J L Carvalho1, M Miranda1, A K Fialho1, H Castro-Faria-Neto2, E Anatriello1, A C Keller3, F Aimbire1. 1. Department of Science and Technology, Federal University of São Paulo, São José dos Campos, São Paulo, Brazil. 2. Laboratory of Immunopharmacology, FioCruz, Rio de Janeiro, Brazil. 3. Department of Microbiology, Immunology and Parasitology, Federal University of São Paulo, São Paulo, São Paulo, Brazil.
Abstract
COPD is a prevalent lung disease with significant impacts on public health. Affected airways exhibit pulmonary neutrophilia and consequent secretion of pro-inflammatory cytokines and proteases, which result in lung emphysema. Probiotics act as nonspecific modulators of the innate immune system that improve several inflammatory responses. To investigate the effect of Lactobacillus rhamnosus (Lr) on cigarette smoke (CS)-induced COPD C57Bl/6 mice were treated with Lr during the week before COPD induction and three times/week until euthanasia. For in vitro assays, murine bronchial epithelial cells as well as human bronchial epithelial cells exposed to cigarette smoke extract during 24 hours were treated with Lr 1 hour before CSE addition. Lr treatment attenuated the inflammatory response both in the airways and lung parenchyma, reducing inflammatory cells infiltration and the production of pro-inflammatory cytokines and chemokines. Also, Lr-treated mice presented with lower metalloproteases in lung tissue and lung remodeling. In parallel to the reduction in the expression of TLR2, TLR4, TLR9, STAT3, and NF-κB in lung tissue, Lr increased the levels of IL-10 as well as SOCS3 and TIMP1/2, indicating the induction of an anti-inflammatory environment. Similarly, murine bronchial epithelial cells as well as human bronchial epithelial cells (BEAS) exposed to CSE produced pro-inflammatory cytokines and chemokines, which were inhibited by Lr treatment in association with the production of anti-inflammatory molecules. Moreover, the presence of Lr also modulated the expression of COPD-associated transcription found into BALF of COPD mice group, i.e., Lr downregulated expression of NF-κB and STAT3, and inversely upregulated increased expression of SOCS3. Thus, our findings indicate that Lr modulates the balance between pro- and anti-inflammatory cytokines in human bronchial epithelial cells upon CS exposure and it can be a useful tool to improve the lung inflammatory response associated with COPD.
COPD is a prevalent lung disease with significant impacts on public health. Affected airways exhibit pulmonary neutrophilia and consequent secretion of pro-inflammatory cytokines and proteases, which result in lung emphysema. Probiotics act as nonspecific modulators of the innate immune system that improve several inflammatory responses. To investigate the effect of Lactobacillus rhamnosus (Lr) on cigarette smoke (CS)-induced COPD C57Bl/6 mice were treated with Lr during the week before COPD induction and three times/week until euthanasia. For in vitro assays, murine bronchial epithelial cells as well as human bronchial epithelial cells exposed to cigarette smoke extract during 24 hours were treated with Lr 1 hour before CSE addition. Lr treatment attenuated the inflammatory response both in the airways and lung parenchyma, reducing inflammatory cells infiltration and the production of pro-inflammatory cytokines and chemokines. Also, Lr-treated mice presented with lower metalloproteases in lung tissue and lung remodeling. In parallel to the reduction in the expression of TLR2, TLR4, TLR9, STAT3, and NF-κB in lung tissue, Lr increased the levels of IL-10 as well as SOCS3 and TIMP1/2, indicating the induction of an anti-inflammatory environment. Similarly, murine bronchial epithelial cells as well as human bronchial epithelial cells (BEAS) exposed to CSE produced pro-inflammatory cytokines and chemokines, which were inhibited by Lr treatment in association with the production of anti-inflammatory molecules. Moreover, the presence of Lr also modulated the expression of COPD-associated transcription found into BALF of COPDmice group, i.e., Lr downregulated expression of NF-κB and STAT3, and inversely upregulated increased expression of SOCS3. Thus, our findings indicate that Lr modulates the balance between pro- and anti-inflammatory cytokines in human bronchial epithelial cells upon CS exposure and it can be a useful tool to improve the lung inflammatory response associated with COPD.
Although chronic obstructive pulmonary disease (COPD) is one of the major chronic health conditions in which disability and death rates are increasing worldwide, the development of new strategies to disease management remains underwhelming [1-3]. Although the intrinsic factors that contribute to COPD development remais subject of discussion, the cigarette smoke is well recognized as a risk factor for the disease [3].Chemokines such as CXCL1 and CXCL8 as well as cytokines TNF, IL-1β, IL-6, and IL-17 are chemotactic factors that attract inflammatory cells to the injured lung, principally neutrophils and monocyte-derived macrophage [4-7], where the pulmonary destruction initiates, compromising the alveolar parenchyma [8]. Exacerbated activity of metalloproteinases from neutrophils in COPDpatients is responsible for destruction of alveolar parenchyma [9-12]. In COPD, neutrophils release proteinases into lung milieu, such as metalloproteases MMP-9 and MMP-12, result in emphysema [13] where the immune system switches to a Th17 response to promote the perpetuation of inflammation [14]. The effects of matrix metalloproteinase (MMP) can be inhibited by tissue inhibitors of metalloproteinase (TIMP) secreted by several cells [15]. During the pathogenesis of COPD, the balance between the effects of MMP and its TIMP is dysregulated [16-18], since that MMP released by neutrophils overlaps with TIMP activity with consequent pulmonary tissue destruction.In parallel to the cytokine storm, the transcription factors NF-κB and the balance between STAT3/SOCS3 (suppressor of cytokine signaling 3) signaling are also present in the COPD pathogenesis through secretion of pro-inflammatory mediators, such as TNF, IL-8, IL-33, CXCL1, CXCL9, and CCL2 from bronchial epithelial cells [19, 20]. Some authors have evidenced an unbalanced SOCS3/STAT3 in in vivo COPD as well as in emphysematouspatients [21-23]. This phenomenon is characterized by a reduced SOCS3 expression associated with increased STAT3 causing pulmonary fibrosis.Cigarette pollutants can directly trigger pathogen-associated molecular patterns (PAMPs) such as toll-like receptors (TLRs), particularly TLR2 and TLR4, to initiate pattern recognition [24]. TLRs are present in dendritic cells, alveolar macrophages, neutrophils, and epithelial cells, and they have been correlated to lung inflammation caused by COPD [3]. Among them, the expression of TLR2, TLR4, and TLR9 is elevated in monocytes and TLRs are associated with number of sputum neutrophils, secretion of pro-inflammatory cytokines, and lung function impairment [25-27]. This is a reflex of the immune dysfunction observed in COPD [28, 29].Some airways structural cells, such as the bronchial epithelium, when exposed to cigarette smoke secrete pro-inflammatory mediators activating alveolar macrophages as well as attracting neutrophils and activated lymphocytes towards the injured tissue [13, 30]. In fact, the airway epithelial cells are interface between innate and adaptive immunity. Moreover, the bronchial epithelial cells also discharge transforming growth factor-β (TGFβ), which triggers fibroblast proliferation for tissue remodeling [14, 31]. Therefore, small airway-wall remodeling strongly contributes to airflow limitation in COPD, decline in lung function, and poor responses to available therapies [32-34].Due to the high morbidity and the limitations of existing COPD treatments [1, 35], innovative action is needed against airway inflammation as well as lung emphysema to better control the disease. One effective treatment for COPD may be to attenuate immune response driven to pro-inflammatory mediators and at the same time upregulate the secretion of anti-inflammatory proteins in lung milieu. Therefore, the ability of probiotics to modulate the immune response and the effects of their use to prevent the development of various chronic diseases, including COPD and asthma, has caught the attention of many researchers [36-40]. Little is known, however, concerning the nature of the probiotic-host cell interactions, or how these interactions could be manipulated to obtain stronger regulatory responses in treatment against COPD.Thus, we aim to investigate whether the oral feeding with probiotic Lactobacillus rhamnosus can beneficially modulate the immune response and attenuate lung inflammatory response in in vivo COPD model induced by cigarette smoke.
2. Material and methods
2.1. Animals
Three-month-old male C57Bl/6 mice were used. They were purchased from Center for the Development of Experimental Models (CEDEME) of the Federal University of São Paulo (UNIFESP), housed under controlled humidity, light and temperature conditions, inside ventilated polyethylene cages, in the vivarium located at Science and Technology Institute at the UNIFESP in São José dos Campos, SP, Brazil. The animals had food (Nuvilab–Quimtia. Brazil) and water ad libitum. The mice were anesthetized with ketamine (100 mg/kg) and xylazine (10 mg/kg) via i.p. and euthanized with excess anesthetics. The experiments were approved according to CONCEA (2016) and the Research Ethics Committee on Animal Use (CEUA) of UNIFESP under the register 9034130216.
2.2. Induction of COPD and preparation of the cigarette smoke extract (CSE)
The in vivo COPD was induced in C57Bl/6 mice by inhaling smoke from 14 cigarettes for 60 days, 7 days/week, for 30 min. The smoke was pumped into a plastic box measuring 42 cm (length) × 28 cm (width) × 27 cm (height), where the animals were kept and passively inhaled the cigarette smoke. For the in vitro experiments, the cigarette smoke extract (CSE) was prepared through the burning of 14 commercial cigarettes (tar: 13 mg; nicotine: 1.10 mg; carbon monoxide: 10 mg) using a vacuum machine (Nevoni– 1001 VF-PE. Series: 304—Brazil) with -11 Kpa to be incorporated into PBS.
2.3. Oral feeding with Lactobacillus rhamnosus
The mice were treated via gavage with probiotic Lactobacillus rhamnosus (Lr) (1×109 CFU/0.2 mL PBS/mouse) (Liane Laboratory, Ribeirão Preto, SP) each day for seven days prior to the COPD induction and then 3 times/week until euthanasia. The experimental protocol is illustrated in Fig 1.
Fig 1
Time schedule of COPD model and probiotic treatment.
Male C57Bl/6 mice were exposed to inhalation of cigarette smoke (14 cigarettes; 30 minutes/day; 7 days/week; during 60 days) for COPD induction and treated with Lactobacillus rhamnosus (Lr) (109 CFU/0.2 mL PBS/mouse) for seven days prior to the COPD induction and, after that, 3 times/week until the day of the euthanasia.
Time schedule of COPD model and probiotic treatment.
Male C57Bl/6 mice were exposed to inhalation of cigarette smoke (14 cigarettes; 30 minutes/day; 7 days/week; during 60 days) for COPD induction and treated with Lactobacillus rhamnosus (Lr) (109 CFU/0.2 mL PBS/mouse) for seven days prior to the COPD induction and, after that, 3 times/week until the day of the euthanasia.
2.4. Murine bronchial epithelial cells and culture conditions
The lungs were removed and immersed in sterile enzymatic solution for digestion with dispase II for 60 min. After digestion, the cells were resuspended in cell basal medium that contained growth factors for epithelial cells and placed in petri dishes for 20 min. Adherent cells were collected and resuspended in RPMI 1640 plus fetal bovine serum, penicillin, and streptomycin and then maintained in culture until the third passage. The cells were isolated, plated and restimulated with 2.5% cigarette smoke extract (CSE) incorporated into the culture medium. The treatment with Lactobacillus rhamnosus (Lr) was performed 1 h before CSE addition in culture medium with murine bronchial epithelial cells. Then 24 hours after CSE addition, the culture supernatants were removed, and stored at -40°C until use.
2.5. Human bronchial epithelial cells (BEAS-2B) and culture conditions
The lineage of human bronchial epithelium cells (BEAS-2B (ATCC® CRL-9609™)) were isolated from normal human bronchial epithelium obtained from autopsy of healthy individuals and were acquired from American Type Culture Collection (Manassas, VA). BEAS cells were cultured in small airway cell basal medium that contained growth factors for epithelial cells. The cells used were between the 45th and 55th generation passages. BEAS cells were washed with medium and introduced into each well of 24-well culture plates in triplicate at a concentration of 6×105 cells.mL-1. After 12 hours, BEAS cells were exposed to cigarette smoke extract (CSE) and probiotic (1×105 UFC of Lr). The CSE was made from 1 unfiltered cigarette which was burned in 10 mL of culture medium. A vacuum pump was used at a pressure of -11 Kpa so that the cigarette smoke could be incorporated into the culture medium. Cells were stimulated with 2.5% CSE incorporated into the culture medium. The treatment with probiotic was performed 1 h before CSE addition in culture medium with BEAS cells. Then, 24 hours after CSE addition, the culture supernatants were removed, and stored at -40°C until use.
2.6. Experimental groups
The animals were randomly divided into 3 groups of 7 animals each: control (pure air inhalation for 60 days); COPD (14 cigarettes smoke inhalation for 60 days; 30 min a day; 7 days/week); Lr + COPD (14 cigarettes smoke inhalation for 60 days; 30 min a day, 7 days/week + Lactobacillus rhamnosus). The animals received Lr (109 CFU/0.2 mL PBS/mouse) every day for the entire week before inhalation of CS and, after that, 3 days/week until euthanasia. For in vitro assays, murine bronchial epithelial cells or BEAS cells were divided in 3 groups: control (culture medium alone), COPD (murine bronchial epithelial cells or BEAS cells exposed to CSE), and Lr + COPD (murine bronchial epithelial cells or BEAS cells exposed to Lr 1-hour prior to addition of CSE in culture medium). The murine bronchial epithelial cells or BEAS cells were incubated with a density of 5×105 /mL of Lr.
2.7. Bronchoalveolar lavage fluid (BALF)
After the mice were euthanized with excess anesthetics, the trachea was cannulated, and lungs were rinsed with 0.5 mL of cold PBS (saline). This was followed by 2 additional washings with the same saline volume. Total and differential cell counts of BALF were determined by hemocytometer and cytospin preparation stained with Instant-Prov (Newprov, Brazil). Number of macrophages, neutrophils, and lymphocytes were scored by light microscopy.
2.8. Histology and image analysis
After the euthanasia, the lungs were carefully removed, perfused, and fixed with 4% paraformaldehyde for 24 h at a positive pressure (20 cm H2O), for histological examination. Paraffin (Sigma-Aldrich Co., St. Louis, MO, USA) was used to embed the fixed tissue. Lung segments of approximately 5μm were stained with hematoxylin and eosin (Sigma-Aldrich Co.) for morphometric analysis of pulmonary emphysema. The parameters analyzed were peribronchial inflammation (polymorphonuclear cells), alveolar wall enlargement (Lm), deposition of collagen fibers, and destruction of elastic fibers. Five airways of all animals were imaged at 400 X magnifications using a Nikon Eclipse E-200 microscope camera and the software Image Pro-Plus 4.0.
2.8.1. Alveolar enlargement
Sections of lung tissue were stained with hematoxylin and eosin (Sigma-Aldrich Co.), and the increased air space was evaluated by the linear mean of the alveolar intercept (Lm) in twenty fields selected from each slide of lung tissue, with amplification of 200 X. The destruction of the alveolar septa was evaluated by the technique of counting points in twenty fields randomly throughout the pulmonary parenchyma (excluding fields presenting airways and pulmonary vessels).
2.8.2. Peribronchial inflammation
Peribronchial inflammation was obtained through analyzing the space between the basal membrane and adventitia. The number of polymorphonuclear cells were evaluated in this specific area. Polymorphonuclear cells were counted according to morphological criteria; groups were blinded. The results were expressed as number of cells per square millimeter. The number of polymorphonuclear cells per square millimeter of lung tissue was presented graphically.
2.8.3. Collagen fibers
The collagen deposition in the airways was performed with the addition of Picrosirius staining (Sigma-Aldrich Co.). The density of the collagen fibers was measured using a standardized color threshold (red) by the CellSens software from the region between the basal membrane of the epithelium to the adventitial airway. The results were expressed as μm2 of collagen fibers/collagen per μm2 of lung tissue area.
2.8.4. Elastic fibers
The destruction of elastic fibers in the airways was performed with the addition of Verhoeff Van Grieson (Sigma-Aldrich Co.) staining for elastic fiber marking. In brief, five airway tissues per animal (all animals of all groups) were subjected to image analysis using the CellSens software. The density of the elastic fibers was measured using a standardized color threshold (brown) by the CellSens software for the region between the basal membrane of the epithelium to the adventitial airway. The results were expressed in μm2 of elastic fibers/elastic fibers per μm2 of lung tissue area.
2.9. Cytokines and TGF-β in BALF, in bronchial epithelial cells and lung tissue
The levels of cytokine, chemokines and TGF-β in BALF, in murine bronchial epithelial cells, as well as in BEAS cells were assessed using ELISA kits for mice or human. The ELISA assay kit for mice was also employed to measure the SOCS3 concentration in lung tissue. All ELISA kits were used in accordance with the manufacturer’s instructions. Briefly, 200 μL of BALF were used in a quantitative sandwich enzyme immunoassay technique. For this, a mouse specific cytokine and chemokine monoclonal antibody was pre-coated on a microplate. Standards, control and colors are pipetted into wells and the concentration of cytokine present is activated by the immobilized antibody. After washing off non-activated chemicals, a polyclonal antibody binds to a specific enzyme to each cytokine and is then added to wells. After washing to remove any unbound antibody-enzyme reagent, a substrate solution is added to the wells. An enzymatic reaction produces a blue product that turns yellow when a stop solution is added. The intensity of the measurement is proportional to the amount of each cytokine evaluated in specific lysate kits in the initial step. The sample values are then read on the standard curve”. Values are expressed as pg/mL deduced from standard runs in parallel with recombinant cytokines, chemokines and TGF-β.
2.10. Real-time Polymerase Chain Reaction (PCR) for MMP-9, MMP-12, TIMP1, TIMP2, TLR2, TLR4, TLR9, NF-κB, STAT3 and SOCS3
The mRNA expression in the animal lung tissue, in murine bronchial epithelial cells, as well as in BEAS cells was quantified by real-time PCR for MMP-9: CGGATTTGGCCGTAT TGGGC (forward) and TGATGGCATGCACTGTGGTC (reverse) and MMP-12: TTTGACCCACTTCGCC (forward) and GTGACACGACGGAACAG (reverse), TIMP-1: CCACGAATCAAGAGACC (forward) and GGCCCGTGATGAGAAAC (reverse) and TIMP-2: GGTAGCCTGTGAATGTTCCT (forward) and ACGAAAATGCCCTCAGAAG (reverse), TLR-2: GAGCATCCGAATTGCATCACC (forward) and CCCAGAAGCATCACATGACAGAG (reverse), TLR-4: CATGGATCAGAAACTCAGCAAAGTC (forward) and CATGCCATGCCTTGTCTTCA (reverse), and TLR-9: CAGCTAAAGGCCCTGACCAA (forward), and CCACCGTCTTGAGAATGTTGTG (reverse), plus the transcription factors NF-ĸB: CCGGGAGCCTCTAGTGAGAA (forward) and TCCATTTGTGACCAACTGAACGA (reverse), STAT3: TACCAGCCCTCCAATCAAAG (forward) and GGTCACACAGCACACAATCC, and SOCS3: CTGCAGGAGAGCGGATTCTACT (forward) and GCTGTCGCGGATAAGAAAGG (reverse). The tests were conducted in accordance with the manufacturer’s specifications. Briefly, 1μg of the total RNA was used for cDNA synthesis. Reverse transcription (RT) was performed in a 200μL solution in the presence of 50mM Tris-HCl (pH 8.3), 3mM MgCl2, 10mM dithiothreitol, 0.5mM dNTPs, and 50ng random oligonucleotides with 200 units of reverse transcriptase (Invitrogen ™). Reaction conditions were: 20 °C for 10 min, 42 °C for 45 min, and 95 °C for 5 min. A 7000-sequence detection system (ABI Prism, Applied Biosystems®) was used through the SYBRGreen kit (Applied Biosystems®) and the values obtained normalized against the internal control gene GAPDH: CGGATTTGGCCGTATTGGGC (forward) and TGATGGCATGCACTGTGGTC (reverse).
2.11. Immunohistochemistry for NF-κB and STAT3 in lung tissue
For immunohistochemistry analysis, the paraffin-embedded sections of lung tissues were deparaffinized with xylene and then rehydrated. Section slides were incubated with 3% hydrogen peroxide for 10 min, then in 5% BSA in PBS blocking solution for 20 min, and after, incubated overnight with anti-NF-κB antibody (Cell signaling Technology) in blocking solution at 4 °C. After washing with PBS, the slides were treated with biotinylated secondary antibody for 20 min, streptavidin-HRP (horseradish peroxidase) for 20 min, and 3,3N-Diaminobenzidine Tetrahydrochloride for 10 min. The slides were then washed, and counter stained with hematoxylin. Slides were evaluated by microscopy, and the positive cells exhibited yellow or brown particles.
2.12. Statistics
The results were evaluated through the Analysis of Variance (ANOVA) and the Tukey-Kramer Multiple Comparison Test to determine the differences between the groups. The analysis were performed using Sigma Stat 3.1 software and graphs using GraphPad Prism 5.0 software. The results were considered significant when p < 0.05.
3. Results
3.1. Lactobacillus rhamnosus attenuate the cigarette-induced airway inflammation
The analysis of cellular content in BALF revealed that in response to cigarette smoke, the COPD group presented with an increase in the total number of cells in the airways, in comparison to the control, non-smoking group (Fig 2A). In concordance with the characteristic inflammatory response observed in COPD manifestation, the infiltrating cells were constituted by macrophages (2B), neutrophils (2C), and lymphocytes (2D). In contrast, it is possible to observe in the Lr group that probiotic feeding inhibited the influx of inflammatory cells into the airways. This phenomenon was accomplished by a significant attenuation in the levels of pro-inflammatory molecules (Fig 3). The exposure to cigarette smoke increased the levels of both pro-inflammatory cytokines, such as IL-1β (3A), IL-6 (3B), TNF-α (3C), KC (3D), IL-17 (3E), and TGF-β (3J) in BALF, in comparison to control group. Controversially, the Lr group presented with a significant reduction in the levels of both pro-inflammatory cytokines and chemokines when compared with the COPDmice. For notice, the inflammatory response observed in the COPD group was correlated with a significant reduction in the levels of IL-10 (3K) in the airways, whereas in the Lr this anti-inflammatory cytokine is increased. For pro-inflammatory mediators, there was no difference between the Lr group and the control group (data not shown).
Fig 2
Leukocyte lung infiltration.
After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), the total cells (2A) and inflammatory cells were counted (x105) in BALF in millimeters by the morphometric evaluations of cytospin preparations. Pulmonary inflammation was represented by the influx of specific leukocytes; neutrophil (2B), macrophage (2C), and lymphocytes (2D) in BALF fluid. All cell counts were obtained from the control, COPD and Lr + COPD groups. No significant difference between Lr group and control group (data not shown). Each plot represents mean ± SEM from 7 different animals. The experiments were performed in triplicate. Results were considered significant when p < 0.05.
Fig 3
Cytokines and chemokines in BALF and SOCS3 in lung tissue.
The BALF obtained from control, COPD, and Lr + COPD groups was prepared for analysis of pro- and anti-inflammatory cytokines. The mediator’s TNF (3A), IL-1β (3B), IL-6 (3C), IL-17 (3D), CXCL1 (3E), IL-10 (3F), TGF-β (3G) in BALF and SOCS3 (3H) in lung tissue were assayed by enzyme-linked immunosorbent assay (ELISA). Each plot represents mean ± SEM from 7 different animals. The experiments were performed in triplicate. Results were considered significant when p < 0.05.
Leukocyte lung infiltration.
After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), the total cells (2A) and inflammatory cells were counted (x105) in BALF in millimeters by the morphometric evaluations of cytospin preparations. Pulmonary inflammation was represented by the influx of specific leukocytes; neutrophil (2B), macrophage (2C), and lymphocytes (2D) in BALF fluid. All cell counts were obtained from the control, COPD and Lr + COPD groups. No significant difference between Lr group and control group (data not shown). Each plot represents mean ± SEM from 7 different animals. The experiments were performed in triplicate. Results were considered significant when p < 0.05.
Cytokines and chemokines in BALF and SOCS3 in lung tissue.
The BALF obtained from control, COPD, and Lr + COPD groups was prepared for analysis of pro- and anti-inflammatory cytokines. The mediator’s TNF (3A), IL-1β (3B), IL-6 (3C), IL-17 (3D), CXCL1 (3E), IL-10 (3F), TGF-β (3G) in BALF and SOCS3 (3H) in lung tissue were assayed by enzyme-linked immunosorbent assay (ELISA). Each plot represents mean ± SEM from 7 different animals. The experiments were performed in triplicate. Results were considered significant when p < 0.05.
In concordance with the findings observed in the BALF, the COPD group presented with an inflammatory response in lung tissue (Fig 4), with marked influx of polymorphonuclear cells into the parenchyma (4A). Also, these animals exhibited signals characteristic of tissue remodeling as alveolar wall enlargement (4B), and collagen deposition (4C) and elastic fibers destruction (4D). In contrast, it is possible to observe in the Lr group that probiotic feeding reduced the peribronchial inflammation (the influx of polymorphonuclear cells) as well as alveolar enlargment, collagen deposition and elastic fibers destruction. In morphometric studies, there was no significant difference between the Lr group and the control group (data not shown).
Fig 4
Airway morphometry.
After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), sections (5 μm) of formalin-fixed lungs were stained with hematoxylin and eosin for histological examination in control, COPD, and Lr + COPD groups. (Original magnification, ×200). (4A) Quantification of polymorphonuclear cells in airway wall, (4B) Alveolar enlargement (Lm), (4C) Collagen fibers deposition, and (4D) Fiber elastics destruction were measured as described in Material and Methods section. Each plot represents mean ± SEM from 7 different animals. Results were considered significant when p < 0.05.
Airway morphometry.
After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), sections (5 μm) of formalin-fixed lungs were stained with hematoxylin and eosin for histological examination in control, COPD, and Lr + COPD groups. (Original magnification, ×200). (4A) Quantification of polymorphonuclear cells in airway wall, (4B) Alveolar enlargement (Lm), (4C) Collagen fibers deposition, and (4D) Fiber elastics destruction were measured as described in Material and Methods section. Each plot represents mean ± SEM from 7 different animals. Results were considered significant when p < 0.05.
3.3. Lactobacillus rhamnosus modulates the balance between metalloproteases and tissue inhibitors of metalloproteases
In COPD, pulmonary remodeling is correlated with the deregulation in the balance between MMP and its inhibitors (TIMP). The analysis of lung tissue by quantitative PCR revealed that CS inhalation induced a significant increase in the mRNA expression of both MMP-9 (5A) and MMP-12 (5B) accomplished by inhibition in the expression of the genes associated with TIMP-1 and TIMP-2 proteins (5C and 5D, respectively). On the other hand, oral feeding with Lr sustained the expression of the mRNA for MMP-9 and MMP-12 in levels comparable to those found in control animals, and partially restored the expression of both TIMP-1 and TIMP-2 genes. No significant difference between Lr group and control group (data not shown) (Fig 5).
Fig 5
Metalloproteases in lung tissue.
The mRNA expression of the MMP-9, MMP-12, TIMP-1 and TIMP-2 in lung from the control, COPD, and Lr + COPD groups is illustrated in Fig 5. After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), the mRNA expression for MMP-9 (5A), MMP-12 (5B), TIMP-1 (5C), and TIMP-2 (5D) in lung tissue were evaluated through Real Time-PCR. The values were normalized by the GAPDH expression and expressed by arbitrary units. Each bar represents mean ± SEM from 7 different animals. The experiments were performed in triplicate. Results were considered significant when p < 0.05.
Metalloproteases in lung tissue.
The mRNA expression of the MMP-9, MMP-12, TIMP-1 and TIMP-2 in lung from the control, COPD, and Lr + COPD groups is illustrated in Fig 5. After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), the mRNA expression for MMP-9 (5A), MMP-12 (5B), TIMP-1 (5C), and TIMP-2 (5D) in lung tissue were evaluated through Real Time-PCR. The values were normalized by the GAPDH expression and expressed by arbitrary units. Each bar represents mean ± SEM from 7 different animals. The experiments were performed in triplicate. Results were considered significant when p < 0.05.
3.4. Lactobacillus rhamnosus downregulates expression of STAT3 and NF-κB in lung tissue
The activation of the STAT3 pathway and, consequently, the induction of NF- κB transcription factor regulate the expression of genes associated with inflammation in lung diseases and are correlated with disease severity. In concordance, inhalation of CS induced a significant increase in the mRNA expression of NF-κB and STAT3-related genes in lung tissue from COPDmice, in comparison to control group (Fig 6A and 6B, respectively). In contrast, the Lr group presented with a lower expression of these genes when compared to COPDmice, in levels similarly to those found in control group. These data were corroborated with immunohistochemical staining of lung tissue (Fig 6A and 6B). No significant difference between Lr group and control group (data not shown).
Fig 6
Transcription factors in lung tissue.
The mRNA expression of the NF-κB and STAT3 in lung from the control, COPD, and Lr + COPD groups is illustrated. After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), the mRNA expression for NF-κB (6A) and STAT3 (6B) in lung tissue were evaluated through Real Time-PCR. The values were normalized by the GAPDH expression and expressed by arbitrary units. For immunohistochemical localization of NF-κB and STAT3 in lung tissue of mice from control, COPD and Lr + COPD groups, the positive reaction was visualized as a yellowish-brown stain. Each plot represents mean ± SEM from 7 different animals. Results were considered significant when p < 0.05.
Transcription factors in lung tissue.
The mRNA expression of the NF-κB and STAT3 in lung from the control, COPD, and Lr + COPD groups is illustrated. After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), the mRNA expression for NF-κB (6A) and STAT3 (6B) in lung tissue were evaluated through Real Time-PCR. The values were normalized by the GAPDH expression and expressed by arbitrary units. For immunohistochemical localization of NF-κB and STAT3 in lung tissue of mice from control, COPD and Lr + COPD groups, the positive reaction was visualized as a yellowish-brown stain. Each plot represents mean ± SEM from 7 different animals. Results were considered significant when p < 0.05.
3.5. The beneficial effect of Lactobacillus rhamnosus is associated with a reduction in the expression of toll-like receptors in lungs
Because TLR engagement plays an important role in COPD pathogenesis, we decided to determine the status of mRNA expression to different TLRs in our model. Fig 7 demonstrates that among the TLR studied, the expression of mRNA for TLR2 (7A), TLR4 (7B), and TLR9 (7C) increased in cigarette smoke challenged-mice compared to control group. On the other hand, the treatment with Lr reduced the expression of induced a significant reduction in these genes in comparison with COPD group. No significant difference between Lr group and control group (data not shown).
Fig 7
Toll-like receptors in lung tissue.
After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), the mRNA expression for TLR2 (7A), TLR4 (7B) and TLR9 (7C) in lung tissue of control, COPD and Lr + COPD groups was evaluated through Real Time-PCR. The values were normalized by the GAPDH expression and expressed by arbitrary units. Each bar represents mean ± SEM from 7 different animals. The experiments were performed in triplicate. Results were considered significant when p < 0.05.
Toll-like receptors in lung tissue.
After exposure of C57Bl/6 male mice to cigarette smoke and treatment with Lactobacillus rhamnosus (Lr), the mRNA expression for TLR2 (7A), TLR4 (7B) and TLR9 (7C) in lung tissue of control, COPD and Lr + COPD groups was evaluated through Real Time-PCR. The values were normalized by the GAPDH expression and expressed by arbitrary units. Each bar represents mean ± SEM from 7 different animals. The experiments were performed in triplicate. Results were considered significant when p < 0.05.
3.6. Lactobacillus rhamnosus modulates the secretion of inflammatory mediators in murine bronchial epithelial cells
The airway epithelium is central to the pathogenesis of COPD. Therefore, we investigated the secretion of cytokines and chemokines from murine bronchial epithelial cells stimulated with CSE, treated with Lr, or stimulated with CSE and treated with Lr. As shown in Fig 8, the secretion of TNF (8A), IL-1β (8B), IL-6 (8C), CXCL1 (8D), from CSE-bathed murine bronchial epithelial cells increased compared to control group. On the contrary, the CSE-exposed murine bronchial epithelial cells secreted lower levels of IL-10 (8E), TGF-β (8F) as well as SOCS3 (8G) than murine bronchial epithelial cells from control group. The pre-incubation with Lr probiotic inhibited the secretion of all cytokines, with exception of SOCS3, TGFβ and IL-10, which were upregulated, even in comparison to control group. For pro-inflammatory mediators, there was no difference between the Lr group and the control group (data not shown).
Fig 8
Murine bronchial epithelial cells.
Cytokines and chemokines secretion from murine bronchial epithelial cells of control and COPD groups and treated with Lr 1 hour before addition of CSE is illustrated in Fig 8. The inflammatory mediator’s TNF (8A), IL-1β (8B), IL-6 (8C), CXCL1 (8D), IL-10 (8E), TGF-β (8F) and SOCS3 (8G) in supernatant of murine bronchial epithelial cells were assayed by enzyme-linked immunosorbent assay (ELISA). The assays were performed in triplicate. Results were considered significant when p < 0.05.
Murine bronchial epithelial cells.
Cytokines and chemokines secretion from murine bronchial epithelial cells of control and COPD groups and treated with Lr 1 hour before addition of CSE is illustrated in Fig 8. The inflammatory mediator’s TNF (8A), IL-1β (8B), IL-6 (8C), CXCL1 (8D), IL-10 (8E), TGF-β (8F) and SOCS3 (8G) in supernatant of murine bronchial epithelial cells were assayed by enzyme-linked immunosorbent assay (ELISA). The assays were performed in triplicate. Results were considered significant when p < 0.05.
3.7. Lactobacillus rhamnosus modulates the secretion of inflammatory mediators in human bronchial epithelial cells (BEAS)
We investigated the secretion of cytokines and chemokines from human bronchial epithelial cells (BEAS) stimulated with CSE or stimulated with CSE and treated with Lr. As shown in Fig 9, the secretion of TNF (9A), IL-1β (9B), IL-6 (9C), and CXCL8 (9D) from CSE-bathed BEAS cells increased compared to control group. On the other hand, CSE-exposed BEAS cells secreted lower levels of IL-10 (9E) as well as TGFβ (9F) compared to control group. The same effect was observed with levels of SOCS3 (9G) The presence of probiotic in BEAS cell culture stimulated with CSE markedly inhibited the secretion of all cytokines investigated herein, with exception of SOCS3, TGFβ and IL-10, which were upregulated in comparison to control cells. For pro-inflammatory mediators, there was no difference between the Lr group and the control group (data not shown).
Fig 9
Human bronchial epithelial cells (BEAS).
Cytokines and chemokines secretion from BEAS cells stimulated with CSE and treated with Lr are illustrated in Fig 9. The inflammatory mediator’s TNF (9A), IL-1β (9B), IL-6 (9C), CXCL8 (9D), IL-10 (9E), TGFβ (9F) and SOCS3 (9G) in supernatant of human bronchial epithelial cells were assayed by enzyme-linked immunosorbent assay (ELISA). The assays were performed in triplicate. Results were considered significant when p < 0.05.
Human bronchial epithelial cells (BEAS).
Cytokines and chemokines secretion from BEAS cells stimulated with CSE and treated with Lr are illustrated in Fig 9. The inflammatory mediator’s TNF (9A), IL-1β (9B), IL-6 (9C), CXCL8 (9D), IL-10 (9E), TGFβ (9F) and SOCS3 (9G) in supernatant of human bronchial epithelial cells were assayed by enzyme-linked immunosorbent assay (ELISA). The assays were performed in triplicate. Results were considered significant when p < 0.05.
3.8. Lactobacillus rhamnosus downregulates NF-κB, STAT3 and SOCS3 in murine bronchial epithelial cells and in BEAS cells
The in vivo findings indicated that the anti-inflammatory effects of Lr treatment was associated with the modulation of the genes associated with NFκB and STAT3 pathways (Fig 10). In concordance, both the murine bronchial epithelial cells (10A and 10B) and human bronchial epithelial cells (10C and 10D) cells presented with increased expression of mRNA to NF-κB and STAT3 genes upon exposure to CSE, in comparison to control cells. The Lr treatment maintained the expression of these genes at levels similar to those observed in the control cells, corroborating the notion that the beneficial effects associated with the probiotic involves the control of the STAT3 pathway. On the contrary, both the murine bronchial epithelial cells (10C) and the BEAS cells (10F) stimulated with CSE presented a level lower of SOCS3 compared to control group. The oral feeding with Lr restored the SOCS3 levels in murine bronchial cells as well as in BEAS cells to values similar to control. STAT3 and NFκB pathways are regulated by molecules such as SOCS3, which lower levels has been associated with COPD. For pro-inflammatory transcription factors, there was no difference between the Lr group and the control group (data not shown).
Fig 10
Transcription factors in murine bronchial epithelial cells and in BEAS.
The mRNA expression of the NF-κB, STAT3 as well as SOCS3 in murine bronchial epithelial cells from the control, COPD, and Lr + COPD groups is illustrated in Figs 10A, 10B and 10C, respectively. Figs 10D, 10E and 10F presents the mRNA expression of the NF-κB, STAT3 as well as SOCS3 in human bronchial epithelial cells (BEAS) from the control, COPD, and Lr + COPD groups. After exposure of both airway epithelial cells, murine and human, to cigarette smoke extract (CSE) and treatment with Lactobacillus rhamnosus (Lr), the mRNA expression for NF-κB, STAT3 and SOCS3 in lung tissue was evaluated through Real Time-PCR. The values were normalized by the GAPDH expression and expressed by arbitrary units. The assays were performed in triplicate. Results were considered significant when p < 0.05.
Transcription factors in murine bronchial epithelial cells and in BEAS.
The mRNA expression of the NF-κB, STAT3 as well as SOCS3 in murine bronchial epithelial cells from the control, COPD, and Lr + COPD groups is illustrated in Figs 10A, 10B and 10C, respectively. Figs 10D, 10E and 10F presents the mRNA expression of the NF-κB, STAT3 as well as SOCS3 in human bronchial epithelial cells (BEAS) from the control, COPD, and Lr + COPD groups. After exposure of both airway epithelial cells, murine and human, to cigarette smoke extract (CSE) and treatment with Lactobacillus rhamnosus (Lr), the mRNA expression for NF-κB, STAT3 and SOCS3 in lung tissue was evaluated through Real Time-PCR. The values were normalized by the GAPDH expression and expressed by arbitrary units. The assays were performed in triplicate. Results were considered significant when p < 0.05.
4. Discussion
The present study demonstrates the ability of the probiotic Lactobacillus rhamnosus (Lr) to control lung inflammation in cigarette smoke (CS)-induced COPD experimental model. Lr feeding attenuated both the migration of inflammatory cells to the lung and tissue remodeling features, such as alveolar enlargement and exacerbated deposition of collagen and mucus secretion. Although the mechanisms involved in this phenomenon remain an object of study, the probiotic mitigated the cytokine storm associated with COPD pathogenesis, maintaining the equilibrium between transcription factors that regulate the production of pro and anti-inflammatory molecules.Our findings corroborate previous studies showing that that CS inhalation induces a robust migration of inflammatory cells to the lung environment, mainly macrophage and neutrophils [41-43]. In response to CS, pulmonary cells produced pro-inflammatory cytokines such as IL-1β, IL-6 and TNF-α resulting in the secretion of several chemokines. The increase in CXCL1 levels promotes the migration and differentiation of monocytes in lung tissue, amplifying the inflammatory process [44-46]. The chronic inflammation of the lungs results in alterations in the parenchyma architecture, a process known as tissue remodeling, due an unbalance between active MMPs and its inhibitors, TIMP [47, 48]. In concordance with this notion, CS group presented, in association with pulmonary neutrophilia, alveolar enlargement as well as loss of alveolar parenchyma, collagen deposition, and destruction of elastic fibers. These structural alterations were accomplished by a significant increase in the mRNA expression for MMP-9 and MMP-12 that was inversely to gene expression for TIMP-1 and TIMP-2. Despite the cytokine/chemokine storm and the consequent cascade of events induced by CS inhalation, probiotic feeding attenuated the inflammatory process both in the airways space and lung parenchyma.Although the mechanisms behind this effect are allusive, we found that Lr feeding increased both the levels of IL-10 in the BALF and SOCS3 in lung tissue, even when compared to control animals, indicating that probiotic induced an anti-inflammatory stead state. This idea is corroborated by the fact that Lr feeding sustained the levels of mRNA for TLRs, one of the major players in CS-induced COPD, and for pro-inflammatory transcription factors, such as NFκB and STAT3, at levels comparable to those from control animals. It is noteworthy that the group of mice that received only Lr (group Lr) was added in the Figures when there was significant difference from the Lr group compared to the control group. It happened in the concentration of IL-10, TGF-β and SOCS3 proteins, that is, proteins that guarantee an anti-inflammatory millieu in the lung. These results reinforce the idea that the insertion of certain probiotics in the diet can guarantee an anti-inflammatory balance in COPD. Our results also show that airway epithelial cells participate as target of Lr for secretion of the same anti-inflammatory mediators observed in in vivo COPD. These data strongly suggest that daily oral feeding protects the bronchial epithelial cells through increasing of anti-inflammatory response. This result is important because airway epithelial cells are the first barrier between the airways and the environment, and they are therefore activated by a variety of agents, including cigarette smoke.Some authors have highlighted the complex roles of TLRs in the pathogenesis of COPD and suggested that the activation of TLR2 and/or inhibition of TLR4 may be novel therapeutic strategies for the treatment of COPD [49]. Despite it, most studies show that TLR4 stimulation followed by TLR2 stimulation does not cause tolerance but enhances cytokine production from activated neutrophils instead [50]. This may be a relevant mechanism by which bacteria cause excessive inflammation in COPDpatients. In addition, some authors demonstrated that CSE-exposed human bronchial epithelial cells secrete CXCL8 and IL-1β via TLR4 [51]. Although presenting cytosol-initiated signaling, unlike membrane receptor TLR2 and TLR4, the TLR9 has been reported to be important for lung neutrophils infiltration in COPD [52]. Indeed, these authors show that TLR9 agonists induce neutrophil migration in mice with COPD, and that TLR9 knockout mice do not show neutrophil migration after exposure to cigarette smoke. Within the airways of smokers, the TLR9 is the crucial signaling for the pro-inflammatory mediators secretion that contribute to the accumulation of neutrophils [53, 54]. Based on our results, it seems possible that Lr has the ability to control lung inflammation by reducing TLRs receptor expression regardless of cell signaling and localization of each investigated TLR.Because epithelial cells are the interface between innate and adaptative immunity and a growing body of evidence supports a major role for non-immune pulmonary cells in COPD [55-57], we decided to study the response of epithelial cells to probiotic stimulation. The exposure of murine or human epithelial cells to cigarette extract (CSE) resulted in the secretion of several pro-inflammatory cytokines and chemokines and induced expression of mRNA to STAT3 and NFκB, mirroring the observed in the in vivo model. In contrast, probiotic stimulation made the epithelial cells refractory to the inflammatory provocation provided by CE.The proposal of action mechanism for Lr effect in which the bronchial epithelium is the important target was confirmed when the probiotic modulated the secretion of pro- and anti-inflammatory cytokines in human bronchial epithelial cells stimulated with CSE. Moreover, our results show that the anti-inflammatory effect of Lr on cytokines secretion from CSE-exposed human bronchial epithelial cells was due to the downregulation of both transcription factors, NF-κB and STAT3. The modulation of transcription factors SOCS3 and STAT3 by probiotic was also observed in human bronchial epithelial cells. This reinforces the idea that the in vivo action mechanism of Lr involves the signaling pathway NF-κB/STAT3/SOCS3 in human bronchial epithelium cells in order to attenuate both the lung inflammation and the exacerbation of immune response in lung microenvironment.Finally, several strains of Lactobacillus, as well as its structural components, and microbial-produced metabolites can stimulate epithelial cell signaling pathways which can prevent cytokine and oxidant-induced epithelial damage thereby promoting cell survival through increased production of cytoprotective molecules [57]. Our results demonstrated that Lr, by itself, increased secretion of both the IL-10 and the TGF-β secretion as well as SOCS3 levels in human bronchial epithelial cells unstimulated with CSE, which supports the idea that daily supplementation with probiotic may protect the lung milieu through of airway epithelial cells, since the IL-10 can suppress pro-inflammatory genes and the TGF-β can guarantee the integrity of airway epithelial barrier.In conclusion, the present manuscript describes by the first time that Lr modulates the secretion of pro- and anti-inflammatory molecules from human airway epithelial cells through of restoring the equilibrium between the transcription factors NF-kB/STAT-3 and SOCS3, and it seems to be an important action mechanism of probiotic in order to control lung inflammation as well as airway remodeling in COPD.9 Dec 2019PONE-D-19-30819Oral feeding with probiotic Lactobacillus rhamnosus attenuates cigarette smoke-induced COPD in C57Bl/6 mice: Relevance to inflammatory markers in human bronchial epithelial cellsPLOS ONEDear Dr. Aimbire,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.We would appreciate receiving your revised manuscript by Jan 23 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Hong Wei ChuAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements:Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found atPlease ensure that you refer to Figure 5 in your text as, if accepted, production will need this reference to link the reader to the figure.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: Partly**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The pathogenesis of COPD is one that still needs to be fully elucidated in order for better treatment for patients suffering from this disease. The manuscript takes an interesting approach to utilize probiotics in order to prevent onset of COPD in a mouse model as well as pro-inflammatory effects of CSE on epithelial cells. The authors, intriguingly, show a positive effect with the addition of Lactobacillus rhamnosus (Lr) in the lungs of a COPDmouse model and epithelial cells from mice and humans. This manuscript, however, needs major revisions in many aspects. First, the order of the figures is not easy for the reader to follow the line of reasoning. For example, it is the opinion of this reviewer, that figure 4 be moved to figure 2 to emphasize the mouse model is an appropriate model for COPD. Secondly, the mouse model is a 60-day long experiment, yet at the end, mRNA for cytokines and chemokines is measured over protein concentration. After such a chronic exposure, protein levels would be more impactful than mRNA. Third, the BALF data, although very interesting, does not seem to fit within this manuscript. Since Lr is being fed to the mice, the bacteria would therefore would have a greater impact on endothelial cells within the lung more than epithelial or BAL. There is also a possibility that Lr is influencing proteins within the liver and having an effect on the liver/lung axis more than within the lung tissue itself. Without data looking at liver proteins and/or endothelial cell responses in the lung, the BALF data seems to be out of place. Lastly, the authors make assumptions about the timeline of experiments and concentrations of stimuli. For example, it was never described why the concentration of Lr was determined for this paper. Has this been shown previously? The experimental design for the smoking studies also seems quite aggressive with 14 cigarettes smoked in ½ hour. Overall, this paper could be rewritten with stronger data to emphasize the importance of probiotics on COPD pathogenesis.Other comments:• It was unclear how BALF was prepared for ELISA cytokine/chemokine expression. Were the cells isolated and re-stimulated? Were they isolated, seeded on a plate, and left for 24 hours post isolation for cytokine expression?• The H&E staining in Figure 4 does not emphasize specific cell type within the lungs.• All pictures are missing scale bar.• Collage and elastin fibers are very hard to see in Figure 4. If proximity to the airway is not emphasized within the text, it would be helpful to have a picture closer of the collage and elastin.• Figure 6: Is there a positive and negative control for these stains? It seems as though entire cells are showing positive of NFkB especially within the epithelial cell layer. This could be a place where the authors can tie in the epithelial data easily by doing IF staining for NFkB and an epithelial marker, thereby further strengthening their decision to further investigate epithelial cells.• Figure 7: The relevance of selective TLR mRNA is not discussed. While it was mentioned that differences in TLR expression has been shown in COPD, this is still controversial based on the patient. The reason for investigating these 3 TLRs was also not mentioned and considering all three have different intracellular signaling, this was a confusing choice.• For the epithelial studies – the mouse data can be moved to supplemental has it follows the human data. It would also be helpful to either include Lr alone as a treatment within graphs or do not have it. It hard to follow why it was included in some graphs, but not others.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.21 Jan 2020PLOS ONEResponses to ReviewerPONE-D-19-30819“Oral feeding with probiotic Lactobacillus rhamnosus attenuates cigarette smoke-induced COPD in C57Bl/6 mice: Relevance to inflammatory markers in human bronchial epithelial cells”Review Comments to the AuthorReviewer #11. The pathogenesis of COPD is one that still needs to be fully elucidated in order for better treatment for patients suffering from this disease. The manuscript takes an interesting approach to utilize probiotics in order to prevent onset of COPD in a mouse model as well as pro-inflammatory effects of CSE on epithelial cells. The authors, intriguingly, show a positive effect with the addition of Lactobacillus rhamnosus (Lr) in the lungs of a COPDmouse model and epithelial cells from mice and humans.R: Dear Reviewer, although this is the first study that investigate the effect of Lr on inflammatory parameters that define the COPD, there are some authors that have shown the beneficial effects of Lr in the treatment of patients with allergic asthma, and these effects have been reproduced in murineasthma model. In addition, some authors have reported that Lr is able to influence immune and inflammatory cells, as well as, structural cells such as airway epithelial cells and lung fibroblast. For this reason, it is reasonable to suggest that Lr would also be able to attenuate lung inflammation in an in vivo COPD model induced by exposure to cigarette smoke. Finally, the results of the present manuscript are original and it does not seem intriguing, since a set of published data (see references) support our hypothesis. There is a mechanism of action described by Forsythe (2011) (it is in our references) for probiotics that suggest that the signaling of the anti-inflammatory effect of Lr is linked to cells of the pulmonary immune system. However, before of the present study, it was never described in in vivo COPD model.2. This manuscript, however, needs major revisions in many aspects. First, the order of the figures is not easy for the reader to follow the line of reasoning. For example, it is the opinion of this reviewer, that figure 4 be moved to figure 2 to emphasize the mouse model is an appropriate model for COPD.R: The authors understand the Reviewer's point of view, but we would like to keep the order of the results presented in this manuscript as it represents the sequence of events in the experimental COPD model. As it may be noted, the present study begins by assessing inflammatory parameters in vivo, and based on these results we investigated the cellular mechanisms involved in COPD. Lastly, the in vivo results led us to investigate the airway epithelial cells. Therefore, we kindly urge the Reviewer to maintain the sequence in the manuscript due to the explanation below:- initially the cells reach the lung (BALF cellularity with predominance of neutrophils)- these cells secrete cytokines (cytokines in BALF)- the cytokines in turn alter lung tissue (histology and morphometry)- the COPD-related proteases contribute to tissue damage (MMP-9 and MMP-12)- the transcription factors responsible for the synthesis of inflammatory mediators are present (NF-κB, STAT3)- the receptors expression of immune response are also involved in the lung (TLR2, 4 and 9)- the effect of Lr on in vivo COPD may be the result of its modulating effect on inflammatory mediators and transcription factors in bronchial epithelial cells.3. Secondly, the mouse model is a 60-day long experiment, yet at the end, mRNA for cytokines and chemokines is measured over protein concentration. After such a chronic exposure, protein levels would be more impactful than mRNA.R: Dear Reviewer, in the present study, cytokine and chemokine levels were not assessed by mRNA. Instead, all cytokines and chemokines were evaluated by ELISA kits that indicate protein concentration of these inflammatory mediators in BALF as well as in lung tissue.4. Third, the BALF data, although very interesting, does not seem to fit within this manuscript. Since Lr is being fed to the mice, the bacteria would therefore would have a greater impact on endothelial cells within the lung more than epithelial or BAL. There is also a possibility that Lr is influencing proteins within the liver and having an effect on the liver/lung axis more than within the lung tissue itself. Without data looking at liver proteins and/or endothelial cell responses in the lung, the BALF data seems to be out of place.R: Dear Reviewer, we find your remark very pertinent, however, this manuscript addresses the effect of Lr on lung inflammation observed in cigarette smoke exposure-induced COPD, so the characteristics of this type of lung inflammation are targets of Lr. One of the main features of lung inflammation is the large number of inflammatory cells that migrate to the lung. These cells can be detected in BALF, and are responsible for the early phase and progression of COPD because they secrete cytokines capable of attracting more and more inflammatory cells, perpetuating lung inflammation. This progression of inflammatory cell-induced inflammation in BALF culminates in irreversible changes in lung tissue, such as mucus deposition, increased collagen secretion, alveolar enlargment and destruction of elastic fibers. Thus, the evaluation of cellularity and cytokines secretion in BALF is an important marker in the treatment of COPD. Regarding to endothelial cells, it is important to highlights that the choice to analyze airway epithelial cells is not due to the effect of Lr, but due to the fact that airway epithelial cells orchestrate the initial response of the inflammatory process after contact with the toxic components present in cigarette smoke, since they secrete cytokines capable of acting as chemoattractants for neutrophils. Neutrophils secrete proteases that can destroy the lung parenchyma. The airway epithelial cells are the first line of defense against allergens and toxic components. In fact, the airway epithelial cells are the interface between innate and adaptive immunity in COPD. Thus, the Reviewer is right in suggesting the possibility that Lr may influence lung endothelial cells, however our focus was to evaluate the effect of Lr on airway epithelial cells due to its crucial importance for COPD. The Reviewer is also right to suggest that Lr may influence liver proteins, and that there may be a lung-liver axis. However, liver proteins alteration is not a marker of lung inflammation in COPD. In COPD, inflammatory mediators, such as cytokines and chemokines, secreted in the pulmonary environment are the most important inflammatory markers and predictors of disease severity and for this reason the lung is the target organ of our study. Moreover, the present manuscript shows results that are based on the description of the action mechanism of probiotics in lung inflammation published by Forsyhte, 2011 (see reference). In this study the author describes that the beneficial effect of probiotics, including Lr, is due to the initial recognition of non-pathogenic bacteria by antigen presenting cells in the gut-associated lymphoid tissue (GALT), from that moment on, these cells stimulate the lymphocytes that migrate to the lung and stimulate bronchial lymphoid tissue (BALT) to secrete anti-inflammatory mediators such as IL-10. Thus, although the liver-lung axis can be relevant because the liver participates in the metabolization of probiotics, the present study deals with the use of Lr in lung inflammation in COPD, and therefore, lung cells.5. Lastly, the authors make assumptions about the timeline of experiments and concentrations of stimuli. For example, it was never described why the concentration of Lr was determined for this paper. Has this been shown previously? The experimental design for the smoking studies also seems quite aggressive with 14 cigarettes smoked in ½ hour. Overall, this paper could be rewritten with stronger data to emphasize the importance of probiotics on COPD pathogenesis.R: Dear Reviewer, we have recently published a manuscript in “Cellular Immunology” journal entitled “Oral feeding of Lactobacillus bulgaricus N45.10 inhibits the lung inflammation and airway remodeling in murineallergic asthma: Relevance to the Th1/Th2 cytokines and STAT6/T-bet. Anatriello E, Cunha M, Nogueira J, Carvalho JL, Sá AK, Miranda M, Castro-Faria-Neto H, Keller AC, Aimbire F. Cell Immunol. 2019 341:103928. doi: 10.1016/j.cellimm.2019.103928. Based on that study, we decided to use the same concentration of Lr in the present manuscript. Concerning the in vivo COPD model, our study is adapted from the article published in Plos One in which mice were exposed to cigarette smoke for 75 days. “Human Tubal-Derived Mesenchymal Stromal Cells Associated with Low Level Laser Therapy Significantly Reduces Cigarette Smoke-Induced COPD in C57BL/6 mice”. Peron JP, de Brito AA, Pelatti M, Brandão WN, Vitoretti LB, Greiffo FR, da Silveira EC, Oliveira-Junior MC, Maluf M, Evangelista L, Halpern S, Nisenbaum MG, Perin P, Czeresnia CE, Câmara NO, Aimbire F, de Paula Vieira R, Zatz M, de Oliveira AP. PLoS One. 2015 25;10(9):e0139294. doi: 10.1371/journal.pone.0139294. Moreover, the animal induction protocol was approved by the Ethics Committee on Animal Study, as described in the “Material and Methods” section. Although the reviewer suggested that stronger results should be included to evidence the effect of Lr, we would like to point out that the effect of Lr was evaluated on the inflammatory parameters that characterize the COPD, from BALF cellularity to changes in lung architeture. In addition, our results show that human bronchial epithelial cells are targeted by Lr for controlling the lung inflammatory response in COPD. These results have clinical importance, and in this sense, this study makes a translational bridge the beneficial effect of Lr in murine bronchial epithelium to the human lineage BEAS. In addition, the present manuscript describes a mechanism of action for the anti-inflammatory and immunomodulatory effect of probiotic Lr.Other Comments:1 • It was unclear how BALF was prepared for ELISA cytokine/chemokine expression. Were the cells isolated and re-stimulated? Were they isolated, seeded on a plate, and left for 24 hours post isolation for cytokine expression?R: BALF - The bronchoalveolar lavage fluid (BALF) was obtained from three lung washes with phosphate buffered saline (PBS) (3 x 0.5 mL PBS). BALF was collected and centrifuged at 3000 rpm for 15 minutes at 4ºC and the supernatant collected and resuspended in 1ml PBS. The material was then stored in a freezer at -80ºC for analysis of cytokines through ELISA kit (DuoSet® Kit, R&D Systems) following the manufacturers' recommendations. BALF was prepared for ELISA as follow: “Briefly, 200 µL of BALF were used in a quantitative sandwich enzyme immunoassay technique. For this, a mouse specific cytokine and chemokine monoclonal antibody was pre-coated on a microplate. Standards, control and colors are pipetted into wells and the concentration of cytokine present is activated by the immobilized antibody. After washing off non-activated chemicals, a polyclonal antibody binds to a specific enzyme to each cytokine and is then added to the wells. After washing to remove any unbound antibody-enzyme reagent, a substrate solution is added to the wells. An enzymatic reaction produces a blue product that turns yellow when a stop solution is added. The intensity of the measurement is proportional to the amount of each cytokine evaluated in specific lysate kits in the initial step. The sample values are then read on the standard curve”. It is noteworthy that the description of how biological fluid samples (cellular supernatant, serum, sputum, BALF) or tissue homogenates are prepared for the ELISA can be found in the kit description in detail. Therefore, it is not common to describe the entire sample preparation steps in the "Material and Methods".Cells - The cells were isolated, plated and restimulated with 2.5% cigarette smoke extract (CSE) incorporated into the culture medium. Then, 24 hours after CSE addition, the culture supernatants were removed, and stored at -40°C until use for cytokine analysis through Elisa kits. It was inserted in subsection 2.4 in the “Material and Methods” section.2 • The H&E staining in Figure 4 does not emphasize specific cell type within the lungs.R: Dear Reviewer, the H&E staining pattern only illustrates the presence of inflammatory infiltrate in the peribronchial region. However, the technique of tissue morphometry allows to evaluate the specific type of inflammatory cell. For this reason, in the present study it was possible to evaluate the number of neutrophils in the peribronchial region.3 • All pictures are missing scale bar.R: Dear Reviewer, the scale bars were inserted in the pictures as required.4 • Collagen and elastin fibers are very hard to see in Figure 4. If proximity to the airway is not emphasized within the text, it would be helpful to have a picture closer of the collage and elastin.R: Dear Reviewer, the figure related to collagen received “red arrows”, indicating the collagen clearly marked in blue. Thus, Figure 4C shows a bluish coloring in the COPD group and a reduction in blue color in the mice of the COPD group treated with Lr. In addition, we added “red arrows” in peribronchial inflammatory infiltrate, alveolar enlargment, and collagen deposition. The elastic fibers of the lung tissue were marked in a brownish tone. Therefore it is possible to visualize the whole Figure 4D with brownish color illustrating the elastic fibers.5 • Figure 6: Is there a positive and negative control for these stains? It seems as though entire cells are showing positive of NFkB especially within the epithelial cell layer. This could be a place where the authors can tie in the epithelial data easily by doing IF staining for NFkB and an epithelial marker, thereby further strengthening their decision to further investigate epithelial cells.R: Dear Reviewer, the positive and negative controls for stains (NF-κB and STAT3) were inserted in Figure 6. We agree with the Reviewer's suggestion about to localize via IF the NF-kB and STAT3 in bronchial epithelial cells, however we would like to point out that the choice to study bronchial epithelial cells is not related to the in vivo experiment where in fact the most intense staining seems to be located in the bronchial epithelial region. The choice to evaluate bronchial epithelial cells is due to their importance in the development and progression of COPD. Thus, even if there no participation of transcription factors NF-κB and STAT3 in lung tissue of COPDmice, both murine bronchial epithelial cells and BEAS cells would be investigated.6 • Figure 7: The relevance of selective TLR mRNA is not discussed. While it was mentioned that differences in TLR expression has been shown in COPD, this is still controversial based on the patient. The reason for investigating these 3 TLRs was also not mentioned and considering all three have different intracellular signaling, this was a confusing choice.R: Dear Reviewer, it was inserted in the “Discussion” section. We would like to reaffirm that our goal was to investigate whether Lr could influence the lung expression of TLR2, 4, and 9 receptors reported by some authors as the most important innate immunity receptors in the pathogenesis of COPD. Thus, the localization and different cellular signaling of each TLR is not necessarily relevant, in principle, to understand whether Lr can attenuate the expression of these receptors in the lung. Thus, the choice to investigate TLR 2, 4, and 9 as targets of Lr in in vivo COPD was relevant.7 • For the epithelial studies – the mouse data can be moved to supplemental has it follows the human data. It would also be helpful to either include Lr alone as a treatment within graphs or do not have it. It hard to follow why it was included in some graphs, but not others.R: The authors would like to appeal to the Reviewer to understand that data on the effect of Lr on in vivo COPD is partly a reflex of the Lr effect on bronchial epithelial cells. Thus, the relevance of the present study is that these cells tha are crucial for the development and chronicity of COPD are targets of Lr. That way, if this data is moved to the supplemental data, the article relevance is lost and even title will also have to be changed. Thus, we would like to request that the results of Lr effect on murine and BEAS be grouped together with the main results. For the Lr group, results with Lr alone were not included in some experiments because there was no difference between the control group and the Lr group. Otherwise, when we evaluated the effect of Lr on anti-inflammatory mediators such as IL-10, TGF-beta and SOCS3, we noticed that there was a significant increase in the levels of these mediators in the Lr group that was not exposed to smoke. This effect was observed in BALF, murine bronchial epithelial cells and in BEAS cells. For this reason, the Lr group has been inserted only in these figures. The authors would also like to emphasize how interesting these results are because they show that Lr can create an anti-inflammatory environment even in mice and BEAS cells that have not been exposed to smoke.Submitted filename: Response to Reviewer.docClick here for additional data file.18 Feb 2020PONE-D-19-30819R1Oral feeding with probiotic Lactobacillus rhamnosus attenuates cigarette smoke-induced COPD in C57Bl/6 mice: Relevance to inflammatory markers in human bronchial epithelial cellsPLOS ONEDear Dr. Aimbire,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.In Figure 4, neutrophil count data based on H&E staining is not convincing. There was no indication of neutrophils in the provided histology pictures. Immunostaining of neutrophils could be considered.We would appreciate receiving your revised manuscript by 3/17/2020. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Hong Wei ChuAcademic EditorPLOS ONE[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.17 Mar 2020PLOS ONEResponses to ReviewerPONE-D-19-30819R1“Oral feeding with probiotic Lactobacillus rhamnosus attenuates cigarette smoke-induced COPD in C57Bl/6 mice: Relevance to inflammatory markers in human bronchial epithelial cells”Review Comments to the AuthorReviewer #11. In Figure 4, neutrophil count data based on H&E staining is not convincing. There was no indication of neutrophils in the provided histology pictures. Immunostaining of neutrophils could be considered.R: Dear Reviewer, we also take the opportunity to notify You that we made a mistake in Figure 4A. The correct caption of the graph is “polymorphonuclear/mm2 of lung tissue”. In this way, we also corrected the text exchanging “neutrophils” in the lung parenchyma for "polymorphonuclear cells". It is worth noting that this change does not compromise the characteristics of the in vivo COPD model, nor the interpretation nor the conclusions of results found in the present manuscript. Finally, the Reviewer is correct when affirm that to define the number of neutrophils in the lung tissue more accurately, a specific marker is needed. However, we would like to respectfully attach some manuscripts published in selective editorial policy journals where the authors evaluate the number of neutrophils in peribronchial region using the H&E staining pattern only. The manuscripts were inserted below:- Lanças T, Kasahara DI, Prado CM, Tibério IF, Martins MA, Dolhnikoff M. Comparison of early and late responses to antigen of sensitized guinea pig parenchymal lung strips. J Appl Physiol (1985). 2006 100(5):1610-6.- Rigonato-Oliveira NC, Mackenzie B, Bachi ALL, Oliveira-Junior MC, Santos-Dias A, Brandao-Rangel MAR, Delle H, Costa-Guimaraes T, Damaceno-Rodrigues NR, Dulley NR, Benetti MA, Malfitano C, de Angelis C, Albertini R, Oliveira APL, Abbasi A, Northoff H, Vieira RP. Aerobic exercise inhibits acute lung injury: from mouse to human evidence Exercise reduced lung injury markers in mouse and in cells. Exerc Immunol Rev. 2018; 24:36-44.- Davino-Chiovatto JE, Oliveira-Junior MC, MacKenzie B, Santos-Dias A, Almeida-Oliveira AR, Aquino-Junior JCJ, Brito AA, Rigonato-Oliveira NC, Damaceno-Rodrigues NR, Oliveira APL, Silva AP, Consolim-Colombo FM, Aimbire F, Castro-Faria-Neto HC, Vieira RP. Montelukast, Leukotriene Inhibitor, Reduces LPS-Induced Acute Lung Inflammation and Human Neutrophil Activation. Arch Bronconeumol. 2019 55(11): 573-580.Submitted filename: Response to Reviewer 2.docClick here for additional data file.6 Apr 2020Oral feeding with probiotic Lactobacillus rhamnosus attenuates cigarette smoke-induced COPD in C57Bl/6 mice: Relevance to inflammatory markers in human bronchial epithelial cellsPONE-D-19-30819R2Dear Dr. Aimbire,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Hong Wei ChuAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:13 Apr 2020PONE-D-19-30819R2Oral feeding with probiotic Lactobacillus rhamnosus attenuates cigarette smoke-induced COPD in C57Bl/6 mice: Relevance to inflammatory markers in human bronchial epithelial cellsDear Dr. Aimbire:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Hong Wei ChuAcademic EditorPLOS ONE
Authors: Claudia Costa; Rogerio Rufino; Suzanne L Traves; Jose Roberto Lapa E Silva; Peter J Barnes; Louise E Donnelly Journal: Chest Date: 2007-10-09 Impact factor: 9.410
Authors: MeiLan K Han; Alvar Agusti; Peter M Calverley; Bartolome R Celli; Gerard Criner; Jeffrey L Curtis; Leonardo M Fabbri; Jonathan G Goldin; Paul W Jones; William Macnee; Barry J Make; Klaus F Rabe; Stephen I Rennard; Frank C Sciurba; Edwin K Silverman; Jørgen Vestbo; George R Washko; Emiel F M Wouters; Fernando J Martinez Journal: Am J Respir Crit Care Med Date: 2010-06-03 Impact factor: 21.405
Authors: A R Almeida-Oliveira; Jcj Aquino-Junior; A Abbasi; A Santos-Dias; M C Oliveira-Junior; R W Alberca-Custodio; N C Rigonato-Oliveira; L P Salles-Dias; N R Damaceno-Rodrigues; E G Caldini; F M Arantes-Costa; A P Ligeiro-Oliveira; M G Belvisi; R P Vieira Journal: Exerc Immunol Rev Date: 2019 Impact factor: 6.308
Authors: Simon R Lea; Sophie L Reynolds; Manminder Kaur; Karen D Simpson; Simon R Hall; Edith M Hessel; Dave Singh Journal: Int J Chron Obstruct Pulmon Dis Date: 2018-03-02
Authors: Jin-Ju Jeong; Hee Jin Park; Min Gi Cha; Eunju Park; Sung-Min Won; Raja Ganesan; Haripriya Gupta; Yoseph Asmelash Gebru; Satya Priya Sharma; Su Been Lee; Goo Hyun Kwon; Min Kyo Jeong; Byeong Hyun Min; Ji Ye Hyun; Jung A Eom; Sang Jun Yoon; Mi Ran Choi; Dong Joon Kim; Ki Tae Suk Journal: Microorganisms Date: 2022-01-26
Authors: Aurileia Aparecida de Brito; Tawany Gonçalves Santos; Karine Zanella Herculano; Cintia Estefano-Alves; Cristiano Rodrigo de Alvarenga Nascimento; Nicole Cristine Rigonato-Oliveira; Maria Cristina Chavantes; Flávio Aimbire; Renata Kelly da Palma; Ana Paula Ligeiro de Oliveira Journal: Front Immunol Date: 2022-02-02 Impact factor: 7.561
Authors: Fabiana Olimpio; José Roberto Mateus da Silva; Rodolfo P Vieira; Carlos R Oliveira; Flavio Aimbire Journal: Clinics (Sao Paulo) Date: 2022-03-15 Impact factor: 2.365