Diagnostic and prognostic roles of circulating miRNA-223-3p in hepatitis B virus-related hepatocellular carcinoma.

BACKGROUND: Circulating microRNAs (miRNAs) have been shown to dysregulate in many cancer types including hepatocellular carcinoma (HCC). The purpose of this study was to examine the potential diagnostic or prognostic roles of circulating miRNAs in patients with hepatitis B virus (HBV)-related HCC.
METHODS: Paired cancerous and adjacent non-cancerous liver tissue specimens of patients with HBV-related HCC were used as a discovery set for screening 800 miRNAs by a Nanostring quantitative assay. Differentially expressed miRNAs were then examined by SYBR green quantitative RT-PCR in a validation cohort of serum samples obtained from 70 patients with HBV-related HCC, 70 HBV patients without HCC and 50 healthy controls.
RESULTS: The discovery set identified miR-223-3p, miR-199a-5p and miR-451a significantly lower expressed in cancerous tissues compared with non-cancerous tissues. In the validated cohort, circulating miR-223-3p levels were significantly lower in the HCC group compared with the other groups. The combined use of serum alpha-fetoprotein and miR-223-3p displayed high sensitivity for detecting early HCC (85%) and intermediate/advanced stage HCC (100%). Additionally, serum miR-223-3p had a negative correlation with tumor size and BCLC stage. On multivariate analysis, serum miR-223-3p was identified as an independent prognostic factor of overall survival in patients with HCC. In contrast, circulating miRNA-199a-5p and miR-451a did not show any clinical benefit for the diagnosis and prognostic prediction of HCC.
CONCLUSIONS: Our results demonstrated that miR-223-3p was differentially expressed in cancerous compared with paired adjacent non-cancerous tissues. In addition, circulating miRNA-223-3p could represent a novel diagnostic and prognostic marker for patients with HBV-related HCC.

Introduction

Hepatocellular carcinoma (HCC) represents the sixth most common cancer and the second leading cause of cancer-related mortality worldwide [1]. The prevalence of HCC differs among geographical distribution with its high rate in East and Southeast Asia [2]. In Thailand, major etiologic factors of HCC development are hepatitis B virus (HBV), followed by hepatitis C virus (HCV) infection, alcoholic liver disease (ALD) and non-alcoholic fatty liver disease (NAFLD). Our previous report has demonstrated that at least 60% of HCC cases are attributed to chronic HBV infection [3]. Despite advanced improvements in curative treatment including surgical and ablative therapies, the overall survival of patients with HCC remains unsatisfactory due to tumor aggressiveness at presentation and high rates of recurrence [2]. Currently, prognostic markers for HCC in routine clinical practice are not yet available. Thus, a reliable serum biomarker for early diagnosis, monitoring tumor progression and prognostic prediction is highly needed and would be of great clinical benefit.

Recent advances have demonstrated that the development of HCC is a complex process involving several genetic and epigenetic changes accumulated through repeated hepatocyte destruction and regeneration. Among these alterations, aberrant expression of microRNAs (miRNAs) plays an essential role in multistep processes of HCC development [4]. MiRNAs are small non-coding RNAs of approximately 18–24 nucleotides that modulate gene expression process by binding to specific mRNA targets and promoting their degradation and translational inhibition [5]. In addition, miRNAs participate in several biological and pathological processes, including cell differentiation, growth, angiogenesis and immune activation [6]. Moreover, it has been shown that miRNA alterations can act as either oncogene activation or tumor suppressor gene inactivation in HCC development [7]. Since dysregulation of miRNA expression has been linked to hepatic carcinogenesis and progression, detecting these miRNAs alterations in liver tissue and blood samples could be potential biomarkers for diagnosis and prognosis of HCC [4, 7]. Although previous studies revealed clinical correlations of miRNA detection in HCC, some reports were limited by insufficient number of screened miRNAs, inadequate independent validation and failure to differentiate HCC from non-HCC chronic liver disease. In addition, liver tissue derived miRNA from liver biopsy might not be ideal biomarkers for HCC because of its invasive procedure with potential complications [8]. Thus, detecting circulating miRNAs in body fluids such as serum specimens is more beneficial for the diagnosis and prognosis of HCC [9].

In this study, we investigated global miRNA expression profiling in liver tissue specimens obtained from patients with HBV-related HCC by NanoString quantitative platform. Additionally, we validated clinical significance of candidate miRNAs by Real-Time PCR in another set of serum specimens obtained from patients with HBV-related HCC.

Materials and methods

Patients and sample collection

To investigate miRNA expression profiles in liver tissue, pairs of cancerous and adjacent non-cancerous tissue specimens were obtained from patients with HBV-related HCC undergoing surgical resection at the Department of Surgery, Chulalongkorn University from 2013 to 2017. The diagnosis of HCC was confirmed by histopathology. Liver tissue samples were immediately stored in RNA later solution (Cat No. 76106, QIAGEN, and Germany) and were then frozen in liquid nitrogen until RNA extraction.

For the validation cohort, stored serum samples were collected from patients with HBV-related HCC, who were diagnosed for the first time at King Chulalongkorn Memorial Hospital, Bangkok, Thailand between 2013 and 2017. The diagnosis of HCC in this cohort was based on typical imaging studies and/or histopathology in accordance with the American Association for the Study of Liver Diseases (AASLD) guideline [10]. Briefly, the criteria of HCC diagnosis were included focal hepatic lesions with hyperattenuation at the arterial phase and hypoattenuation at the portal phase in dynamic computed tomography (CT) or magnetic resonance imaging (MRI). Liver biopsy or fine needle aspiration were performed to confirm HCC diagnosis in cases without typical imaging features. Baseline clinical parameters of these patients were collected, which included gender, age, biochemical liver function tests, Child-Pugh classification, serum alpha-fetoprotein (AFP) and staging of HCC classified by the Barcelona Clinic Liver Cancer (BCLC) [11]. In addition, overall survival (OS) of the patients characterized by the interval between initial recruitment and death or the last follow-up visit was recorded.

Stored serum samples were also obtained from two additional groups, including healthy blood donors with no apparent liver disease (healthy controls) and patients with chronic HBV infection who did not have evidence of HCC (the non-HCC group). Healthy controls and the non-HCC group were matched for gender and age with patients with HCC to reduce confounding effects. The diagnosis of chronic HBV infection was confirmed by the presence of serum hepatitis B s antigen (HBsAg) for at least 6 months. Patients with HCV and/or human immunodeficiency virus (HIV) co-infection were excluded. Collected serum sample specimens were separated by centrifugation and stored at -70°C until further tested.

This study was performed according to the Declaration of Helsinki for the participation of human individuals. The protocol of this study had been approved by the Institute Ethics Committee of Faculty of Medicine, Chulalongkorn University (IRB No. 726/60) and written informed consent was obtained from each participant.

Nanostring nCounter analysis

Total RNAs extracted from 25 mg of HCC frozen tissues and matched adjacent non-cancerous tissues individually were extracted for miRNAs using the GenUP™ Total RNA Kit (Biotechrabbit GmbH, Hennigsdorf, Germany). These RNAs were determined for total 800 miRNA expression using the Human nCounter miRNA Assay v 3.0 kit following the manufacturer's instructions (NanoString Technologies, Seattle, WA, USA). Candidate miRNAs were selected if their differential expression in cancerous and non-cancerous tissues were more than 5-folds.

Validation of NanoString results by qRT-PCR analysis

From NanoString analysis, we selected candidate miRNAs that were significantly differential expression between cancerous and non-cancerous tissues. After filtering, the top 3 candidate miRNAs, including miR-223-3p, miR-199a-5p and miR-451a, were selected for validate their circulating expression levels by qRT-PCR analysis. Briefly, 200 μL of serum samples were extracted using a miRNA isolation kit (Cat No. RMI050, Geneaid Biotech, USA). For cDNA synthesis and poly (A) tail addition, the first-strand cDNA was then synthesized from purified total RNA using SL-poly (A) sequence: GTCGTATCCAGTGCAGGGTCCGAGGTAT TCGCACTGGATACGACAAAAAAAAAAAAAAAAAAVN and RevertAid First Strand cDNA Synthesis Kit (Cat No. 1622, Thermo Scientific, USA). The candidate miRNAs were assessed in duplicate by quantitative RT-PCR using SYBR Green system (QPCR Green Master Mix HRox, Cat No. BR0500402, Biotechrabbit, Germany) with specific primers including miR-223-3p:5’TGTCAGTTTGTCAAATACCCCA3’(forward),miR-199a5p:5’AGTGTTCAGAC TACCTGTTC3’(forward), miR-451a: 5’AAACCGTTACCATTACTGAGTT3’(forward) and SL-polyA-R: 5’GCAGGGTCCGAGGTATTCG3’ (universal reverse). MiR-21 was used as the internal control [12]. Downregulation was confirmed by StepOnePlus Real-time PCR System (Applied Biosystems, USA). The relative expression level was calculated by ΔΔCT of the 2- ΔΔCT method [13]..

Statistical analysis

NanoString analysis was performed using nSolver Analysis Software (Version 4.0). Data according to miRNAs differential expressions levels were analyzed with SPSS statistics version 22 (SPSS Inc., Chicago, IL) and GraphPad Prism 5.0 (GraphPad software, CA, USA) software. Quantitative data were calculated in terms of mean ± standard and percentages. Comparisons between groups were analyzed by χ2 or Fisher’s exact test for categorical variables and by Student’s t-test for quantitative variables. Correlations between baseline parameters were analyzed by the Spearman's rank test. Survival curves were calculated based on Kaplan-Meier analysis and log-rank test. The Cox regression analysis was conducted to identify independent baseline factors associated with overall survival (OS) of patients with HCC. P values <0.05 were indicated statistical significance.

Results

Expression profiling of microRNAs in liver tissues

A discovery set comprised of 4 pair cancerous and surrounding non-cancerous tissue specimens obtained from 4 patients with HBV-related HCC undergoing surgical resection. All these patients had early stages (BCLC stage 0 or A) and did not receive any therapy for HCC before collecting the samples (S1 Table). Based on the NanoString platform, expression levels of 800 microRNAs were obtained. As shown in Fig 1, a volcano plot demonstrated that 21 miRNAs were significantly differentially expressed in cancerous and non-cancerous tissues. After filtering, the top 3 candidate miRNAs, including miR-223-3p, miR-199a-5p and miR-451a, were selected for further validation in serum specimens by qRT-PCR analysis.

Fig 1

Volcano plot shows the profile of the differential miRNAs expression in 4 tissue samples of patients with HCC.

The x-axis represents the Log2 fold change and y-axis represents significance level expressed as the—log10 P-value. The red 3 dots shown in the volcano plot are the downregulated miRNAs in HCC tissue. The blue dots represent miRNAs that did not demonstrate a significant change in expression. Significance value was indicated with a P-value cut-off of 0.05.

Validation of miRNA ratios by RT-qPCR

To further investigate whether circulating miRNA expression could be applied for diagnosis of HCC; RT-qPCR was performed in serum samples of a validation cohort consisting of 70 patients with HBV-related HCC, 70 patients without HCC and 50 healthy controls. Among these individuals, healthy controls and the non-HCC group were matched for gender and age with patients with HCC (Table 1). Compared with patients without HCC, the HCC group had significantly lower serum albumin and platelet count but higher serum total bilirubin, aspartate aminotransferase (AST), alanine aminotransferase (ALT), AFP level, the presence of HBV genotype C and cirrhosis. There was no significant difference in terms of HBeAg positivity and HBV DNA level. Among the HCC group, the initial cancer stages based on the BCLC criteria were as follows: 21 (30.0%), 24(34.3%) and 25(35.7%) patients in stages 0-A, B and C-D, respectively.

Table 1

Demographic data of the studied cohorts.

Baseline Characteristics	Healthy controls (n = 50)	Patients without HCC (n = 70)	Patients with HCC (n = 70)	P
Age (years)	51.7±4.0	51.2±10.9	52.0±8.3	0.867
Gender (Male)	30 (60.0)	42 (60.0)	51(72.9)	0.202
Aspartate aminotransferase (IU/L)		33.9±30.2	116.1±135.9	<0.001*
Alanine aminotransferase (IU/L)		37.0±34.0	66.4±52.9	<0.001*
Serum albumin (g/dL)		4.2±0.4	3.6±0.5	<0.001*
Total bilirubin (mg/dL)		0.7±0.3	1.1±0.7	<0.001*
Platelet count (109/L)		214.0±56.3	154.6±70.1	<0.001*
HBeAg positivity		29 (41.4)	24 (34.3)	0.486
HBV genotype				0.001
B		17 (24.3)	4 (5.7)
C		52 (74.3)	58 (82.9)
Unknown		1 (1.4)	8 (11.4)
Log10 HBV DNA (IU/mL)		4.7±2.0	4.5±1.7	0.491
Alpha fetoprotein (ng/mL)		6.4±5.7	7877.4±21065.5	0.011*
Presence of cirrhosis		11 (15.7)	60 (85.7)	<0.001*
BCLC stage (0-A/B/C-D)		-	21(30.0)/24(34.3)/25(35.7)	-

Data express as mean±SD and n (%)

For further analysis, three miRNAs, including miR-223-3p, miR-199a-5p and miR-451a, identified in the discovery setting and known to be dysregulated in HCC were selected. Relative expression miRNAs levels of the subjects in each group are plotted in Fig 2A, 2B and 2C. The results showed that circulating miR-223-3p levels in the HCC group (0.31±0.46) were significantly lower than the non-HCC group (0.94±1.05, P<0.001) and healthy controls (1.00±0.00, P<0.001). In contrast, circulating miR-199a-5p (0.83±1.19) levels in the HCC group were not significantly different from those of the non-HCC group (1.07±1.53, P = 0.300) and healthy controls (1.00±0.00, P = 0.240). For miR-451a, their expression levels in the HCC group were comparable with the non-HCC group (0.38±0.83 vs 0.18±0.58, P = 0.092) but significantly differed from those of healthy controls (P<0.001).

Fig 2

Relative expression of serum (A) miR-223-3p, (B) miR-199a-5p and (C) miR-451a in studied groups.

Relationship between serum miRNAs levels and clinical parameters

Among patients with HCC, the correlation between serum miRNAs levels and clinical parameters at baseline was examined. There was no correlation between miR-223-3p and miR-199a-5p (r = 0.118, P = 0.329), miR-223-3p and miR-451a (r = -0.059, P = 0.28), as well as miR-199a-5p and miR-451a (r = 0.149, P = 0.218). Serum miR-223-3p had a negative correlation with tumor size (r = -0.312, P = 0.008) and BCLC stage (r = -0.410, P<0.001) but did not correlated with other clinical parameters, including sex, age, biochemical parameters, AFP level, HBeAg status and HBV DNA level. Serum miR-199a-5p level did not have significant correlation with clinical parameters. For serum miR-451a, its level was negatively correlated with AST (r = -0.308, P = 0.009), ALT (r = -0.381, P = 0.001) and tumor size (r = -0.277, P = 0.020), but did not correlate with other parameters.

Serum miRNAs as diagnostic markers of HCC

The ROC curves for miR-223-3p, miR-199a-5p and miR-451a were generated on the same graph to compare their diagnostic accuracies. As shown in Fig 3, the area under the curve (AUROC) of HCC and the other groups was 0.81 [95% confidence interval (CI); 0.74–0.87, P<0.001] for miR-223-3p, 0.61(95%CI; 0.52–0.69, P = 0.015) for miR-199a-5p and 0.68 (95%CI; 0.60–0.76, P<0.001) for miR-451a. As miR-223-3p was considered the best biomarkers among the studied miRNAs, its diagnostic role was further evaluated. Based on the ROC curve analysis, a cut-off point of serum miR-223-3p levels that exhibited the highest accuracy for differentiating HCC from the other groups was approximately 0.4. At this cut-off level, its sensitivity and specificity were approximately 76.7%, and 80%, respectively.

Fig 3

The area under the curve (AUROC) of HCC and the other groups.

Regarding all HCC, 56 of 70 (80.0%) patients had decreased levels of serum miR-223-3p <0.4, whereas 43 (61.4%) patients had elevated serum AFP at cut-off value of 20 ng/mL. When both serum markers were combined, the sensitivity was increased to 95.7%. For early-stage HCC (stages 0 and A), 13 of 21 (61.9%) patients had decreased levels of serum miR-223-3p <0.4, whereas 12 (57.1%) patients had elevated serum AFP at cut-off value of 20 ng/mL. When both markers were used together, the sensitivity of the combined test was 85.7% and 100% for detecting early-stage and intermediate/advanced stage HCC, respectively. The sensitivity of both markers and their combination in relation with BCLC staging is showed in Table 2.

Table 2

The sensitivity of serum miR-223-3p, AFP and combination in diagnosis of HCC according to tumor staging.

BCLC Staging	miR-223-3p (0.4)	AFP (20 ng/ml)	miR-223-3p and AFP
Stage 0, A (n = 21)	13 (61.9)	12 (57.1)	18 (85.7)
Stage B (n = 24)	18 (75.0)	15 (62.5)	24 (100)
Stage C,D (n = 25)	25 (100)	16 (64.0)	25 (100)

Data expressed as n (%)

Serum miRNAs in predicting overall survival of patients with HCC

Apart from clinical correlations, we further examined the potential prognostic role of serum miR-223-3p, miR-199a-5p and miR-451a. Using the median value (0.13) as the cut-off level, the median OS of patients with serum miR-223-3p levels of ≥0.13 was 44.4 months, which was significantly better than that of patients whose serum levels were <1.3 (median OS, 20.7 months; P = 0.001 by log rank test) (Fig 4A). For serum miR-199a-5p, there was no difference in OS between patients with high or low levels (Fig 4B). Likewise, there was no difference in OS between patients with high or low levels of serum miR-451a (Fig 4C).

Fig 4

Association of the studied miRNAs with overall survival in patients with HCC.

(A) miR-223-3p (B) miR-199a-5p (C) miR-451a.

Serum miR-223-3p, miR-199a-5p and miR-451a levels were entered into the univariate analysis together with other variables that might influence the prognosis of HCC. These baseline factors included age, gender, AST and ALT levels, platelet counts, HBeAg status, HBV DNA level, AFP level, Child classification, tumor size and the BCLC stage. Among these parameters, AFP, tumor size, the BCLC stage and serum miR-223-3p were selected for multivariate analysis. Based on multivariate analysis, the data revealed that independent prognostic factors of OS were the BCLC stage and serum miR-223-3p (Table 3).

Table 3

Variables associated with overall survival in patients with HCC.

Variables	Category	Overall survival
		Univariate analysis		Multivariate analysis
		OR (95%CI)	P	OR (95%CI)	P
Age (years)	< 50 vs. ≥ 50	0.70 (0.33–1.48)	0.347
Gender	Male vs. Female	1.17 (0.51–2.68)	0.709
Aspartate aminotransferase (IU/L)	< 60 vs. ≥ 60	1.44 (0.68–3.05)	0.342
Alanine aminotransferase (IU/L)	< 50 vs. ≥ 50	0.76 (0.36–1.60)	0.465
Platelet count (109/L)	≥ 140 vs. <140	1.81 (0.83–3.95)	0.134
HBeAg positivity	Negative vs. Positive	1.43 (0.65–3.18)	0.376
Log10 HBV DNA (IU/mL)	< 4.0 vs. ≥ 4.0	0.69 (0.29–1.63)	0.393
Child-Pugh classification	A vs. B and C	1.26 (0.58–2.76)	0.560
Alpha fetoprotein (ng/mL)	< 100 vs. ≥ 100	2.76 (1.26–6.07)	0.011*	1.28 (0.55–2.97)	0.571
Tumor size (cm.)	<5.0 vs. ≥ 5.0	4.21 (1.52–11.68)	0.006*	0.99 (0.23–4.22)	0.985
BCLC stage	0-B vs. C, D	5.74 (1.86–17.75)	0.002*	9.27 (1.99–43.14)	0.005*
miR-223-3p	≥ 0.13 vs. < 0.13	4.38 (1.66–11.56)	0.003*	6.61 (2.36–18.55)	<0.001*
miR-199a-5p	≥ 0.46 vs. < 0.46	0.81 (0.38–1.72)	0.589
miR-451a	≥ 0.05 vs. < 0.05	1.03 (0.49–2.18)	0.933

Discussion

Growing evidence has indicated a critical role of miRNAs in hepatocarcinogenesis [4]. It is well recognized that these small non-coding RNAs involve in post-transcriptional regulation of gene expression and many cellular processes such as growth, angiogenesis, differentiation and metastasis[6]. Recent data have demonstrated that miRNA deregulation are already detectable in premalignant lesions including low-grade or high-grade dysplastic nodules, indicative of their contribution in early stages of HCC development [14]. Moreover, deregulated miRNAs are shown to be pivotal modulators in tumor progression and aggressiveness, in which they act as oncogenes or tumor suppressors [7]. Considering their contribution in various stages of hepatocarcinogenesis and their stability in body fluids, it appears that circulating miRNAs could serve as potential diagnostic and prognostic biomarkers for HCC.

The present study was primarily designed to compare miRNAs expression in tissue samples of patients with HBV-related HCC, and then validated the clinical implication of selected candidate miRNAs in serum specimens. In the discovery cohort, we applied the NanoString platform that allowed the detection of tissue miRNAs with high sensitivity and specificity. Based on this technique, we identified 29 miRNAs that were significantly differentially expressed in cancerous and non-cancerous tissues. Among these, miR-223-3p was significantly down-regulated expressed in cancerous tissue compared to their respective controls. Such finding was in agreement with previous data demonstrated that highly deregulated miR-223 expression could markedly distinguish HCC from adjacent non-cancerous liver, irrespective of viral hepatitis status [15, 16]. For instance, repressed miR-223 expression in cancerous tissues obtained from patients with chronic viral hepatitis exhibited median 5-fold reduction compared with the non-cancerous counterpart, while the corresponding figure observed in tumors derived from non-B non-C HCC was approximately 3.5-fold reduction [15]. Thus, altered expression of miR-223-3p in liver tissue suggested that this miRNA could hold value as a novel biomarker for HCC.

In the validated cohort of circulating miRNAs, we found that serum miR-223-3p levels were significantly lower in patients with HCC compared with the non-HCC group and healthy controls. Based on ROC curve analysis, it was revealed that circulating miR-223-3p could help discriminate HCC from the other two groups. At the cut-off level of 0.4, its sensitivity and specificity were approximately 80%. When this biomarker were applied together with serum AFP, the sensitivity of the combined test was approximately 85% for early cancer and reached 100% for detecting intermediate and advanced stage HCC. Currently, serum AFP is the most widely used tumor marker for the detection and monitoring of HCC. However, this fetal-specific glycoprotein lacks its sensitivity in detecting early HCC [17]. Thus, the combination of AFP and serum miR-223-3p could be considered as a potentially promising tool to better differentiate HCC from benign liver disorders, as demonstrated in this study. Of note, there was no difference of circulating miR-223-3p levels among non-HCC samples, suggesting that there was no sequential decline of this microRNA from normal controls and patients without HCC. These results were consistent with previous data demonstrating that serum miR-223 levels were significantly decreased in patients with HCC, irrespective of underlying etiologies, compared with sera from individuals without HCC [18-22]. Moreover, a recent meta-analysis indicated that the combination of miRNAs and AFP could significantly increase the diagnostic accuracy compared with the use of each test alone [23]. Interestingly, it was also highlighted in the above-mentioned report that circulating miRNAs exhibited great potential as a novel strategy for early diagnosis of HCC.

Additionally, our results showed that there was a negative correlation between down-regulation of serum miR-223-3p and more aggressive tumor behavior in patients with HCC. Specifically, decreased miR-223-3p level was observed more frequently in patients with large tumor size and advanced BCLC stages. In addition, Kaplan-Meier survival analysis showed that the overall survival of the low serum miR-223-3p group was significantly inferior to that of the high miR-223-3p expression group. Finally, multivariate analysis confirmed that diminished serum miR-223-3p level was an independent, unfavorable predictor of overall survival. To the best of our knowledge, this report is the first to demonstrate the prognostic implication of circulating miR-223-3p in patients with HCC.

As its expression was negatively related to tumor progression, our findings also suggested that this miRNA might display a tumor suppressive role in HCC. In fact, previously in vitro studies had reported the tumor suppressive role of miR-223-3p expression in HCC cell lines. For instance, it was shown that downregulation of miR-223 could promote Hep3B cell line via the insulin-like growth factor-1 signaling pathway [24]. In addition, miR-223-223-3p could regulate pyrin domain containing 3 in promoting hep3B apoptosis and inhibit cell proliferation [25]. Similarly, overexpression of miR-223 showed significantly increased HepG2 and Bel-7402 apoptosis and acted as a tumor suppressor through mTOR signaling pathway [26]. Moreover, downregulation of miR-223 could lead to alterations in integrin αV subunit expression, resulting in tumor cell migration and increased metastatic potential [16]. These in vitro studies supported our clinical findings that circulating miR-223 could represent a good prognostic marker for HCC. Regarding miR-199, previous data showed that this miRNA was associated with cell cycle processes in HCC via XBP1/cyclin D and acted as a tumor suppressor by targeting RGS17 in the inhibition of tumor growth [27]. For miR-451, previous published reports suggested that this miRNA strongly repressed HCC proliferation [28-30]. However, our results did not show any clinical significance of miR-199 and miR-451 in terms of diagnosis or prognosis of patients with HCC.

Besides the mentioned miRNAs, other several miRNAs might also involve in various processes of hepatocarcinogenesis [4]. For instance, previous data showed that the let-7 family of microRNAs modulated Bcl-xL expression and potentiated treatment-induced apoptosis in HCC [31]. In the discovery set, we found that hsa-let-7c was significantly up-regulated in cancerous tissues compared with non-cancerous tissues, which was in line with a previous study demonstrating that increased hsa-let-7c expression was associated with HCC progression and poor prognosis [32]. In contrast, other reports identified hsa-let-7c as being downregulated in HCC cell lines and human cancerous tissues [31, 33–34]. As the role of hsa-let-7c in HCC was still uncertain, we decided to exclude the analysis of this miRNA in the validation cohort. Regarding miR-155, previous data revealed a positive correlation between this miRNA and toll-like receptor 7 (TLR7), which might regulate viral transcription during chronic HBV infection [35]. Moreover, in an animal model aberrant expression of miR-155 was found at early stages of NAFLD-induced hepatocarcinogenesis [36]. In our study, however, its expression levels in cancerous and non-cancerous tissues were comparable, indicating this miRNA might not participate in the development of HBV-related HCC.

This report had some limitations as being a retrospective cohort, which recruited relatively small number of patients. Moreover, our study included only patients with chronic HBV infection, which might not be applicable to other etiological causes of chronic liver disease, such as chronic HCV infection, ALD and NAFLD. Despite these limitations, our data clearly demonstrated that miR-223-3p was differentially expressed in cancerous tissues compared with paired adjacent tissues. In addition, circulating miRNA-223-3p levels could differentiate HCC from the non-HCC groups. Apart from its diagnostic role, this circulating miRNA could also serve as a promising prognostic biomarker of HBV-related HCC. Further studies are worthwhile to confirm these observations and to elucidate the clinical significance of serum miRNA-223-3p in patients with HCC.

Clinicopathological features of 4 patients undergoing surgical resection.

(DOCX)

Click here for additional data file.

6 Nov 2019

PONE-D-19-28223

Diagnostic and prognostic roles of circulating miRNA-223-3p in hepatitis B virus–related hepatocellular carcinoma

PLOS ONE

Dear Dr. Tangkijvanich,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands, however it generated high enthusiam. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Dec 21 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Ratna B. Ray

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

Research reported in this publication was supported by the Thailand Research Fund (RTA6280004), the Grant for Chula Research Scholar (CU-GRS-60-06-30-03), the Royal Golden Jubilee Ph.D. Program (Grant No. PHD/0061/2559) and Center of Excellence in Hepatitis and Liver Cancer, Faculty of Medicine, Chulalongkorn University.

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

The authors have no any financial to disclose.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Pratedrat P et al. examined the expression of miRs from paired cancerous and adjacent non-cancerous liver tissue specimens of 4 patients with HBV related HCC.

1. Authors should describe which company made “GenUP™ Total RNA Kit”.

2. How did authors measure the miRs from sera? Authors should describe them. Which miR did they use? Because it is difficult to use miR-21 as internal control from sera. Did authors use a spike control? Cf) Nakamura M, et al. Serum microRNA-122 and Wisteria floribunda agglutinin-positive Mac-2 binding protein are useful tools for liquid biopsy of the patients with hepatitis B virus and advanced liver fibrosis. PLoS One. 2017 May 5;12(5):e0177302. doi: 10.1371/journal.pone.0177302.

3. Authors examined the expression of miRs from paired cancerous and adjacent non-cancerous liver tissue specimens of 4 patients with HBV related HCC. Please describe the backgrounds of these four patients in detail. Please demonstrate all data of miRs from these 4 patients.

4. In Table 1, which do they have HBV genotypes?

Reviewer #2: The study has been well designed and it compares miRNAs expression in tissue samples of patients with HBV related HCC and then validated the clinical implication of the selected miRNA s in serum specimens. In the validated cohort of circulating miRNAs it was observed that serum miRNA 223-3P levels were significantly lower in patients with HCC compared with the non HCC group and healthy controls. The combination of AFP and serum miRN-223P could be considered as a potentially promising tool to better differentiate HCC from benign liver disorders. There was also a negative correlation between down regulation of serum MIR-223-3P and aggressive behavior in patients with HCC. The study also demonstrates the prognostic implication of circulatory MIR-223-3P in patients with HCC.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

20 Dec 2019

Dear the editors

We appreciate the opportunity to submit a revision of our manuscript entitled “Diagnostic and prognostic roles of circulating miRNA-223-3p in hepatitis B virus-related hepatocellular carcinoma” for publication in PLOS ONE. It is gratifying that the editors and reviewers consider our study has been well designed and has generated high enthusiasm.

This revised manuscript has been improved as a result of changes made in response to the comments of the reviewers. We have attached a point-by-point response to the comments and have highlighted the changes from the previous version with red color in the revised manuscript.

This manuscript is not currently under consideration elsewhere, and all authors have approved the submission of this manuscript for publication in PLOS ONE.

Thank you for considering this revised manuscript. We look forward to your kind reply.

Best regards,

Pisit Tangkijvanich, M.D.

Center of Excellence in Hepatitis and Liver Cancer,

Faculty of Medicine, Chulalongkorn University,

Bangkok, 10330 Thailand

Telephone: +662-256-4482, Fax: +662-256-4482

E-mail address: pisittkvn@yahoo.com

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

________________________________________

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

________________________________________

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

________________________________________

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Point-by-Point Response to the Reviewers’ Comments

Reviewer #1: Pratedrat P et al. examined the expression of miRs from paired cancerous and adjacent non-cancerous liver tissue specimens of 4 patients with HBV related HCC.

1. Authors should describe which company made “GenUP™ Total RNA Kit”.

Ans. Thank you for the comment. “GenUP™ Total RNA Kit” was made by Biotechrabbit GmbH, Hennigsdorf, Germany (In Materials and Methods, page 6, line 122).

2. How did authors measure the miRs from sera? Authors should describe them. Which miR did they use? Because it is difficult to use miR-21 as internal control from sera. Did authors use a spike control? Cf) Nakamura M, et al. Serum microRNA-122 and Wisteria floribunda agglutinin-positive Mac-2 binding protein are useful tools for liquid biopsy of the patients with hepatitis B virus and advanced liver fibrosis. PLoS One. 2017 May 5;12(5):e0177302. doi: 10.1371/journal.pone.0177302.

Ans. We appreciate the comment. We agree that selecting a reliable reference gene is necessary for an accurate measurement of circulating miRNA by RT-qPCR. Based on a recent review by Anfossi S, et al (Clinical utility of circulating non-coding RNAs - an update, Nat Rev Clin Oncol 2018;15:541-63), the current gold standard techniques for normalization of miRNA expression data are still lacking. The more widely used methods are spiked-in exogenous controls or stably expressed miRNAs. For a spike-in control, it has been shown that this method could be associated with technical variation from manual pipetting error (de Ronde MWJ, et al, Study Design and qPCR Data Analysis Guidelines for Reliable Circulating miRNA Biomarker Experiments: A Review. Clin Chem. 2018; 64:1308-18) Based on several algorithms, including GeNorm, Normfinder, BestKeeper, and Comparative DCq, the most stably expressed reference genes in serum of patients with HCC appears to be miR-21 (Tang G, et al. Different normalization strategies might cause inconsistent variation in circulating microRNAs in patients with hepatocellular carcinoma. Med Sci Monit 2015; 21: 617-24). Thus, we selected miR-21 as the reference gene in this study and we found that the levels of miR-21 were consistent in all serum samples similar to the previous report.

3. Authors examined the expression of miRs from paired cancerous and adjacent non-cancerous liver tissue specimens of 4 patients with HBV related HCC. Please describe the backgrounds of these four patients in detail. Please demonstrate all data of miRs from these 4 patients.

Ans. The clinical backgrounds of these four patients in detail are shown in Supplement Table 1. All of the data of miRs are shown in Supplement File.

4. In Table 1, which do they have HBV genotypes?

Ans. HBV genotypes in the HCC and non-HCC groups are now added in Table 1. Genotype C was significantly more common in patients with HCC compared with patients without HCC (In Results, page 8, line 181-182).

Reviewer #2: The study has been well designed and it compares miRNAs expression in tissue samples of patients with HBV related HCC and then validated the clinical implication of the selected miRNA s in serum specimens. In the validated cohort of circulating miRNAs it was observed that serum miRNA 223-3P levels were significantly lower in patients with HCC compared with the non HCC group and healthy controls. The combination of AFP and serum miRN-223P could be considered as a potentially promising tool to better differentiate HCC from benign liver disorders. There was also a negative correlation between down regulation of serum MIR-223-3P and aggressive behavior in patients with HCC. The study also demonstrates the prognostic implication of circulatory MIR-223-3P in patients with HCC.

Ans. Thank you very much for the comments.

26 Feb 2020

PONE-D-19-28223R1

Diagnostic and prognostic roles of circulating miRNA-223-3p in hepatitis B virus–related hepatocellular carcinoma

PLOS ONE

Dear Tangkijvanich,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

In particular, other important microRNAs involved in HBV infection should be discussed

We would appreciate receiving your revised manuscript by 1 month. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Isabelle Chemin, PhD

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Authors found that miR-223-3p was differentially expressed in cancerous compared with paired adjacent non-cancerous tissues. However, the process of selection and other important microRNAs in HBV infection should be discussed. Because authors used small number of patients for screening.

1. It is unclear why the authors exclude hsa-let-7c. Discuss about hsa-let-7c, which is upregulated in your law data.

See: Jiang X, et al. Regulation of microRNA by hepatitis B virus infection and their possible association with control of innate immunity. World J Gastroenterol. 2014 Jun 21;20(23):7197-206.

2. Authors should discuss about miR-155. Ref. Sarkar N, et al. Expression of microRNA-155 correlates positively with the expression of Toll-like receptor 7 and modulates hepatitis B virus via C/EBP-β in hepatocytes. J Viral Hepat. 2015 Oct;22(10):817-27.

3. Authors should describe the patient characteristics of patients for Nanostring nCounter Analysis.

Reviewer #2: I find that the clarifications in response to the comments by the referees have been answered well and incorporated in the revised text of the paper.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

25 Mar 2020

Dear the editors

We appreciate the opportunity to submit a revision of our manuscript entitled “Diagnostic and prognostic roles of circulating miRNA-223-3p in hepatitis B virus-related hepatocellular carcinoma” for publication in PLOS ONE. It is gratifying that the editors and reviewers consider our study has been well designed and has generated high enthusiasm.

This revised manuscript has been improved as a result of changes made in response to the comments of the reviewers. We have attached a point-by-point response to the comments and have highlighted the changes from the previous version with red color in the revised manuscript.

This manuscript is not currently under consideration elsewhere, and all authors have approved the submission of this manuscript for publication in PLOS ONE.

Thank you for considering this revised manuscript. We look forward to your kind reply.

Best regards,

Pisit Tangkijvanich, M.D.

Center of Excellence in Hepatitis and Liver Cancer,

Faculty of Medicine, Chulalongkorn University,

Bangkok, 10330 Thailand

Telephone: +662-256-4482, Fax: +662-256-4482

E-mail address: pisittkvn@yahoo.com

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

2. Is the manuscripts technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Point-by-Point Response to the Reviewers’ Comments

Reviewer #1: Authors found that miR-223-3p was differentially expressed in cancerous compared with paired adjacent non-cancerous tissues. However, the process of selection and other important microRNAs in HBV infection should be discussed because authors used small number of patients for screening.

1. It is unclear why the authors exclude hsa-let-7c. Discuss about hsa-let-7c, which is upregulated in your law data. See: Jiang X, et al. Regulation of microRNA by hepatitis B virus infection and their possible association with control of innate immunity. World J Gastroenterol. 2014 Jun 21;20(23):7197-206.

Ans. Thank you very much for the comment. Based on our data, multiple let-7 isoforms including 7a, 7b, 7c, 7d, 7e, 7f, 7g and 7i were upregulated in cancerous tissues compared with non-cancerous tissues. However, previous reports regarding the role of let-7c in HCC was inconclusive. For example, a study showed that the upregulation of let-7c expression was associated with the progression and poor prognosis of HCC (ref#31). In contrast, other reports demonstrated that let-7c was downregulated in HCC cell lines and human malignant tissue (ref#32 and 33). (In Discussion, second paragraph, page 16).

Moreover, distinguishing let-7 miRNA family members that differ by a single nucleotide is difficult by conventional qRT-PCR. Other more specific methods such as stem-loop RT-qPCR combined with TaqMan-based real-time quantification and locked nucleic acid (LNA) might improve the detection. However, these techniques are highly dependent on the design of the stem-loop and LNA oligomers, which often requires extensive trial-and-error optimization and more expensive than conventional primers (Benes V, Castoldi M. Methods. 2010; 50(4):244-9). For these reasons, we decide to exclude the analysis of let-7c in the validation cohort.

2. Authors should discuss about miR-155. Ref. Sarkar N, et al. Expression of microRNA-155 correlates positively with the expression of Toll-like receptor 7 and modulates hepatitis B virus via C/EBP-β in hepatocytes. J Viral Hepat. 2015 Oct;22(10):817-27.

Ans. We appreciate the comment. Although this miRNA exhibited a positive correlation with TLR7 and might regulate the pathogenesis of HBV infection (ref#34), our data showed that its expression levels in cancerous tissues were similar to the non-cancerous specimens. Thus, this miRNA might not play an important role in human HCC. (In Discussion, second paragraph, page 16).

3. Authors should describe the patient characteristics of patients for Nanostring nCounter Analysis.

Ans. The characteristics and clinical backgrounds of 4 patients using in Nanostring nCounter analysis are shown in Supplement Table 1.

Reviewer #2: I find that the clarifications in response to the comments by the referees have been answered well and incorporated in the revised text of the paper.

Ans. Thank you very much for the comments.

10 Apr 2020

Diagnostic and prognostic roles of circulating miRNA-223-3p in hepatitis B virus–related hepatocellular carcinoma

PONE-D-19-28223R2

Dear Dr. Tangkijvanich

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Isabelle Chemin, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

14 Apr 2020

PONE-D-19-28223R2

Diagnostic and prognostic roles of circulating miRNA-223-3p in hepatitis B virus–related hepatocellular carcinoma

Dear Dr. Tangkijvanich:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Mrs Isabelle Chemin

Academic Editor

PLOS ONE