88/TRIF and Caspase-1/-11 deficient mice, and thus may not be fully explained by the same live bacterial sensing pathway. Our data confirm and extend previous findings of functional redundancy between innate and adaptive immune responses in the control of intestinal commensal bacteria[33] and the efficacy of established model vaccines with adjuvant[46] in MYD88/TRIF double-deficient mice. Here we show that this extends also to intestinal pathogenic bacteria. The remarkable robustness of this system may represent an evolutionary adaptation to pathogens that evade or alter the innate immune defense. Long-established live STm vaccine strains like SPI2 T3SS-deficient[47] and aromatic amino acid auxotrophic aro mutants[48] of STm also are effective mucosal immunogens, but are not fully growth deficient in host tissues and consequently considered dangerous for HIV positive and other immunocompromised individuals (reviewed in ref. [14]). This has so far ruled out approval for human application. On the other hand, peptidoglycan metabolite auxotrophic STm strains similar to the one we presented in this paper have been developed previously[49] but in this form have been considered insufficiently immunogenic because of their poor mucosal penetration. This conclusion is however predicated on the preclinical study mainly in conventional rodent models that are (like humans) intestinally colonization resistant against Salmonella[9]. In this context, when STmAux proliferation in the intestinal lumen is inhibited by the competing microbiota, its colonization dynamics would be expected to be more similar to the germ-free mouse model, and it may consequently require very high oral doses (as we saw in germ-free mice) to be efficacious. Instead, the field has moved into the direction of developing more sophisticated strains that display regulated delayed in vivo attenuation/lethality phenotypes, allowing for transient survival, replication, and tissue invasion in vivo[11]. These highly innovative approaches are inherently more difficult to combine with safety parameters matching those of the constitutively d-Ala/Dap auxotrophic strain. The presented experiments in non-colonization-resistant mouse models highlight yet another possible strategy. The remarkably efficient gut luminal microbiota-syntrophy permitted extended mucosal stimulation with live virulence factor-competent STmAux, without compromising the strain’s deficiency in causing pathology and systemic infection. This phenotype could potentially be exploited further by metabolic engineering of STmAux strains to gain intestinal colonization efficiency, or by temporal reduction of colonization resistance in the host at the time of treatment (preferably other than by antibiotic treatment). However, given that our conclusions so far are based on mouse models that have laboratory levels of microbiota complexity, additional work in more relevant preclinical models will be necessary to assess potential translatability of these findings for veterinary or human medical applications.

Methods

Bacterial strains, plasmids, and culture media

The bacterial strains and plasmids used in this study are listed in Table 1. Auxotrophic strain HA135 (STmAux, UK-1 background) [ΔmetC::TetRA Δalr ΔdadX Δasd] was generated from strain χ9052 [Δalr3 ΔdadB4 ΔasdA33] by replacing the coding region of metC with a TetRA resistance cassette by Lambda Red recombineering using recombineering plasmid pSIM5 (ref. [50]) as described in ref. [51]. Isogenic mutant alleles ΔinvC::aphT, ΔinvC::aphT ΔssaV::cat, and Δ(avrA-invH::cat) Δ(ssaG-ssaU::aphT) were transferred into the STm and STmAux backgrounds by phage P22-mediated transduction using the donor strains M736, M73831 and χ9650 (ref. [28]), respectively, as described[52]. Auxotrophic strain HA623 (SL1344 background) [ΔmetC ΔalrN ΔalrP Δasd] was generated from strain SL1344 (SB300) by in-frame deletion of each gene. This was achieved be generation of four single deletion mutants in SL1344 using the plasmid pSIM6 encoded Lambda Red recombinase system[50] for allelic exchange of the coding sequence (leaving the stop codon) with a Tet selectable tetA-sacB cassette, followed by four sequential rounds of P22 transduction followed by Lambda Red recombineering mediated removal of the tetA-sacB cassette by counterselection as described[53], leading to quadruple deletion mutant HA623. HA630 was generated by Lambda Red recombination of a tetRA resistance cassette into the asd deletion site of HA623. The mutagenesis primers used are listed in Table 2. Auxotrophic SPI1 effector gene sopE sopE2 sipA triple mutant H727 was constructed in parent strain SL1344 as described previously[31]. The reported avirulence phenotype of the sopE sopE2 sipA mutation was confirmed by gentamicin protection assay (see Fig. S7D) and by P22 transduction of the wild-type alleles of asd and alrN to recover prototrophy in resultant strain HA733, which was then confirmed to be of strongly reduced intestinal virulence in germ-free mice (histopathological score at day 2 of infection = 2.5 ± 0.5 [mean ± range; n = 2]; wild-type control = 11).
Table 1

Bacterial strains and plasmids.

Strain (acronym)/plasmidGenetic backgroundRelevant genotypeKnown resistancesCommentsOrigin or reference
χ4138 (STm)UK-1Wild-type strainNalVirulent wild-type control[28]
χ9650 (STmΔSPI1 ΔSPI2)UK-1Δ(avrA-invH::cat) Δ(ssaG-ssaU::aphTNal, Cam, Kan[28]
χ9052UK-1Δalr3 ΔdadB4 ΔasdA33[68]
M736ATCC 14028s derivate IR715 (ref. [69])ΔinvC::aphTNal, Kan[31]
M738ATCC 14028s derivate IR715 (ref. [69])ΔssaV::catNal, Cam[31]
HA135 (STmAux)UK-1, χ9052ΔmetC::tetRA Δalr3 ΔdadB4 ΔasdA33TetThis study
HA618 (STmAux ΔinvC)UK-1, STmAuxΔmetC::tetRA Δalr3 ΔdadB4 ΔasdA33 ΔinvC::aphTTet, KanThis study
HA218 (STmAux ΔinvC ΔssaV)UK-1, STmAuxΔmetC::tetRA Δalr3 ΔdadB4 ΔasdA33 ΔinvC::aphT ΔssaV::catTet, Kan, CamThis study
HA208 (STmAux ΔSPI1 ΔSPI2)UK-1ΔmetC::tetRA Δalr3 ΔdadB4 ΔasdA33 Δ(avrA-invH::cat) Δ(ssaG-ssaU::aphTTet, Kan, CamThis study
pM973pWKS30 (ref. [70])AmpeGFP under control of the ssaG promoter[17]
SB300 (STm)SL1344Wild-type strainStr
HA623SL1344ΔmetC ΔalrN ΔalrP ΔasdStrThis study
HA630 (STmAux)SL1344, HA300ΔmetC ΔalrN ΔalrP Δasd::tetRAStr, TetUsed in Fig. 7 and corresponding Supplementary figuresThis study
HA705 (STmT3SS−)SL1344, SB300ΔinvC::aphT ΔssaV::catStr, Kan, CamUsed in Fig. 7This study
HA706 (STmΔssaV)SL1344, SB300ΔssaV::catStr, CamUsed in Fig. 7This study
HA702 (STmAux T3SS−)SL1344, SB300ΔmetC ΔalrN ΔalrP Δasd::tetRA ΔinvC::aphT ΔssaV::catStr, Tet, Kan, CamUsed in Fig. 7This study
HA700 (STmAux ΔinvC)SL1344, SB300ΔmetC ΔalrN ΔalrP Δasd::tetRA ΔinvC::aphT ΔinvC::aphTStr, Tet, KanUsed in Fig. 7This study
HA727 (STmAux ΔTriple-Eff)SL1344, SB300ΔmetC ΔalrN ΔalrP Δasd ΔinvC::aphT ΔinvC::aphT ΔsopE::pGP704 ΔsipA::aphT ΔsopE2::pM218Str, Tet, Kan, Cam,Used in Fig. S7This study
HA733 (STmΔTriple-Eff)SL1344, SB300ΔmetC ΔalrP ΔsopE::pGP70 ΔsipA::aphT ΔsopE2::pM218Str, Tet, Kan, CamPrototrophic derivative of HA727This study
SKI12 (rough STm)SL1344, SB300ΔwbaPNal[71]
M1525 (SEn)S. Enteritidis 125109Wild-type strain[72]
HA627 (rough SEn)S. Enteritidis 125109ΔrfbSThis study
Table 2

Primers used for bacterial mutagenesis.

Primer name5′ → 3′ sequenceAdditional informationApplicable background
STM-metC-tetRA-FTTTGGCAAAATTTTCATCTGTATCACACGTCGCCAGGGTGCAGATGGTTATATTCATGCTAGTTTAGACATCCAGACGGTTAAAATCAGGAAACGCAACTTAAGACCCACTTTCACATTAllelic exchange of metC with TetRAUK-1
STM-metC-tatRA-RGTACTCCTGAATCGTCCGGGATGCCTTGATCCCGGACGCAACAAACGCAGACTTTTCCACGGAAATTGTCTGCATATATGTCCATCCCCGGCAACTTTACTAAGCACTTGTCTCCTGAllelic exchange of metC with TetRAUK-1
STM-metC-cntr-FACGCCAGAATCAAACCAATCmetC control primerUK-1
STM-metC-cntr-RATCGCCAGGTAAGAATGACGmetC control primerUK-1
STM-asd-TetA-SacB-FGAACCACACGCAGGCCCGATAAGCGCTGCAATAGCCACTAATCAAAGGGAAAACTGTCCATATGCAllelic exchange of asd with TetA-SacBSL1344
STM-asd-TetA-SacB-RCGCGCATACACAGCACATCTCTTTGCAGGAAAAAAACGCTTCCTAATTTTTGTTGACACTCTATCAllelic exchange of asd with TetA-SacBSL1344
STM-asd-rmvl-FGAACCACACGCAGGCCCGATAAGCGCTGCAATAGCCACTAAGCGTTTTTTTCCTGCAAAGAGATGTGCTGTGTATGCGCGRemoval of TetA-SacB cassetteSL1344
STM-asd-rmvl-RCGCGCATACACAGCACATCTCTTTGCAGGAAAAAAACGCTTAGTGGCTATTGCAGCGCTTATCGGGCCTGCGTGTGGTTCRemoval of TetA-SacB cassetteSL1344
STM-asd-ctrl-RvTAAGCGCTGCAATAGCCACTasd control primerSL1344
STM-asd-ctrl-FwTTGCGACTTTGGCTGCTTTTasd control primerSL1344
STM-alrN-TetA-SacB-FCCCAAGTGGACCGGTCGACGCCTTAGCCTGAATTAGGTTAATCAAAGGGAAAACTGTCCATATGCAllelic exchange of alrN with TetA-SacBSL1344
STM-alrN-TetA-SacB-RCAACGTTTGCATAGCGCGCATAACTGATAAAGGAAGTGAATCCTAATTTTTGTTGACACTCTATCAllelic exchange of alrN with TetA-SacBSL1344
STM-alrN-rmvl-FCCCAAGTGGACCGGTCGACGCCTTAGCCTGAATTAGGTTATTCACTTCCTTTATCAGTTATGCGCGCTATGCAAACGTTGRemoval of TetA-SacB cassetteSL1344
STM-alrN-rmvl-RCAACGTTTGCATAGCGCGCATAACTGATAAAGGAAGTGAATAACCTAATTCAGGCTAAGGCGTCGACCGGTCCACTTGGGRemoval of TetA-SacB cassetteSL1344
STM-alrN-ctrl-FwGTTTGGCGGCATGATTTGGAalrN control primerSL1344
STM-alrN-ctrl-RvCACCTTAGGCTGGACGATGGalrN control primerSL1344
STM-alrP-TetA-SacB-FGATGAGTAACTCTCCGTCATTCTTTTAACAAGGAATTCAATCCTAATTTTTGTTGACACTCTATCAllelic exchange of alrP with TetA-SacBSL1344
STM-alrP-TetA-SacB-RCCGGATAAGCGCAAGCGCCACCCGGCCCGCCGCGTATTTAATCAAAGGGAAAACTGTCCATATGCAllelic exchange of alrP with TetA-SacBSL1344
STM-alrP-rmvl-FGATGAGTAACTCTCCGTCATTCTTTTAACAAGGAATTCAATAAATACGCGGCGGGCCGGGTGGCGCTTGCGCTTATCCGGRemoval of TetA-SacB cassetteSL1344
STM-alrP-rmvl-RCCGGATAAGCGCAAGCGCCACCCGGCCCGCCGCGTATTTATTGAATTCCTTGTTAAAAGAATGACGGAGAGTTACTCATCRemoval of TetA-SacB cassetteSL1344
STM-alrP-ctrl-FwGGTACGGTTCGTCTGACGTTalrP control primerSL1344
STM-alrP-ctrl-RvTATTACCGGATGACGGCGTGalrP control primerSL1344
STM-metC-TetA-SacB-FTAGTTTAGACATCCAGACGGTTAAAATCAGGAAACGCAACTCCTAATTTTTGTTGACACTCTATCAllelic exchange of metC with TetA-SacBSL1344
STM-metC-TetA-SacB-RCGGAAATTGTCTGCATATATGTCCATCCCCGGCAACTTTAATCAAAGGGAAAACTGTCCATATGCAllelic exchange of metC with TetA-SacBSL1344
STM-metC-rmvl-FTAGTTTAGACATCCAGACGGTTAAAATCAGGAAACGCAACTAAAGTTGCCGGGGATGGACATATATGCAGACAATTTCCGRemoval of TetA-SacB cassetteSL1344
STM-metC-rmvl-RCGGAAATTGTCTGCATATATGTCCATCCCCGGCAACTTTAGTTGCGTTTCCTGATTTTAACCGTCTGGATGTCTAAACTARemoval of TetA-SacB cassetteSL1344
STM-metC-ctrl-FwGCCAGGGTGCAGATGGTTATmetC control primerSL1344
STM-metC-ctrl-RvGACGCAACAAACGCAGACTTmetC control primerSL1344
STM-asd-TetRA-FwGCGCGCATACACAGCACATCTCTTTGCAGGAAAAAAACGCTTTAAGACCCACTTTCACATTAllelic exchange of asd with TetRASL1344
STM-asd-TetRA-RvAACCACACGCAGGCCCGATAAGCGCTGCAATAGCCACTACTAAGCACTTGTCTCCTGAllelic exchange of asd with TetRASL1344
Bacterial strains and plasmids. Primers used for bacterial mutagenesis. Luria-Bertani (LB) medium (Sigma-Aldrich) was used as standard bacterial culture medium. Ampicillin (Sigma; 100 μg/mL), tetracycline (Sigma; 12.5 μg/mL), kanamycin (Sigma; 50 μg/mL), chloramphenicol (Sigma; 6 μg/mL), nalidixic-acid (Sigma; 50 μg/mL), meso-diaminopimelic acid (m-Dap; Sigma, 50 μg/mL), and/or d-alanine (d-Ala; Sigma, 200 μg/mL) were added to the medium as appropriate.

Cellular invasion assays

HeLa (Kyoto) cells were seeded into 24-well dishes and were grown for 1 day until 80% confluence was obtained. HeLa cells were cultured in Dulbecco modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS) and incubated at 37 °C under an atmosphere containing 5% CO2. Shortly before STm infection, the adherent cells were incubated in Hanks’ buffered salt (HBSS) medium. STm strains were inoculated from a single colony in 10 mL d-Ala (200 μg/mL) and m-Dap (50 μg/mL) supplemented (optional) 0.3 M sodium-chloride/LB and incubated at 150 r.p.m., at 37 °C for 16 h. STm cultures were diluted 1:20 into 40 mL fresh medium and incubated at the same conditions for 5 h. Subsequently, STm were washed in PBS and HeLa cells were infected with approximately 3 × 106 CFU STm per well. Fifty minutes after infection, extracellular STm were inactivated by replacing HBSS with DMEM containing 10% FBS and gentamicin (400 μg/mL) up to a total infection time of 2 h. For the quantification of intracellular (=gentamicin protected) STm, HeLa cells were washed in PBS and subsequently lysed in 0.1% sodium-deoxycholate/PBS. The released intracellular bacteria were quantified on d-Ala and m-Dap supplemented LB agar plates. For differential fluorescent staining of extra- and intracellular STm, HeLa cells were cultured on glass coverslips and infected as described above. After a total infection time of 2 h, cells were fixed in 4% PBS-buffered paraformaldehyde. After incubation in blocking buffer (2% BSA/PBS), the cells were incubated in rabbit-anti-STm O-antigen group B antiserum (Becton Dickinson) diluted in blocking buffer, washed twice in blocking buffer, and incubated in goat anti-rabbit CY3 (Jackson Immunoresearch) diluted in blocking buffer. Subsequently, cells were permeabilized with 0.5% Triton X-100 in PBS, incubated again in blocking buffer, and stained again with rabbit-anti-STm O-antigen group B antiserum (Becton Dickinson), washed in blocking buffer, and incubated in a solution of goat anti-rabbit Alexa Fluor-647 (Jackson Immunoresearch) antibody and DAPI (Sigma). The coverslips were mounted under Vectashield mounting medium (Vectorlabs) and examined under a Zeiss Axio Imager M1 fluorescence microscope with a ×63 oil objective and recorded with an AxioCamHR3 camera.

Animal experiments

Animal experiments were performed in accordance to animal experiment licenses (BE94/11, BE91/14, BE36/15, BE85/17) approved by the Bernese Cantonal Ethical committee for animal experiments and carried out in accordance with Swiss Federal law for animal experimentation. Mice were maintained under axenic barrier conditions at the Clean Mouse Facility of the University of Bern. The housing conditions in the whole facility are strictly controlled. The ambient temperature is 23–25 °C and the relative humidity is 52–60%. All mice received at all times standard diet (Kliba 3307) and water ad libitum. The genetic background of all mice used was C57BL/6. MYD88−/− TRIFlps/lps mice[54,55] were provided by Bruce A. Beutler, The Scripps Research Institute, CA, USA and maintained germ free in the Clean Mouse Facility, University of Bern. NRLC4−/− (also known as Ipaf−/−) mice[56] were provided by V. Dixit, Genentech, and derived germ free in the Clean Mouse Facility, University of Bern. NOD1−/− NOD2−/− mice[57] were provided by Dana Philpott, University of Toronto ON, Canada, and derived germ free and provided by Elena F. Verdue, Axenic Gnotobiotic Facility, McMaster University, Hamilton ON, Canada. Caspase-1/11−/− mice (B6N.129S2-Casp1tm1Flv Casp4del/J[58]) were purchased from The Jackson Laboratory in the form of cryopreserved embryos and transferred into germ-free recipients in the Clean Mouse Facility, University of Bern. Germ-free and sDMDMm wild-type C57BL/6 animals, germ-free JH−/− mice[59] and RAG−/− mice[60] were maintained at the Clean Mouse Facility, University of Bern. Gnotobiotic sDMDMm mice have been generated at the Clean Mouse Facility of the University of Bern by inoculation of germ-free C54BL/6 mice with purified culture of the murine intestinal bacterial consortium Oligo-MM12 (ref. [38]) and stably maintained in flexible film isolators under strictly axenic conditions. sDMDMm RAG−/− mice and MYD88−/− TRIFlps/lps mice were generated by co-housing of the genetically modified germ-free mice with gnotobiotic wild-type sDMDMm mice for 4 weeks. SPF C57BL/6 mice were purchased from Charles River (France) and maintained at the Central Animal Facility of the Department of Biomedical Research, University of Bern. For infections in the streptomycin pretreatment model[24] SPF mice were pre-treated with 20 mg of streptomycin dissolved in sterile water prior to infection with STm by gavage. Infection and colonization experiments were performed under strict aseptic conditions. Mice were derived and maintained germ free in flexible film isolators[61] (including the duration of transient auxotrophic bacterial conditioning) or autoclaved Sealsafe-plus IVC cages (Tecniplast, Italy; during STm challenge and short-term infections) at the Clean Mouse Facility (CMF) of the University of Bern. Animals were provided with autoclaved mouse chow (Kliba 3307) and water ad libitum. Germ-free status of all animals was routinely monitored using culture-based and culture-independent methods established by the Clean Mouse Facility, DKF University of Bern. Mice were infected with 200 μL STm suspension. Bacteria for enteral inoculation were grown under SPI1-inducing conditions. Auxotrophic STm were inoculated into 10 mL d-Ala- (200 μg/mL) and m-Dap- (50 μg/mL) supplemented LB containing 0.3 M NaCl and incubated shaking at 150 r.p.m., at 37 °C for 16 h. The resulting bacterial cultures were diluted 108-fold in 500 mL fresh medium and incubated under the same conditions for 15 more hours. STm were harvested by centrifugation (15 min, 4816 × g, 4 °C), washed twice with cold PBS, and resuspended to the appropriate densities. For peracetic acid (PAA) inactivation, an aliquot of auxotrophic STm was resuspended in 10 mL 1% peracetic acid for 1 h at room temperature. The inactivated STm suspension was washed with PBS and resuspended to the the appropriate density. Sterility of PAA-killed inocula was confirmed by standard culture methods. Wild-type STm cultures were inoculated from a single colony in 10 mL 0.3 M sodium-chloride/LB and incubated at 150 r.p.m., at 37 °C for 16 h. Wild-type STm cultures were diluted 1:20 into 40 mL fresh medium and incubated at the same conditions for 5 h.

Bacterial loads in organs and feces

Organs, feces, and cecum content were aseptically collected. Organs were homogenized in 0.5 mL 0.5% tergitol/PBS, feces and cecum content in 0.5 mL PBS using a tissue lyzer (TissueLyzer LT, Qiagen, 50 Hz, 3–5 min, with a stain-less steel bead). Bacterial loads were quantified by plating on LB agar. Where necessary, d-Ala (200 μg/mL) and m-Dap (50 μg/mL) were added.

Isolation of intestinal secretory IgA

Intestinal IgA lavages were collected by rinsing the small intestine with 5 mL of 1% soybean-trypsin inhibitor/0.05 M EDTA/PBS. The intestinal lavages were spun at 4816 × g, >20 min, 4 °C. The supernatant was sterile-filtered (0.22 µm cut-off size) to remove bacteria-sized particles and stored long-term in aliquots frozen at −20 °C.

Immunoglobulin repertoire sequencing

Germ-free C57BL/6 mice were orally administrated with 3 × 1010 STmAux or STmAux Δ three times at 7-day intervals. Naïve germ-free mice served as naïve controls. Twenty-eight days post last administration, ileum and MLN were dissected and snap-frozen in Trizol reagent (Life Technologies) using liquid nitrogen. Thawed tissues were homogenized (Retsch bead-beater) in 1 mL of Trizol reagent. Two hundred microliters chloroform was added to samples and centrifugation (12,000 × g, 15 min, 4°C) was performed. The upper phase containing RNA was collected, and RNA was precipitated with ice-cold isopropanol. After washing once with 75% (v/v) ethanol, RNA pellet was dried and resuspended in RNase-free water. Nanodrop2000 (Thermo Scientific) was used to quantify RNA concentrations and purity. To prepare IgA amplicons, cDNA was synthesized by mixing 700 ng of RNA, 1 μL of 2 μM gene specific primer mix (as previously described[62], 1 μL of 10 mM dNTP (containing dATP, dCTP, dGTP, and dTTP at a final concentration of 10 mM, Invitrogen) and topped with dH2O to 13 μL. Samples were heated to 65 °C for 5 min, and then cooled for 1 min on ice. Four microliters 5X first strand buffer (Invitrogen), 1 μL 782 0.1 M DTT (Invitrogen), 1 μL RNaseOUT (Invitrogen), and 1 μL Superscript III RT enzyme (Invitrogen) were added to each reaction, mixed, and incubated at 55 °C for 50 min. A heat inactivation at 70 °C for 15 min was done to stop the reaction. Five microliters of synthesized cDNA library was used as a template DNA for amplicon PCR PlatinumTaq PCR buffer (Qiagen) following the manufacturer’s instruction. Primers used in the PCR reaction listed below were described previously[63]. PCR products were electrophorized on 1.5% agarose gel and purified with the QIAquick Gel Extraction kit (Qiagen). The purified DNA was quantified using Qbit (Thermofisher). Sequencing adapters (Nextera® XT Index Kit, Illumina) were linked to each amplicon by doing a second PCR. After testing with a Fragment Analyzer™ (Advanced Analytical), amplicons with sequencing adaptors were pooled for sequencing on the MiSeq Illumina sequencer using paired 250 bp mode. For primer sequences used view Table 3.
Table 3

Primers used for antibody repertoire sequencing.

IgH Forward Mix5′ → 3′ sequence Illumina Adapter sequence read 1 + Diversity region + VH 5′-specific region
IgH-UAd-fw1TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAKGTRMAGCTTCAGGAGTC
IgH-UAd-fw2TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAGGTBCAGCTBCAGCAGTC
IgH-UAd-fw3TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNCAGGTGCAGCTGAAGSASTC
IgH-UAd-fw4TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAGGTCCARCTGCAACARTC
IgH-UAd-fw5TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNCAGGTYCAGCTBCAGCARTC
IgH-UAd-fw6TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNCAGGTYCARCTGCAGCAGTC
IgH-UAd-fw7TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNCAGGTCCACGTGAAGCAGTC
IgH-UAd-fw8TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAGGTGAASSTGGTGGAATC
IgH-UAd-fw9TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAVGTGAWGYTGGTGGAGTC
IgH-UAd-fw10TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAGGTGCAGSKGGTGGAGTC
IgH-UAd-fw11TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAKGTGCAMCTGGTGGAGTC
IgH-UAd-fw12TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAGGTGAAGCTGATGGARTC
IgH-UAd-fw13TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAGGTGCARCTTGTTGAGTC
IgH-UAd-fw14TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGARGTRAAGCTTCTCGAGTC
IgH-UAd-fw15TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAAGTGAARSTTGAGGAGTC
IgH-UAd-fw16TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNCAGGTTACTCTRAAAGWGTSTG
IgH-UAd-fw17TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNCAGGTCCAACTVCAGCARCC
IgH-UAd-fw18TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGATGTGAACTTGGAAGTGTC
IgH-UAd-fw19TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNGAGGTGAAGGTCATCGAGTC
Primers used for antibody repertoire sequencing.

Antibody repertoire sequencing analysis

B cell IgA receptor heavy chain libraries were prepared as previously described[64] and sequenced on the Illumina MiSeq platform (2 × 250 cycles, paired-end). Output files were preprocessed (VDJ alignment, clonotyping) using MiXCR (v3.0.12). Clonotypes were defined by 100% amino acid sequence identity of CDR3 regions. Annotation of the different segments was defined by MiXCR according to the nomenclature of the Immunogenetics database (IMGT)[65]. MIXCR output files were further processed in the post-processing tool-suite: VDJtools[66]. Further filtering was applied in order to keep only productive sequences if: (i) they were composed of at least four amino acids and (ii) had a minimal read count of 2 (ref. [63]) and were in-frame. Repertoire overlap was measured by calculating the geometric mean of relative overlap frequencies between CDR3 amino acid sequence usage. The relative overlap similarity was represented on a multi-dimensional scaling (MDS) plot.

Histology and pathological evaluation of cecum tissue

For each individual, proximal and distal cecum tissue was embedded in OCT compound (Tissue Tek, DC6994583) and frozen in liquid nitrogen. Three consecutive 6 μm cryosections of each tissue were mounted on glass slides and stained with hematoxylin and eosin following standard protocols. Histopathology was scored in a blinded manner according to the severity of submucosal edema (0–3 score points), the number of polymorphonuclear granulocytes per high-power field in the lamina propria (0–4 score points), reduced numbers of goblet cells (0–3 score points), and epithelial damage (0–3 score points) resulting in a total score of 0–13 points[24]. The mean combined pathological score of proximal and distal cecum is reported.

Fluorescence microscopy of tissue invaded STm

Tissue invaded intracellular STm harboring ssaG::eGFP reporter plasmid pM973 were visualized and quantified in cecum cryosections prepared from paraformaldehyde-fixed and cryo-embedded cecum tissue as described previously[17]. Sections were stained with DAPI (Sigma, diluted 1:2000) and Phalloidin ATTO 647 (Sigma, diluted 1:500). Up to 12 non-consecutive sections per animal were quantified visually using a Zeiss AXIO Imager.M1 microscope equipped with an EC-Plan-NEOFLUAR 40C/1.3 Oil objective and ×10/23 oculars. One high-power field measures approx. 40,000 µm2. Quantitation was carried out in a blinded manner. Images were recorded on a Zeiss LSM710 laser scanning confocal microscope using the Zeiss ZEN 3.1 software. Images were analyzed with the Image J Fiji package.

mRNA quantification in cecal tissue by qPCR

Cecum tissue was collected 6 h after infection. Immediately, the tissue was washed in PBS and preserved in RNAlater (Qiagen). The total RNA was extracted from approximately 15 mg tissue, using the RNeasy mini kit (Qiagen). The extraction quality was assessed with Agilent RNA 600 Nano Kit (Qiagen) and reached minimally RIN 9. In total, 5 μg mRNA samples were reversed with RT2 easy first strand kit (Qiagen). cDNA libraries were analyzed in a Viia7 Real-Time PCR System and the Viia7 Real-Time PCR System acquisition software (Thermo Scientific) using a the RT2 profiler PCR array quantifying murine Crohn’s disease-related markers (PAMM-169Z, Qiagen) and SYBR green reagents (Qiagen). Five housekeeping genes (Actb, B2m, Gapdh, Gusb, and Hsp90ab1) were averaged and used for calculating ΔCT (=CTsample−CThouskeeping). The upper CT limit was fixed to 35 cycles.

Enzyme-linked immunosorbent assays (ELISA)

Total lipocalin-2 concentrations of cecum content and fecal pellets were determined by sandwich ELISA using a commercial mouse lipocalin- 2/NGAL ELISA DuoSet (R&D, DY1857), according to the manufacturer’s instructions. Immunoglobulin A (IgA) concentrations were quantified from mouse intestinal lavages by sandwich ELISA. ELISA plates were coated with goat anti-mouse IgA (Southern Biotech, 1040-01) and IgA was detected with a horseradish peroxidase (HRP)-conjugated goat anti-mouse IgA (A4789, Sigma). A purified monoclonal IgA isotype antibody (Becton Dickinson, clone M18-254, 553476) served as standard. Absorbance was measured in a 96-microplate reader (VarioskanFlash, version 4.00.53) at 405 nm. Lipocalin-2 and IgA titers were analyzed in Prism 8 for Windows (GraphPad software Inc). −EC50 of each sample/standard was calculated by a four-parameter curve fitting.

Live bacterial flow cytometry

Live bacterial flow cytometry quantification of bacterial-specific intestinal IgA titers (expressed as LogEC50 values) were determined as previously described in ref. [25]. Briefly, STm were cultured under SPI1-inducing conditions[67] as described in the Cellular Invasion Assays section. Subsequently, 1 mL of the culture was pelleted at 4816 × g in a Heraeus Fresco 21 centrifuge. The pellet was washed and resuspended to a density of 107 CFU/mL in sterile-filtered 2% BSA/0.005% NaN3/PBS. Intestinal IgA lavages were collected as described above. Intestinal lavages were serially diluted in sterile-filtered 2% BSA/0.005% NaN3/PBS. Serially diluted Ig-solutions and bacterial suspension were mixed 1:1 and incubated at 4 °C for 1 h. Bacteria were washed twice in sterile-filtered 2% BSA/0.005% NaN3/PBS before re-suspension in monoclonal FITC-anti-mouse IgA (clone 10.3; Becton Dickinson) or PE-anti-mouse IgG1 (clone A85-1; Becton Dickinson) and FITC-anti- mouse IgG2b (clone R12-3; Becton Dickinson). After a further hour of incubation, the bacteria were washed once with PBS/2% BSA/0.005% NaN3/PBS and then resuspended in 2% paraformaldehyde (PFA)/PBS for acquisition on a Becton Dickinson FACSArray SORP or Beckman Coulter Cytoflex S using FSc (forward scatter) and SSc (side scatter) parameters in logarithmic mode. Flow cytometric gating strategy is shown in Fig. S15. Data were analyzed using FlowJo software (Tree Star), and titers were calculated by fitting four-parameter logistic curves[25].

Statistics

Statistics were analyzed using Prism 8 for Windows (GraphPad software Inc.). The specific statistical tests used are indicated in the figure legends. Detailed statistical information is provided in the statistical data analysis file available online in the supplementary material.
  35 in total

1.  Lepromatous leprosy and dementia.

Authors:  K N Mohamed
Journal:  Int J Lepr Other Mycobact Dis       Date:  1990-06

2.  Pharmacokinetics and tissue penetration of cefepime.

Authors:  K J Nye; Y G Shi; J M Andrews; R Wise
Journal:  J Antimicrob Chemother       Date:  1989-07       Impact factor: 5.790

3.  Occupational dermatitis to Honduran mahogany.

Authors:  J F Fowler
Journal:  Contact Dermatitis       Date:  1985-11       Impact factor: 6.600

4.  Protein binding of glycopeptide antibiotics with diverse physical-chemical properties in mouse, rat, and human serum.

Authors:  R W Wittendorf; J E Swagzdis; R Gifford; B A Mico
Journal:  J Pharmacokinet Biopharm       Date:  1987-02

5.  [Fundamentals of ceramics].

Authors:  H A Kreutzmann
Journal:  Zahntechnik (Berl)       Date:  1972-07

6.  Effects of 2-Br-alpha-Ergocryptine, L-dopa and cyclic imides on serum prolactin in postmenopausal women.

Authors:  M Rozencweig; J C Heuson; S Bila; M L'Hermite; C Robyn
Journal:  Eur J Cancer       Date:  1973-09       Impact factor: 9.162

7.  Lymphosarcoma cell leukemia. A clinicopathological study.

Authors:  B Schnitzer; L S Loesel; R E Reed
Journal:  Cancer       Date:  1970-11       Impact factor: 6.860

8.  Cost-containment; playing the money game.

Authors:  M J White
Journal:  Nurs Success Today       Date:  1985-03

9.  [Impotence with venous leakage. An extensive study of 49 cases detected by the artificial erection test].

Authors:  J Buvat; A Lemaire; M Buvat-Herbaut; J L Dehaene; G Marcolin; F Desmons
Journal:  Ann Urol (Paris)       Date:  1986

10.  Seric SLX values in patients with lung tumors.

Authors:  J Hernández; J M García; M A Martínez Muñiz; E Pereiro Alonso; M Pajin Collado; M Del Rosal; M T Allende; A Ruibal
Journal:  Int J Biol Markers       Date:  1991 Jan-Mar       Impact factor: 3.248

View more
  5 in total

1.  Salmonella enterica serovar Choleraesuis vector delivering a dual-antigen expression cassette provides mouse cross-protection against Streptococcus suis serotypes 2, 7, 9, and 1/2.

Authors:  Yu-An Li; Yanni Sun; Yang Fu; Yuqin Zhang; Quan Li; Shifeng Wang; Huoying Shi
Journal:  Vet Res       Date:  2022-06-22       Impact factor: 3.829

2.  NOD2 signaling in CD11c + cells is critical for humoral immune responses during oral vaccination and maintaining the gut microbiome.

Authors:  B E Fox; A Vilander; Z Abdo; G A Dean
Journal:  Sci Rep       Date:  2022-05-19       Impact factor: 4.996

Review 3.  NOD1-Targeted Immunonutrition Approaches: On the Way from Disease to Health.

Authors:  Victoria Fernández-García; Silvia González-Ramos; Paloma Martín-Sanz; José M Laparra; Lisardo Boscá
Journal:  Biomedicines       Date:  2021-05-06

4.  Bacterial cancer therapy in autochthonous colorectal cancer affects tumor growth and metabolic landscape.

Authors:  Gillian M Mackie; Alastair Copland; Masumi Takahashi; Yumiko Nakanishi; Isabel Everard; Tamotsu Kato; Hirotsugu Oda; Takashi Kanaya; Hiroshi Ohno; Kendle M Maslowski
Journal:  JCI Insight       Date:  2021-10-28

Review 5.  Robust microbe immune recognition in the intestinal mucosa.

Authors:  Olivier P Schären; Siegfried Hapfelmeier
Journal:  Genes Immun       Date:  2021-05-06       Impact factor: 2.676

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.