Ania Tomaszewicz Brown1, Denise McAloose1, Paul P Calle1, Angelika Auer2, Annika Posautz3, Sally Slavinski4, Robin Brennan5, Chris Walzer3,6, Tracie A Seimon1. 1. Wildlife Conservation Society, Zoological Health Program, Bronx, New York, United States of America. 2. Institute of Virology, University of Veterinary Medicine, Vienna, Austria. 3. Research Institute of Wildlife Ecology (FIWI), University of Veterinary Medicine, Vienna, Austria. 4. New York City Department of Health and Mental Hygiene, Queens, New York, United States of America. 5. Animal Care Centers of New York, New York, New York, United States of America. 6. Wildlife Conservation Society, Bronx, New York, United States of America.
Abstract
Canine distemper virus (CDV) is a multi-host pathogen that can cause significant mortality in domestic, wild terrestrial and marine mammals. It is a major conservation threat in some endangered species. Infection can result in severe respiratory disease and fatal encephalitis. Diagnosis and disease monitoring in wildlife, and differentiation of CDV from rabies (a life-threatening zoonotic disease that can produce similar neurologic signs), would benefit from the availability of a portable, point-of-care (POC) diagnostic test. We therefore developed a quantitative RT-PCR assay for CDV using shelf-stable, lyophilized reagents and target-specific primers and probes for use with the handheld Biomeme two3™ qPCR thermocycler. Biomeme's extraction methodology, lyophilized reagents, and thermocycler were compared to our standard laboratory-based methods to assess sensitivity, efficiency and overall test performance. Results using a positive control plasmid for CDV showed comparable sensitivity (detection of 50 copies) and PCR efficiency between the two platforms, and CDV detection was similar between platforms when tested using a modified live CDV vaccine. Significantly higher Ct values (average Ct = 5.1 cycles) were observed using the Biomeme platform on known CDV positive animal samples. CDV detection using the Biomeme platform was similar in 25 of 26 samples from suspect CDV cases when compared to standard virology laboratory testing. One false positive was observed that was negative upon retest. The Biomeme methodology can be adapted for detection of specific targets, and this portable technology saves time by eliminating the need for local or international sample transport for laboratory-based diagnostics. However, results of our testing suggest that decreased diagnostic sensitivity (higher Ct values) relative to laboratory-based methods was observed using animal samples, so careful validation and optimization are essential. Portable qPCR platforms can empower biologists and wildlife health professionals in remote and low-resource settings, which will greatly improve our understanding of CDV disease ecology and associated conservation threats in wildlife.
Canine distemper virus (CDV) is a multi-host pathogen that can cause significant mortality in domestic, wild terrestrial and marine mammals. It is a major conservation threat in some endangered species. Infection can result in severe respiratory disease and fatal encephalitis. Diagnosis and disease monitoring in wildlife, and differentiation of CDV from rabies (a life-threatening zoonotic disease that can produce similar neurologic signs), would benefit from the availability of a portable, point-of-care (POC) diagnostic test. We therefore developed a quantitative RT-PCR assay for CDV using shelf-stable, lyophilized reagents and target-specific primers and probes for use with the handheld Biomeme two3™ qPCR thermocycler. Biomeme's extraction methodology, lyophilized reagents, and thermocycler were compared to our standard laboratory-based methods to assess sensitivity, efficiency and overall test performance. Results using a positive control plasmid for CDV showed comparable sensitivity (detection of 50 copies) and PCR efficiency between the two platforms, and CDV detection was similar between platforms when tested using a modified live CDV vaccine. Significantly higher Ct values (average Ct = 5.1 cycles) were observed using the Biomeme platform on known CDV positive animal samples. CDV detection using the Biomeme platform was similar in 25 of 26 samples from suspect CDV cases when compared to standard virology laboratory testing. One false positive was observed that was negative upon retest. The Biomeme methodology can be adapted for detection of specific targets, and this portable technology saves time by eliminating the need for local or international sample transport for laboratory-based diagnostics. However, results of our testing suggest that decreased diagnostic sensitivity (higher Ct values) relative to laboratory-based methods was observed using animal samples, so careful validation and optimization are essential. Portable qPCR platforms can empower biologists and wildlife health professionals in remote and low-resource settings, which will greatly improve our understanding of CDV disease ecology and associated conservation threats in wildlife.
Canine distemper virus (CDV), a Morbillivirus in the Paramyxoviridae family, is a multi-host pathogen that is found globally and has a wide host-range. All members of the order Carnivora are thought to be susceptible, and CDV exposure has also been described in several species of rodents, primates, suids, cervids, and elephants [1]. Significant mortality events have been described in terrestrial and marine mammals [2], and disease and outbreaks in endangered African wild dogs (Lycaon pictus) [3], Ethiopian wolves (Canis simensis) [4], Amur tigers (Panthera tigris altaica) [5-7], Amur leopards (Panthera pardus orientalis) [8], Iberian lynx (Lynx pardinus) [9], and black-footed ferrets (Mustela nigripes) [10] are considered potentially significant conservation threats to these species. Domestic dogs and mesocarnivores are known reservoir hosts [2,6,7]. The virus is epitheliotropic, lymphotropic and neurotropic, and clinical signs are often seen in the respiratory, lymphoid, gastrointestinal and nervous systems [11]. Common outcomes of infection include lymphoid depletion, hyperkeratosis, interstitial pneumonia (often complicated by opportunistic bacterial infections), and fatal encephalopathy.Portable, point-of-care (POC) technologies allow scientists, biologists, medical professionals and the public to take advanced diagnostics to the field [12]. Though not a new concept, few POC tools exist for domestic companion animal or livestock diagnostics. Fewer have been developed and validated for use in wildlife and field settings [13]. However, recent outbreaks of Ebola in great apes and humans, SARS in civets, peste-des-petits ruminants in saiga, Africanswinefever, MERS in camels and humans, and many other diseases of animal and public health importance have highlighted a need for development of new or enhancement of existing portable POC tools [12,14-20].POC diagnostics can help address many challenges in understanding CDV presence, transmission patterns, identification of disease outbreaks, and conservation threats in wildlife. Some of these challenges include access to animals and opportunistic testing across small and large geographic ranges, low density or elusive behavior of some target species, and absence of or limited monitoring efforts. Others challenges researchers face include limited expertise necessary for appropriate animal sample collection, handling, and storage (including maintaining a cold chain), absence of available laboratory testing and differentiating from disease such as rabies which can present with similar clinical manifestations, and/or logistical challenges related to permit processes needed for regional or international sample shipping for laboratory testing. These challenges are compounded in remote and/or low resource settings. POC diagnostics are increasingly providing opportunities for rapid testing by researchers while they are already collecting data in the field, or when handling sick or dead wildlife, and with the development and validation of more user-friendly kits, researchers have opportunities to overcome many of these obstacles and logistical challenges that would normally impede testing.Current methods for CDV detection include histology, electron microscopy, immunohistochemistry (IHC), enzyme-linked immunosorbent assay (ELISA), virus isolation, and conventional and quantitative reverse-transcription PCR (RT-qPCR). All of these methods are generally performed in standard diagnostic laboratories using stationary bench-top analyzers run by trained professionals. While working in the field, limited access to this infrastructure or access to portable diagnostics can negatively impact the accessibility of timely results, case identification, and development of strategies to mitigate disease transmission and spread.The goal of this study was to develop and validate a rapid, portable, field-friendly, CDV-specific, POC RT-qPCR test for wildlife or domestic animal diagnostics. To do so, we compared the sensitivity and efficiency of each component of the Biomeme POC platform (biomeme.com) to our standard, laboratory-based RT-qPCR platform. We subsequently compared the performance of these two platforms using samples from free ranging wildlife in the United States and Austria that were collected during recent natural CDV outbreaks in wild carnivores.The Biomeme platform includes the M1 Sample Prep Kit™ for RNA extraction, LyoRNA™ RT-PCR mastermix with custom primers and a TaqMan probe, and their two3™ thermocycler [13]. The Biomeme M1 Sample Prep Kit™ for RNA extraction is pre-packaged and uses a syringe-mounted extraction column (Fig 1, top). Through the use of four color-coded reagents, the extraction process easily overcomes training and language barriers. The Biomeme LyoRNA™ mastermix is lyophilized and shelf-stable. It can be combined with lyophilized primers and probes into a bead that is pre-packaged into Biomeme qPCR reaction tube ‘Go-Strips’™. Reagents, primers and probes can be manufactured to meet specific needs. Reconstitution of the beads with DNA or RNA template prepares the sample for PCR. The Biomeme two3™ qPCR machine (Biomeme Inc. Philadelphia, PA, USA) is a small, light-weight, portable thermocycler that can be hand-held and displays output through a smart phone or laptop-based application [13]. All of the above steps are performed without the need for heat blocks, centrifuges, or cold storage, and the thermocycler can be run on battery or solar power.
Fig 1
Biomeme POC platform components, and flow-chart of experiments conducted.
Top. Photographic depiction of the step-wise protocol of Biomeme platform including Lysis step, RNA extraction step using the M1 Sample Prep Kit™, PCR reaction using the Biomeme Go-Strips, and qPCR step using the Biomeme two3™ thermocycler. Bottom. Flow chart of experiments conducted to validate the Biomeme platform and compare it to standard benchtop platform, with reference to corresponding figures where each step was conducted.
Biomeme POC platform components, and flow-chart of experiments conducted.
Top. Photographic depiction of the step-wise protocol of Biomeme platform including Lysis step, RNA extraction step using the M1 Sample Prep Kit™, PCR reaction using the Biomeme Go-Strips, and qPCR step using the Biomeme two3™ thermocycler. Bottom. Flow chart of experiments conducted to validate the Biomeme platform and compare it to standard benchtop platform, with reference to corresponding figures where each step was conducted.
Materials and methods
Ethics statement
All samples were collected opportunistically from animals that were found dead or humanely euthanized because of severe illness during naturally occurring wildlife disease outbreaks. Following AVMA Euthanasia Guidelines Raccoons were sedated with intramuscular ketamine prior to the IV or IP injection of sodium pentobarbital. Standard techniques for animal handling, euthanasia, and sampling were performed by licensed veterinarians and technicians in accordance with local, regional, national and international guidelines/best practices and laws. IACUC review and approval for the wildlife handling and sample collection performed in this project are not required in New York State, USA, or in the European Union. No live protected species were handled or sampled for this project.
RNA extraction
RNA extraction using the Biomeme RNA field prep kit
RNA extraction from reconstituted Duramune™ MAX 5 Canine Distemper-Adenovirus Type 2-Parainfluenza-Parvovirus (DA2PP) modified live virus vaccine (Elanco US Inc., Fort Dodge, IA), hair, swabs of tissue (fresh frozen or RNAlater™ preserved), and fresh frozen tissue from suspected CDV positive animals was carried out at both at the Zoological Health Program’s Molecular Laboratory at the Bronx Zoo, New York, NY, USA and University of Veterinary Medicine, Vienna, Austria. These samples were extracted using the Biomeme RNA M1 Sample Prep Kit™. Samples (100 μL of a 1:10 vaccine dilution series, swab, hair or tissue) were placed in 1 mL of BLB (Biomeme lysis buffer) with 5 μL of carrier RNA (Qiagen Inc., CA, USA). Some samples were extracted with 1mL BLB plus 500 μL of molecular grade ethanol to try and enhance RNA viral recovery, however we did not find the addition of ethanol had any effect or improved viral recovery so was eliminated from this protocol early in the study. The samples were vigorously shaken by hand for one minute and incubated at room temperature for 10 minutes. The entirety of the lysate was then drawn up into the Biomeme syringe through the extraction column and gently pumped up and down through the column 10 times, expelling, then discarding the liquid on the final pump. Next, 400 μL of BWB (Biomeme wash buffer) was drawn up into the column and expelled (1 pump). Then 800 uL of BPW (Biomeme protein wash) was drawn up in the column and expelled (1 pump). To eliminate excess fluid in the column, air was drawn up into the syringe and was then completely expelled by pumping residual fluid into a small waste container repeatedly approximately 10 times to dry the column. RNA was eluted from the column by drawing up 250 μL of BEB (Biomeme elution buffer) then pumping it up and down through the column three times. The eluate was expelled into an RNase/DNase-free tube.
RNA extraction using the Qiagen RNA kits
RNA extractions from reconstituted DA2PP vaccine, hair samples, and swabs of fresh frozen or RNAlater™ preserved tissue from CDV positive animals was performed using the QIAamp® Viral RNA Mini Kit (Qiagen Inc., CA, USA). Fresh frozen tissue was extracted using the AllPrep DNA/RNA Mini Kit (Qiagen Inc., CA, USA). Qiagen extraction procedures followed the manufacturer’s protocol and the final extract was eluted with 60 μL DNAse and RNAse-free water for all samples.
RNA extractions at the Institute of Virology, Vienna
For samples tested at the Institute of Virology, University of Veterinary Medicine in Vienna, Austria, standard laboratory methods were used. RNA was extracted from reconstituted fresh frozen preserved tissue. Briefly, an organ suspension of 100 mg of organ tissue into 1 mL of PBS was made. The suspension was then lysed using 3–4 steel beads in a TissueLyser II (Qiagen Inc., Hilden, Germany). The sample was then centrifuged for one minute at 13,000 rpm, and the clarified lysate was extracted using QIAamp® Viral RNA Mini Kit in conjunction with a QIAcube (Qiagen Inc., Hilden, Germany) following the manufacturer’s instructions.
Quantitative real-time PCR
All samples were tested in singlicate except in experiments where we could accommodate duplicate or triplicate replicates on the plate where indicated.
PCR conditions using Biomeme LyoRNA™ RT-PCR mastermix reagents
Samples were tested using quantitative, reverse transcriptase PCR (RT-qPCR) to amplify a 114 bp region of the phosphoprotein (P) gene of canine distemper virus as previously described [21]. Each 25 μL PCR reaction contained the following primers and probe: CDVF4, GTCGGTAATCGAGGATTCGAGAG and CDVR3, GCCGAAAGAATATCCCCAGTTAG, (0.4 μM working concentration), CDV MGB Taqman probe 6FAM-ATCTTCGCCAGAATCCTCAGTGCT-MGBNFQ (0.2 μM working concentration) (Thermo Fisher Scientific, MA, USA). In addition to the primers and probe, each 25 μL reaction contained 2 μL of RNA template, 17.5 μL of DNase/RNase-free water and 5 μL of reconstituted lyophilized Biomeme LyoRNA™ RT-PCR mastermix (5X concentration). Samples using Biomeme LyoRNA™ mastermix were tested using either the Biomeme two3™ or the Bio-Rad MiniOpticon™ thermocycler under the following cycling conditions: 50 °C for 2 minutes, 95 °C for 1 minute, followed by 45 cycles of 95 °C for 15 seconds, 60 °C for 30 sections (data collection step).
PCR using QuantiFast Pathogen RT-PCR mastermix and the Bio-Rad MiniOpticon™ thermocycler
Samples were tested with the QuantiFast Pathogen RT-PCR Kit and reagents (Qiagen Inc., CA, USA) using RT-qPCR to amplify a 114bp region of the CDV phosphoprotein (P) gene as described above. In addition to the primers and probe concentrations listed above, each 25 μL PCR reaction contained the following: 2 μL of RNA template, 12.5 μL of DNase/RNase-free water, 5 μL of 5x master mix, 0.25 μL of 100X reverse transcriptase, 2.5 μL of 10X IC RNA and 2.5 μL of IC (inhibition control) mix. Samples were tested on the Bio-Rad MiniOpticon™ with the following cycling conditions: 50 °C for 20 minutes, 95 °C for 5 minutes, followed by 45 cycles of 95 °C for 15 seconds, 60 °C for 30 seconds (data collection step), and then held at 12 °C. A no-template negative control and plasmids containing the primer binding sites for the CDV P gene were included as negative and positive controls, respectively.
PCR conditions using Biomeme CDV Go-Strips™
Samples from suspect CDV cases were tested using the Biomeme platform at the Research Institute of Wildlife Ecology, University of Veterinary Medicine, Vienna. 3-well Biomeme CDV Go-Strips™ with lyophilized beads containing Biomeme LyoRNA™ RT-PCR mastermix were manufactured with the concentrations of target specific primers and probe as above. When using the Biomeme CDV Go-Strips™, the final RNA elution was diluted 1:4 in RNAase-free water, and 20 μL of diluted template was added to the bead for a final total 20 μL PCR reaction volume. Samples using Biomeme CDV Go-Strips™ were tested using the Biomeme two3™ machine under the following cycling conditions: 50 °C for 2 minutes, 95 °C for 1 minute, followed by 45 cycles of 95 °C for 15 seconds, 60 °C for 30 sections (data collection step). Samples were tested with both positive and negative controls. A no-template negative control and plasmids containing the primer binding sites for the CDV P gene were included in each RT-PCR experiment.
PCR using qScript™ XLT One-Step RT-qPCR ToughMix®, ROX™ and Rotor-Gene Q thermocycler
Samples tested at the diagnostic laboratory of the Institute of Virology, University of Veterinary Medicine, Vienna were tested using 20 μL reactions that contained 2.5 μL of RNA template, 4 μL of DNase/RNase-free water, 10 μL of 2X qScript™ XLT One-Step RTqPCR ToughMix®, ROX™ (Quanta Biosciences™), 2 μL of 50 mM MgSO4, with 0.5 μL of the following primers targeting an 87bp product of the CDV nucleocapsid (N) gene from a 40.0 μM stock concentration; CDV-F: 5-AGCTAGTTTCATCTTAACTATCAAATT -3; CDV-R: 5‘-TTAACTCTCCAGAAAACTCATGC-3; and 0.5 μL of the following probe from a 20.0 μM concentration; CDV-PROBE: FAM-5-ACCCAAGAGCCGGATACATAGTTTCAATGC-3-TAMRA. PCR cycling conditions were 50°C for 15 minutes, then 95°C for 2 minutes, followed by 45 cycles of 95°C for 15 seconds, 60°C for 30 seconds (data collection step). RT-qPCR was performed on a Rotor-Gene Q thermocycler (Qiagen Inc., Hilden, Germany) [22].
Sensitivity, efficiency and copy number calculations
To assess CDV test sensitivity and efficiency for samples tested in NY, a 1:10 dilution series of a synthesized plasmid control containing the primer and probe binding sites and known copy number was used to generate a standard curve from 50 copies to 50,000 copies. The standard curve generated from the CDV positive control plasmid was also used to calculate the total CDV copy number in the RNA extracts from the vaccine control and clinical samples using the following equation solving for x (copy number): x = e((ABS(y-b)/(m)). Since we used 2 μL of template in each PCR reaction, we then divided the calculated copy number (x value) by 2 (copy number represented in 1 μL), and that number was then multiplied by the total RNA extract volume (amount of the final elution volume of each RNA extraction kit). Data was normalized in this manner to account for different elution volumes for each RNA extraction kit. This allowed normalization and comparison of total CDV viral copy recovery in the total RNA extract across platforms. The calculated copy numbers/sample from replicates were then averaged and graphed with standard deviations. PCR efficiency was calculated using the equation: e = (10(-1/slope)-1)*100). Two-tailed T-tests were used to determine significant differences between the Biomeme POC and standard laboratory platform performance.
Animal samples
RNAlater™ preserved wild animal samples
Animal samples preserved in RNAlater™ collected from animals that died naturally during two CDV disease outbreaks in wild mesocarnivores in Austria (2011–2013, 2018) were imported from the Research Institute of Wildlife Ecology, University of Veterinary Medicine, Vienna, Austria to the Bronx Zoo, New York, USA in 2018. This included a total of 26 samples from 3 animals, a pine martin (Martes martes), red fox (Vulpes vulpes) and a European badger (Meles meles). Sample types included heart, liver, kidney, spleen, lung, lymph node, brain, and muscle. Small intestine was available from two animals (pine marten and European badger). After thawing, the surface of the RNAlater™ preserved tissues was swabbed in duplicate using a fine-tipped sterile swab (MW&E, NC, USA) prior to RNA extraction using the Biomeme or standard laboratory methods (Wildlife Conservation Society, Bronx Zoo, NY).
Fresh frozen animal samples: Wild raccoons, New York, USA
Tissues, nasal swabs and/or hair samples were collected from raccoon (Procyon lotor) carcasses that originated from Central Park, New York City (NYC), USA. The raccoons were either found dead or were euthanized due to clinical signs consistent with CDV during a known, laboratory confirmed CDV outbreak in 2018, affecting approximately 175 raccoons. The animals were collected and transported by staff with NYC Parks and Recreation to the city’s municipal animal shelter, Animal Care Centers of New York and in all but four cases, described below, no additional pathological examination was performed. Samples collected varied by animal and included plucked hair with hair root; swabs from foot pad, cerebellum, cerebrum, and lung; and fresh-frozen tissues from foot pad, cerebellum, cerebrum, and lung. Complete necropsy examination and a full set of tissues in 10% neutral buffered formalin was collected from four raccoons that died or were euthanized during the outbreak, and histopathology examination confirmed CDV disease in these animals. Nasal swabs were collected from 3 of the 4 animals. Additionally, hair with root were collected from an additional 48 CDV-suspect animals that were trapped and euthanized during the outbreak. Nasal swabs, fresh tissues and hair samples were archived frozen (-80°C) prior to PCR testing (Wildlife Conservation Society, Bronx Zoo, NY, USA). After thawing, fresh frozen tissue was swabbed using a fine-tipped sterile swab (MW&E, NC, USA) prior to RNA extraction.
Fresh frozen animal samples: Austrian wildlife, Vienna, Austria
Animal samples were obtained from two naturally occurring CDV outbreaks in wild mesocarnivores in Austria (2011–2013, and 2018). Samples were collected from 10 animals that died naturally and included: pine martin (Martes martes; n = 1), beech martin (Martes foina, n = 1), Eurasian otter (Lutra lutra; n = 1), European badger (Meles meles; n = 3), and red fox (Vulpes vulpes; n = 4) (S1 Table). Samples were archived frozen (-80°C) until testing (Research Institute of Wildlife Ecology, University of Veterinary Medicine, Vienna, Austria), but no additional pathological examination was performed. Sample types included lung, brain, kidney, liver and heart (S1 Table). After thawing, fresh frozen tissue was swabbed using a fine-tipped sterile swab prior to RNA extraction (MW&E, NC, USA) for all Biomeme extractions conducted in New York and Vienna, and Qiagen RNA extractions conducted in New York. For samples tested using Qiagen methods in Vienna, tissues were sampled whole and made into an organ suspension prior to RNA extraction as described above.
Histology and immunohistochemistry
Routine processing, sectioning (5 μm), and hematoxylin and eosin staining of formalin fixed tissues from four raccoons (see above) was performed and stained tissues were histologically reviewed by a certified veterinary pathologist. Immunohistochemical (IHC) labeling for canine distemper virus antigen was performed using a primary monoclonal IgG1 anti-CDV surface envelope antibody and positive and negative controls as previously described [23].
Results
Canine distemper virus detection was compared between Biomeme’s portable POC platform (Fig 1, top) and standard laboratory methods using previously published CDV-specific primers and probe [21,22]. Comparison and validation were performed in an iterative manner, testing each step of the Biomeme POC platform independently against standard methods, and then combining each POC step sequentially (Fig 1, bottom). This included: 1. comparison between the Biomeme M1 Sample Prep Kit™ and the Qiagen QIAamp® Viral RNA minikit for RNA extraction and CDV detection in a dilution series of DA2PP vaccine, 2. comparison of the Biomeme LyoRNA™ RT-PCR mastermix and the Qiagen QuantiFast Pathogen RT-PCR mastermix for CDV detection using a syntheticCDV plasmid positive control, 3. comparison of the Biomeme two3™ and Bio-Rad Mini-Opticon qPCR thermocycler for CDV detection with synthetic plasmid positive control, 4. comparison of RNA extraction between the Biomeme M1 Sample Prep Kit™ and the Qiagen QiAMP Viral RNA minikit for CDV detection with CDV-suspect, wild animal samples preserved in RNAlater™, 5. comparison of the Biomeme M1 Sample Prep Kit™ in combination with the Biomeme LyoRNA™ RT-PCR mastermix to the Qiagen kits (RNA extraction and mastermix) for CDV detection from fresh tissues and nasal swabs from CDV-suspect, wild raccoons, and finally, 6. comparison of test performance and results for CDV detection in samples from CDV-suspect, wild animals using the complete Biomeme platform (M1 Sample Prep Kit™, CDV Go-Strips™, and Biomeme two3™ thermocycler) or standard laboratory equipment and methods at an independent virology laboratory in Austria.
Comparison of viral RNA recovery using the Biomeme M1 Sample Prep Kit™ or QIAamp® Viral RNA extraction kit
To compare viral RNA recovery between the Biomeme POC M1 Sample Prep Kit™ and the QIAamp® Viral RNA extraction kit, a dilution series of a reconstituted, commercially available modified live DA2PP vaccine was created and extractions were performed using both kits. RT-qPCR was performed using the QuantiFast Pathogen RT-PCR + IC Kit reagents (Qiagen) and our standard Bio-Rad MiniOpticon™ real-time thermocycler (standard lab methods) in singlicate, and extraction kit performance was based on the number of detected viral RNA copies averaged over three independent experiments and plotted with standard deviations (Fig 2). Copy number recovery was determined from a standard curve of a dilution series of plasmid positive control. No statistical difference in viral copy number recovery was detected between the two extraction methods at any of the dilutions using two-tailed student T-tests (Fig 2).
Fig 2
Comparison of CDV RNA copy number using Biomeme or Qiagen RNA extraction kits.
Canine distemper virus copy number recovery from a ten-fold dilution series (undiluted, 1:10, 1:100, 1:1000, 1:10000) of a reconstituted modified-live, attenuated, DA2PP vaccine. Copy numbers recovered by the Biomeme RNA field extraction kit (orange bars) were compared to the Qiagen extraction kit (blue bars). Shown are standard deviations of the average from three independent experiments. There were no statistical differences (two-tailed student t-test) between the kits at any dilution (p > 0.17).
Comparison of CDV RNA copy number using Biomeme or Qiagen RNA extraction kits.
Canine distemper virus copy number recovery from a ten-fold dilution series (undiluted, 1:10, 1:100, 1:1000, 1:10000) of a reconstituted modified-live, attenuated, DA2PP vaccine. Copy numbers recovered by the Biomeme RNA field extraction kit (orange bars) were compared to the Qiagen extraction kit (blue bars). Shown are standard deviations of the average from three independent experiments. There were no statistical differences (two-tailed student t-test) between the kits at any dilution (p > 0.17).
Comparison of CDV detection using Biomeme LyoRNA™ RT-PCR or QuantiFast Pathogen RT-PCR mastermix
Sensitivity of CDV detection using either the Biomeme LyoRNA™ RT-PCR mastermix or the QuantiFast Pathogen mastermix in combination with the Bio-Rad MiniOpticon™ qPCR thermocycler was compared. CDV positive control plasmid was serially diluted 1:10 (50 copies to 500,000 copies) and tested in duplicate with each mastermix. Cycle threshold (Ct) values were averaged and plotted with standard deviations (Fig 3). Both mastermixes performed similarly in the dilution series and detected as few as 50 copies of CDV P gene target with no statistically significant differences between kits at any dilution using a two-tailed student t-test.
Fig 3
Comparison of Biomeme LyoRNA™ mastermix to QuantiFast Pathogen master mix for CDV detection.
Cycle threshold (Ct) values of a standard dilution series of canine distemper virus positive control plasmid. No statistically significant differences were detected (two-tailed student t-test) in any of the duplicate samples in a comparison of Biomeme LyoRNA™ RT-PCR to QuantiFast Pathogen RT-PCR mastermixes (p > 0.08). All RT-qPCR tests were run on a Bio-rad MiniOpticon qPCR thermocycler.
Comparison of Biomeme LyoRNA™ mastermix to QuantiFast Pathogen master mix for CDV detection.
Cycle threshold (Ct) values of a standard dilution series of canine distemper virus positive control plasmid. No statistically significant differences were detected (two-tailed student t-test) in any of the duplicate samples in a comparison of Biomeme LyoRNA™ RT-PCR to QuantiFast Pathogen RT-PCR mastermixes (p > 0.08). All RT-qPCR tests were run on a Bio-rad MiniOpticon qPCR thermocycler.
Comparison of CDV detection using the Biomeme two3™ or Bio-Rad MiniOpticon™ thermocycler
Sensitivity and efficiency of CDV detection were compared between the Biomeme two3™ and the Bio-Rad MiniOpticon™ qPCR thermocyclers. Samples were tested in singlicate using a CDV plasmid positive control and Biomeme LyoRNA™ RT-PCR mastermix, primers and probe. Cycle threshold (Ct) values from three independent experiments were averaged and plotted with standard deviations. When compared to the Bio-Rad MiniOpticon, the sensitivity of the Biomeme two3™ was similar with detection of as few as 50 copies of the CDV target per PCR reaction. Ct value differences, ranging between 0.9 and 2.6 cycles, were slightly lower on the Biomeme two3™ thermocycler as compared to the Bio-Rad MiniOpticon™ thermocycler (Fig 4). On the Biomeme two3™ thermocycler, the slope of the log-linear phase of the amplification reaction was -3.16, the amplification efficiency was 107.1%, and the R2 value (correlation coefficient) was 0.998 (Fig 4B). For the Bio-Rad MiniOpticon™ the slope was -3.2, the amplification efficiency was 105.4%, and R2 was 0.9472 (Fig 4C).
Fig 4
Comparison of the Biomeme Two3™ and Bio-Rad MiniOpticon assay sensitivity.
A. Triplicate experiments showing cycle threshold (Ct) values and standard deviations in a ten-fold, serial dilution series of a CDV control plasmid with known copy number using Biomeme LyoRNA™ RT-PCR mastermix on the Biomeme two3™ (orange bars) or Bio-rad MiniOpticon™ (blue bars) thermocyclers. P-values are shown in samples evaluated by a two-tailed student t-test. B and C. Standard curves of a standard dilution series of a CDV control plasmid with known copy number from triplicate experiments on the Biomeme two3™ (B) or the BioRad MiniOpticon (C). (* indicates that only 1 of 3 samples tested was positive).
Comparison of the Biomeme Two3™ and Bio-Rad MiniOpticon assay sensitivity.
A. Triplicate experiments showing cycle threshold (Ct) values and standard deviations in a ten-fold, serial dilution series of a CDV control plasmid with known copy number using Biomeme LyoRNA™ RT-PCR mastermix on the Biomeme two3™ (orange bars) or Bio-rad MiniOpticon™ (blue bars) thermocyclers. P-values are shown in samples evaluated by a two-tailed student t-test. B and C. Standard curves of a standard dilution series of a CDV control plasmid with known copy number from triplicate experiments on the Biomeme two3™ (B) or the BioRad MiniOpticon (C). (* indicates that only 1 of 3 samples tested was positive).
Comparison of RNA extraction from RNAlater™ preserved tissues from CDV-positive wildlife: Biomeme M1 Sample Prep Kit™ or Qiagen Viral RNA extraction kit
Viral RNA extraction from swabs of RNAlater™ preserved, known CDV-positive tissue samples from Austrian wildlife that died during a wild mesocarnivore CDV outbreak was compared using the Biomeme M1 Sample Prep Kit™ or QIAamp® Viral RNA extraction kit. RNA was extracted from swabs from heart, liver, kidney, spleen, lung, lymph node, brain, muscle and small intestine from a pine martin, red fox and European badger. RT-qPCR was performed in singlicate and all tests were performed using Biomeme LyoRNA™ RT-PCR reagent, CDV primers and probe, on the Bio-Rad MiniOpticon. Ct values were averaged across triplicate samples and plotted with standard deviations (Fig 5A). Positive CDV detection was seen in all tissues with both extraction methods. Overall, differences in Ct values between the extraction kits were seen within and between tissue types, and Ct values were consistently higher with the Biomeme extraction method in all tissue types. Ct value differences ranged between 1.9 (liver) to 8.6 cycles (brain) between the Biomeme extraction method and Qiagen (Fig 5B). The total average Ct value difference across tissues types was 5.5 cycles when using the Biomeme M1 Sample Prep Kit™ versus the QIAamp® Viral RNA extraction kit. Copy number recovery was calculated and normalized to total RNA extract volume to compensate for different elution volumes between kits. In heart, spleen, lung and brain, RNA viral copy number recovery was lower (0.5–2 logs) with the Biomeme M1 Sample Prep Kit™, but did not reach statistical significance, and was comparable in other tissues that had similar viral recovery such as liver and muscle when normalized to total viral RNA recovered in the RNA extract (Fig 5C).
Fig 5
Comparison of viral recovery in various tissue types stored in RNAlater™ from a CDV outbreak in Vienna, Austria.
Data represents the average of testing a set of tissues from 3 separate animals (n = 3): a CDV positive pine martin, red fox and European badger. Standard deviations are shown, except in small intestine (* indicates tissue where only two cases were available for analysis). A. Comparison of Ct values between the Biomeme M1 Sample Prep Kit™ and QIAamp® Viral RNA extraction kit from tissue swabs. P-values are shown in samples evaluated by a two-tailed student t-test. B. Average Ct differences between Biomeme and Qiagen RNA extraction methods for each tissue swab type (in A). C. Average calculated copy number recovery in total RNA extracts. P-values are shown in samples evaluated by a two-tailed student t-test (p > 0.07).
Comparison of viral recovery in various tissue types stored in RNAlater™ from a CDV outbreak in Vienna, Austria.
Data represents the average of testing a set of tissues from 3 separate animals (n = 3): a CDV positive pine martin, red fox and European badger. Standard deviations are shown, except in small intestine (* indicates tissue where only two cases were available for analysis). A. Comparison of Ct values between the Biomeme M1 Sample Prep Kit™ and QIAamp® Viral RNA extraction kit from tissue swabs. P-values are shown in samples evaluated by a two-tailed student t-test. B. Average Ct differences between Biomeme and Qiagen RNA extraction methods for each tissue swab type (in A). C. Average calculated copy number recovery in total RNA extracts. P-values are shown in samples evaluated by a two-tailed student t-test (p > 0.07).
Comparison of extraction kits and reagents using fresh frozen tissues and nasal swabs from CDV-suspect animals: Biomeme’s M1 Sample Prep Kit™ + LyoRNA™ mastermix or the QIAamp® Viral RNA extraction kit + QuantiFast Pathogen mastermix
Use of the Biomeme M1 Sample Prep Kit™ in combination with the Biomeme LyoRNA™ mastermix was compared to Qiagen RNA extraction and QuantiFast Pathogen mastermix in fresh frozen tissue, swab, and hair samples from CDV-suspect animals collected during a CDV outbreak in raccoons (Central Park, New York City, NY; 2018). Duplicate nasal, foot pad, brain and lung swabs as well as fresh frozen brain, lung, non-haired footpad, and hair with root tissue were tested. All RT-qPCR was run on the Bio-Rad MiniOpticon™. Ct values for individual samples were averaged across the quadruplicate tests (n = 4 animals) and plotted with standard deviations (Fig 6A). All samples were positive using both platforms, and Ct values were consistently higher in all tissue types processed with the Biomeme extraction method and reagents. The Ct difference within tissue types ranged from 2.6 (hair) to 7.6 Ct difference (cerebrum). The average Ct value difference was 5.1 across samples types (Fig 6A). When normalized to account for different elution volumes, recovered viral copy number using the Biomeme platform was similar to the Qiagen platform in hair, brain (cerebrum) swab and frozen brain (cerebellum), and was 0.5–2 logs lower in nasal swab, foot pad, brain (cerebellum) swab, lung swabs, and frozen lung, foot pad, brain (cerebrum) and lung (Fig 6B), however these differences did not reach statistical significance.
Fig 6
Comparison of CDV detection in various sample types from a CDV outbreak in New York, NY: Biomeme M1 Sample Prep Kit™ combined with their LyoRNA™ mastermix versus Qiagen RNA extraction and QuantiFast Pathogen mastermix.
A. Comparison of the average Ct values in fresh frozen tissues, swabs and hair from four CDV-suspect raccoons. B. Average copy number recovery in total RNA extracts from the four cases. In both graphs, the data represent the average of quadruplicate testing, and standard deviations are shown. (* indicates the samples available from three rather than four raccoons (nasal swab)). P-values are shown in samples evaluated by a two-tailed student t-test.
Comparison of CDV detection in various sample types from a CDV outbreak in New York, NY: Biomeme M1 Sample Prep Kit™ combined with their LyoRNA™ mastermix versus Qiagen RNA extraction and QuantiFast Pathogen mastermix.
A. Comparison of the average Ct values in fresh frozen tissues, swabs and hair from four CDV-suspect raccoons. B. Average copy number recovery in total RNA extracts from the four cases. In both graphs, the data represent the average of quadruplicate testing, and standard deviations are shown. (* indicates the samples available from three rather than four raccoons (nasal swab)). P-values are shown in samples evaluated by a two-tailed student t-test.
CDV immunohistochemistry of skin and hair bulb from CDV-positive raccoon samples
CDV is an epitheliotropic virus, and though affected animals can develop skin lesions (hyperkeratosis, hard pad disease), hair has not been historically used as a standard diagnostic sample. Hair can be an accessible sample in cases where internal organ samples cannot safely be collected in a way to limit human exposure, and CDV detection from hair can provide timely results to differentiate from rabies virus as a cause of infection for animals showing signs of neurologic illness. Given the challenges in clinically differentiating the two diseases, testing of hair samples could a valuable alternative approach that can decrease risk of human exposure to rabies when testing for CDV. We used immunohistochemistry (IHC) to verify that CDV virus is found in the skin and hair follicular epithelium/root bulb of infected animals, and as an additional internal positive control for our PCR results.IHC labeling for CDV and bright-field microscopy was performed on all of the tissues that were examined histologically (by hematoxylin and eosin) from four raccoons that died or were euthanized during the 2018 CDV outbreak in New York. Positive labeling by IHC was seen in brain (4 of 4), spinal cord (1 of 1), lung (3 of 4), kidney (4 of 4), urinary bladder (2 of 4), haired skin (2 of 4) (Fig 7A and 7B), footpad (non-haired skin) (3 of 4) (Fig 7C and 7D), spleen (2 of 3), stomach (1 of 2), small intestine (1 of 2), large intestine (2 of 2), and pancreas (1 of 1); no labeling was seen in heart (n = 4) or liver (n = 4).
Fig 7
CDV immunohistochemistry staining of haired skin and footpad from a CDV-positive raccoon.
Immunohistochemical labeling with a monoclonal IgG primary antibody to CDV viral envelope protein antigen (fast-red staining) in haired skin (A and B) and non-haired footpad (C and D) from a CDV positive raccoon. Cytoplasmic immunohistochemical labeling is present in epidermal (e) and follicular epithelial cells (f) in haired skin (A. 200X; B. 400X) and epidermal epithelial cells (e) in non-haired footpad (C, 100X; D, 200X).
CDV immunohistochemistry staining of haired skin and footpad from a CDV-positive raccoon.
Immunohistochemical labeling with a monoclonal IgG primary antibody to CDV viral envelope protein antigen (fast-red staining) in haired skin (A and B) and non-haired footpad (C and D) from a CDV positive raccoon. Cytoplasmic immunohistochemical labeling is present in epidermal (e) and follicular epithelial cells (f) in haired skin (A. 200X; B. 400X) and epidermal epithelial cells (e) in non-haired footpad (C, 100X; D, 200X).
Comparison of extraction kits for screening hair root bulb samples from CDV infected animals: Biomeme’s M1 Sample Prep Kit™ + LyoRNA™ mastermix or the QIAamp® Viral RNA extraction kit + QuantiFast Pathogen mastermix
To further test the Biomeme POC platform for a non-invasive sample type, CDV screening of duplicate hair bulb (with root) samples from a total of 52 dead or euthanized raccoons from the 2018 Central Park outbreak were collected from the dorsal surface of a forefoot. Tests were performed as above to compare the Biomeme platform (Biomeme M1 Sample Prep Kit™ and LyoRNA™ mastermix) to our standard laboratory protocol (QIAamp® Viral RNA extraction kit in combination with the QuantiFast Pathogen RT-PCR +IC Kit, Qiagen). All RT-qPCR was run on the Bio-Rad MiniOpticon™ in singlicate with positive and negative controls. All hair samples were positive for CDV regardless of platform used, and negative controls were negative on both platforms (Fig 8A). The range of Ct value differences in individual animals between the Biomeme platform and Qiagen was 0.2–8.6 cycles. The average Ct value difference across all 52 samples was 3.61 cycles, with a standard deviation of 2.01 cycles, which was statistically significant (P < 0.001) (Fig 8B). However, when we adjusted for total CDV copy number recovery in the RNA extract, we observed no statistically significant difference in CDV detection (P = 0.76) (Fig 8C).
Fig 8
Comparison of RT-qPCR CDV detection (Ct values) using Biomeme POC and standard laboratory methodology in raccoon hair samples from a CDV outbreak in New York, NY.
A. Comparison of Ct values between the two platforms in hair samples from 52 raccoons that died during a 2018 CDV outbreak. Ct values are shown for each individual animal and values are plotted in order of increasing Ct value difference. B. Average cycle threshold difference between Qiagen and Biomeme test with standard deviations are shown (p< 0.001, two-tailed student t-test). C. Average calculated copy number recovery in total RNA extracts between Qiagen and Biomeme test. There was no statistical difference (two-tailed student t-test) between the kits in CDV copy number detection of hair samples (p = 0.76).
Comparison of RT-qPCR CDV detection (Ct values) using Biomeme POC and standard laboratory methodology in raccoon hair samples from a CDV outbreak in New York, NY.
A. Comparison of Ct values between the two platforms in hair samples from 52 raccoons that died during a 2018 CDV outbreak. Ct values are shown for each individual animal and values are plotted in order of increasing Ct value difference. B. Average cycle threshold difference between Qiagen and Biomeme test with standard deviations are shown (p< 0.001, two-tailed student t-test). C. Average calculated copy number recovery in total RNA extracts between Qiagen and Biomeme test. There was no statistical difference (two-tailed student t-test) between the kits in CDV copy number detection of hair samples (p = 0.76).
Independent laboratory validation: Comparison of the Biomeme POC platform using lyophilized reagents, primers, and probe to standard virology laboratory methods in fresh frozen tissue from CDV-suspect animals
Fresh tissue samples from CDV-suspect wild mesocarnivores were collected and archived at -80C during a CDV outbreak in Austria 2011–2013, and in the spring of 2018. Duplicate samples were tested using both the Biomeme platform (Biomeme M1 Sample Prep Kit™, lyophilized CDV ‘Go-strips’™, and Biomeme two3™ thermocycler) and standard laboratory-based methods and protocols (Institute of Virology, University of Veterinary Medicine, Vienna, Austria). Testing was performed on brain, lung, kidney, liver, and heart from 10 animals: pine martin (n = 1), beech martin (n = 1), European badger (n = 3), Eurasian otter (n = 1), and red fox (n = 4) (S1 Table). We found 100% concordance in detection between the Biomeme platform and the virology lab in CDV detection in kidney (6 of 9 positive), liver (2 of 3 positive), heart (1 of 1 positive), and lung (5 of 7 positive) samples (Table 1). We found that in brain samples, 6 of 6 were positive with the Biomeme platform while 5 of 6 were positive with the virology laboratory testing methods. Upon reviewing the Biomeme data from the positive Lutra lutra brain sample 2054, we observed an attenuated amplification curve in the positive result, amplifying and plateauing within 5 cycles. This sample was retested and confirmed to be negative by the Virology lab, and also negative using the Biomeme platform. Therefore we conclude that the initial test result was a false positive. Overall, 96.1% (25 of 26 samples) concordance was observed between platforms initially, and 100% concordance was observed after retest from suspect CDV cases.
Table 1
Results of CDV RT-qPCR testing using the Biomeme POC platform or Virology Laboratory methods in fresh frozen tissue samples from CDV suspect, Austrian mesocarnivores.
Biomeme POC Platform
Virology Lab Methods
Tissue type
Number of Samples
Positive
Negative
Positive
Negative
Lung
7
5
2
5
2
Brain
6
6 (*5)
0 (*1)
5 (*5)
1 (*1)
Kidney
9
6
3
6
3
Liver
3
2
1
2
1
Heart
1
1
0
1
0
Total
26
20 (*19)
6 (*7)
19 (*19)
7 (*7)
* Denotes final data after brain samples from 2054 was retested using both platforms.
* Denotes final data after brain samples from 2054 was retested using both platforms.
Discussion
This study was designed to test the performance of an innovative point-of-care qRT-PCR platform to rapidly and accurately diagnose canine distemper virus (CDV) in field or laboratory settings. The Biomeme platform consists of rapid cellular lysis (10 minutes) and RNA extraction (3–5 minutes) steps, pre-packaged ‘Go-strips’™, and the hand-held, Biomeme two3™ thermocycler equipped with a smartphone for fluorescent detection and data collection (78 min, 45 cycles) (Biomeme Inc. Philadelphia, PA, USA). This portable qPCR platform can be run off-grid with a battery or solar power source. Color-coding of reagents in the extraction process easily overcomes training and language barriers. Shelf-stable, lyophilized reagents can be combined with target-specific primers and probes that are incorporated into a bead in pre-packaged PCR reaction tubes, so called ‘Go-Strips’™. Reconstitution of the beads with DNA or RNA template prepares the sample for PCR. Results can be downloaded to the phone, laptop computer or uploaded for cloud-based storage and retrieval.Our comparisons of this platform to those of two different standard laboratory-based methodologies show that overall, CDV detection using the Biomeme platform was similar to standard laboratory methodologies for plasmid positive control and vaccine control testing. In addition, sensitivity (to 50 copies per PCR reaction) and efficiency (90–110%) were consistent between platforms with positive control synthetic plasmid, and the latter was well within acceptable limits for traditional laboratory methods [21,24]. When compared across different tissue types from different species, and under different storage conditions (RNAlater™, frozen), the Biomeme platform consistently detected CDV positive samples; however, the Ct values were generally higher than with traditional Qiagen RNA extracted samples. Several of the experiments with higher Ct values were conducted while examining only one variable, which allowed us to identify the Biomeme RNA extraction step as the likely cause for this difference in our tests. Further work is needed to determine if the reduction in viral detection is due to either reduced binding of all available RNA to the column or less efficient release of RNA off the column, and if any optimization can be done to improve recovery. We found that RNA extraction from swabs of tissue and whole tissue samples had a lower RNA recovery (0.5–2 logs lower) with the Biomeme methodology than with Qiagen extraction when normalized for total CDV viral RNA in the extract, though these results did not reach statistical significance. So, while overall CDV detection with both platforms was consistent, (26 of 26 after retest), the lower observed recovery of viral RNA with the Biomeme extraction methods, especially in samples with low viral load, has the potential to result in false negative results. Further testing with a variety of different viral titers will be beneficial in ascertaining how this kit performs in a variety of clinical CDV samples that contain low versus high viral loads. Nevertheless, given the portability of the platform, ease of use in the field, and consistent detection of CDV from known and suspect positive samples across tissue and sample types in our study, this platform is a useful point-of care testing tool for detecting CDV.RNAlater™ is commonly used in the field as a method of preserving nucleic acids in tissue or swab samples from wildlife. We therefore tested the performance of the Biomeme platform with RNAlater™ preserved tissues from known CDV positive cases. No observable differences in CDV viral recovery were seen in a comparison using swabs of fresh frozen or RNAlater™ preserved tissues across platforms. Provided the samples are stored optimally according to the manufacturer’s specifications for RNA preservation, RNAlater™ is a suitable preservation method for samples and compatible using the Biomeme POC platform. However, given our small sample size, future comparisons between samples collected from animals with known high or low viral loads, or short and long term, ambient vs frozen RNAlater™ archiving to test RNA preservation and degradation would be especially valuable to establish minimum detection thresholds for CDV using the Biomeme platform.In addition to positive results in classic tissues targeted for CDV testing such as frozen brain and lung, our data show that hair bulb was a reliable, non-invasive sample for CDV detection in virus positive animals. IHC staining of CDV in the epidermal and follicular epithelial cells was consistent with the PCR results. Hair sample collection is easy, can be performed appropriately with minimal training, and can be opportunistically performed in live or dead animals making it a useful sample to collect from wildlife in the field or in a clinical setting. Non-invasive sampling reduces risk associated with handling sick or dead carnivores, especially those that could also be infected with rabies. Rabies is a zoonotic disease that can present with similar clinical neurological symptoms to CDV, and co-infection with both can occur [25]. There are currently no POC tests for rabies. However, a CDV negative POC test result from a non-invasively collected sample would serve to raise a higher suspicion of rabies or other neurologic disease processes for field personnel. In our testing, we found 100% concurrence in our results comparing the Biomeme and standard laboratory platforms. However, as mentioned above, higher Ct values were seen with the Biomeme platform (3.61 cycles, with a standard deviation of 2.01 cycles, n = 52 samples). When compared to other tissues types, the Ct differences across the hair samples were comparable, suggesting hair as a good, non-invasive sample for CDV POC testing. All raccoons tested in our study were found dead or euthanized after exhibiting clinical symptoms, so additional testing of hair samples comparing early, mid and late stage CDVinfection will be especially valuable for determining if hair bulb is more or less valuable at certain stages of the disease.Over the past several years, a variety of methods have become available for CDV detection, with a range of applications and sensitivities. New developments for rapid, quantitative, reverse transcription, recombinase polymerase amplification (RT-RPA) and isothermal polymerase gene amplification (RT-iiPCR) techniques for CDV detection have been recently described [26,27]. Field-capable equipment using these techniques is heavy (1.75 kg for a Genie III used in RT-RPA detection, and 2.1 kg for a POCKIT™ iiPCR analyzer) and requires standard Qiagen commercial kits for RNA extraction. The latter require additional equipment and more reagents and time than the Biomeme M1 Sample Prep Kit™, which can be used off-grid with solar power and without equipment such as centrifuges and heat blocks [14,15]. The entire Biomeme POC platform is lightweight and very portable, and all of the equipment and supplies are able to fit in a standard sized backpack. The two3™ thermocycler plus case is 28 cm x 25.4 cm x 12.7 cm, and at 0.5 kg, making it is considerably lighter than the Genie III or POCKIT™ iiPCR analyzer. In our experience, the Biomeme equipment is also easier to use than other platforms, and, like their extraction kit, the Biomeme thermocycler can be used in remote field settings that lack electricity. When lyophilized, the reagents (lyophilized Go-strips™) are also shelf stable and do not require cold storage. Biomeme also offers an option to include inhibition control lyophilized Go-strips™ in cases where PCR inhibition may be problematic. In our field-tests using the Biomeme two3™ qPCR thermocycler, when fully charged, we have successfully performed up to five consecutive thermocycle runs on a single charge, and the unit is compatible with and able to be charged by a solar-charged battery such as the Goal 0™ (Goal Zero, Bluffdale, UT) (Seimon and Brown, unpublished results).One notable limitation of the Biomeme two3™ thermocycler is that the unit has only three sample wells. So, if both a positive and negative control are run, the user is limited to one unknown sample for each PCR run. This is less problematic when dealing with individual animal POC testing or in projects with fewer samples or low throughput. Additionally, Biomeme has recently released a three9™ device, a slightly larger platform with a total of 9 reaction wells with three color channels, which can test up to 27 targets.CDV affects a wide variety of carnivore species, including mustelids, procyonids, ursids, canids (domestic and wild), felids and marine mammals [2,28-30]. It is considered among the most widespread multi-host pathogens [31]. CDV is a recognized conservation threat to a number of endangered carnivores. Our understanding of CDV ecology, disease transmission and infection outcomes is far from complete and advancing our knowledge is critical for mitigating its effects in wildlife. For example, CDV has become a major conservation threat to endangered populations of Amur tigers (Panthera tigris altaica) and Far Eastern leopards (Panthera pardus orientalis) in the Russia Far East [5,7,8]. This is in addition to the threats faced from poaching, habitat loss and tigerhuman conflict [32,33]. Serological, genetic and demographic studies in domestic dogs and mesocarnivores are needed to determine the role that wildlife and domestic dogs play for both maintaining CDV in the environment and as a source of infection for tigers [6,7]. Having a mechanism for rapid, effective, and field-friendly CDV diagnosis will improve conservation efforts to track disease spread and identify reservoir species, which will in turn lead to better methods for monitoring vulnerable populations and development of solutions to support the conservation of endangered carnivores in the wild. Additionally, adaptation of this platform to test for other pathogens will expand the utility of POC for health monitoring and disease surveillance in conservation, especially in remote, under-resourced regions, and can be a valuable tool in rescue and rehabilitation centers, shelters, and boarding facilities for wildlife and domestic animals as well.
Individual sample results and metadata from CDV suspect, Austrian mesocarnivores.
qPCR results from 26 samples of CDV suspect animals comparing standard laboratory practices at the Virology Laboratory (University of Veterinary Medicine, Vienna, Austria) to the Biomeme POC platform.(DOCX)Click here for additional data file.24 Feb 2020PONE-D-20-01230Development and validation of a portable, point-of-care canine distemper virus qPCR testPLOS ONEDear Dr SeimonThank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Many thanks for submitting your manuscript to PLOS OneThe manuscript was reviewed by two reviewers. Due to a difficulty in finding reviewers, I have provided one of the reviews myself as it is akin to some work which I have doneThe comments are generally only minor, but if you could write a response to reviewers then it will expedite things when you resubmit.I wish you the best of luck with your revisionsMany thanksSimonWe would appreciate receiving your revised manuscript by Apr 09 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Simon Russell Clegg, PhDAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements:1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. In your Methods section, please provide additional location information, including geographic coordinates for the data set (locations of animal capture), if available.3. Please provide the method(s) of euthanasia in the Methods section of your manuscript, where applicable and known.4. Please include a caption for Figures 1 and 8.5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: Overall, this is a well-written manuscript with sound methodology and the authors have clearly conveyed the importance of the development of a field-deployable point-of-care diagnostic assay for canine distemper virus. The results show that the establishment of this CDV Biomeme assay has the potential to be a useful diagnostic tool for both wildlife biologists and in conservation efforts. The confirmation of hair as a reliable sample source for CDV diagnostics is particularly advantageous as risk is minimized to field personnel without compromising the ability to generate rapid, actionable data.I am concerned by the disagreement between the laboratory standard assay and the Biomeme assay. The authors report that one sample derived from brain tissue was reported as positive by the Biomeme assay, but negative with the standard assay. This is inconsistent with the frequent discussion point throughout the manuscript that the Biomeme assay is less sensitive than the laboratory standard assay. The manuscript would be improved by the inclusion of a follow-up to confirm the results for the sample in question with both assays.I believe that the study and described assay is a valuable addition to the field in its current state. As the authors note, clinical manifestations of rabies virus in wildlife may be confused for any number of other pathogens including CDV; however, rabies virus poses a high risk to field personnel. The assay could be improved in the future with the development of a multiplexed assay targeting CDV, Rabies virus, and an internal control with low variability between related species (e.g. HPRT or GAPDH) to ensure that the nucleic extraction was successful.Reviewer #2: This is a very interesting, and well written manuscript comparing diagnostic techniques for the detection of canine distemper virus. The authors have done an excellent job (and should be highly commended), so I have very few, and only generally minor comments.Line 35- using a positive control plasmidLine 79- I think here it is worthwhile making a bit more of the importance of the diagnostics. As the disease clinical signs can sometimes resemble rabiles then this is an important thing to state here. Not least because diagnostics for CDV in the field will mainly be cadaver based as there is no real treatment option for CDVLine 88- maybe have highlighted may sound better?Line 99- four should be in wordsRNA extraction using the Biome RNA field prep kit- are the reagents for the different buffers- e.g. BLB available online? If so could you put a link in to these? Or are they unknown for commercial reasons?Line 136- a comma after expelling may help with reading flowYou have several different extraction procedures- would this not affect levels of DNA extracted and thus results?In several places you say that the samples were tested in singlicate and then in the results you mention some in duplicate and some in triplicate. This was a bit unclear and confusing so maybe you could look at explaining this a little differently? It is also more common to do samples in duplicate or triplicateYou mention the animals which died during CDV outbreaks. Was any pathology done on these animals to confirm the disease as they could have died of anything?Line 317- 3 should be in wordsLine 326- 27- three should be in words and the n = 3 seems a bit repetitive? For the CDV detection comparison with Biome- were the results in Lines 356-360 significant?Again, the use of triplicates when the methodology says singular is a little confusingLine 429- four should be in wordsLine 430- comma after graphsLine 432- 3 and 4 should be in wordsLine 438- the second ‘been’ can be removedLine 448- 4 should be in wordsLine 534- in my experience there is a lot of DNA and RNA lost using the Qiagen kits due to the use of the filters which tend to be relatively poor at releasing DNA after washing stepsLine 536- you say that this is likely due to the RNA extraction- which part of it, and could you optimise it in any way?Line 543- I would always avoid saying test with larger sample sizes- because it raises the simple question ‘why didn’t you do that then?’ (although I am not that cruel). Maybe state that using a variety of different viral titres would be beneficial?Line 564- and animals in a clinical settingLine 573- comma after tissue typesLine 573-575- consider rewording this as two mentions of other tissue types makes it harder to followLine 579- comma after several years,Line 588 and 589- these two sentences may benefit from being linkedLine 597- 5 in wordsLine 600 and 603- 3 in wordsAcknowledgements- can you please just confirm that Biomeme were not involved in the study and didn’t supply reagents etc?**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.Submitted filename: POC_BioMeme_CVD.docxClick here for additional data file.24 Mar 2020The response to reviewer comments is also included in the new cover letter that has been uploaded, and the comments and responses by our authors are indicated in bold to make it easier to read. All lines referenced int he manuscript refer to the Revised manuscript with track changes file.PONE-D-20-01230Development and validation of a portable, point-of-care canine distemper virus qPCR testPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements:1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. In your Methods section, please provide additional location information, including geographic coordinates for the data set (locations of animal capture), if available.Location data was not collected on animals that died naturally or were euthanized during the CDV outbreaks in Austria and Central Park, NY. The samples were opportunistically collected after the animals had been found deceased and no location information, other than that provided in the methods, were obtained because these animals were not collected for the purpose of a study.3. Please provide the method(s) of euthanasia in the Methods section of your manuscript, where applicable and known.We have included the following information in second sentence of the ethics statement in lines 143-144 of the method section in the revised manuscript with track changes: “Following AVMA Euthanasia Guidelines Raccoons were sedated with intramuscular ketamine prior to the IV or IP injection of sodium pentobarbital.”4. Please include a caption for Figures 1 and 8.The caption for Figure 1 has now been added at line 356. We also noticed that the caption and referenced for Figures 7 and 8 were mislabeled in some places, which has now been corrected in line 519 For Figure 7, and for Figure 8 (lines 549-554).5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.We have inserted our caption for our Supporting Information Table S1 at the very end of the manuscript in the manuscript file, and removed the caption from the Supporting Information Table S1 file.Review Comments to the AuthorReviewer #1:1. I am concerned by the disagreement between the laboratory standard assay and the Biomeme assay. The authors report that one sample derived from brain tissue was reported as positive by the Biomeme assay, but negative with the standard assay. This is inconsistent with the frequent discussion point throughout the manuscript that the Biomeme assay is less sensitive than the laboratory standard assay. The manuscript would be improved by the inclusion of a follow-up to confirm the results for the sample in question with both assays.We thank the reviewer for calling attention to this disagreement. The sample in question, brain sample from Lutra lutra 2054, was retested again at the facilities in Vienna, and was confirmed to be negative for CDV. The Vienna lab also tested the sample for PCR inhibition and two other CDV targets using two primer sets for the H gene, and it was negative for CDV with no PCR inhibition observed. Therefore we are confident that this sample is, in fact, negative. In re-reviewing the Biomeme data it appears that the initial positive result had a strange amplification curve, amplifying and plateauing within 5 cycles instead of ~15 cycles as seen with the other positive samples. The sample also had a very low Ct of 19.69, which if true would fall well within the sensitivity of the standard Virology lab assay, but the lab instead found it negative. This sample was also negative in a second qPCR test using the Biomeme platform, so we now know the initial result was a false positive. We have therefore kept the data “as is” in the manuscript, however we flagged the result as a false positive and address this disagreement in light of the new results in line 40 of the abstract, lines 585-591 in results, in Table 1 and in S1 Table in the revised manuscript with track changes. We feel it important to keep the initial result as it may be informative to researchers who encounter or identify similar findings of false positive readings when using this platform.We added the following to lines 39-41: “CDV detection using the Biomeme platform was similar in 25 of 26 samples from suspect CDV cases when compared to standard virology laboratory testing. One false positive was observed that was negative upon retest.”We added the following to lines 585-591: “Upon reviewing the Biomeme data from the positive Lutra lutra brain sample 2054, we observed an attenuated amplification curve in the positive result, amplifying and plateauing within 5 cycles. This sample was retested and confirmed to be negative by the Virology lab, and negative using the Biomeme platform. Therefore we conclude that the initial test result was a false positive. Overall, 96.1% (25 of 26 samples) concordance was observed between platforms initially, and 100% concordance was observed after retest from suspect CDV cases.”Reviewer #2:1. Line 35- using a positive control plasmidWe inserted “a” before “positive control plasmid” in line 35 to correct this.2. Line 79- I think here it is worthwhile making a bit more of the importance of the diagnostics. As the disease clinical signs can sometimes resemble rabiles then this is an important thing to state here. Not least because diagnostics for CDV in the field will mainly be cadaver based as there is no real treatment option for CDV.We agree and added the following to Lines 82-98 and reworked the POC section and placed that paragraph earlier to flow better in the manuscript:POC diagnostics can help address many challenges in understanding CDV presence, transmission patterns, identification of disease outbreaks, and conservation threats in wildlife. Some of these challenges include access to animals and opportunistic testing across small and large geographic ranges, low density or elusive behavior of some target species, and absence of or limited monitoring efforts. Others challenges researchers face include limited expertise necessary for appropriate animal sample collection, handling, and storage (including maintaining a cold chain), absence of available laboratory testing and differentiating from disease such as rabies which can present with similar clinical manifestations, and/or logistical challenges related to permit processes needed for regional or international sample shipping for laboratory testing. These challenges are compounded in remote and/or low resource settings. POC diagnostics are increasingly providing opportunities for rapid testing by researchers while they are already collecting data in the field, or when handling sick or dead wildlife, and with the development and validation of more user-friendly kits, researchers have opportunities to overcome many of these obstacles and logistical challenges that would normally impede testing.3. Line 88- maybe have highlighted may sound better?We agree and have inserted “have highlighted” in line 80 before “a need for development…” to clarify.4. Line 99- four should be in wordsWe have replaced “4” with “four” in line 115.5. RNA extraction using the Biome RNA field prep kit- are the reagents for the different buffers- e.g. BLB available online? If so could you put a link in to these? Or are they unknown for commercial reasons?These buffers and their components available from Biomeme Inc. are proprietary and therefore information on the reagents is unavailable to us.6. Line 136- a comma after expelling may help with reading flowWe have inserted a comma after expelling in line 165.7. You have several different extraction procedures- would this not affect levels of DNA extracted and thus results?In this study, we calculated copy number of virus detected from duplicate samples for each of the methods of RNA extraction in order to compare their efficacy across the two platforms in question. Data was normalized to account for different elution volumes for the different RNA extraction kits. This allowed normalization and comparison of total CDV viral copy recovery within the total RNA extract across platforms. However, the extraction method used on site at the virology laboratory in Vienna, Austria, was the only protocol we could not normalize using this method because the Virology lab processed their samples differently (organ tissue suspension) from how the Biomeme samples were processed (organ swab, see methods), which is why we did not compare Ct values.8. In several places you say that the samples were tested in singlicate and then in the results you mention some in duplicate and some in triplicate. This was a bit unclear and confusing so maybe you could look at explaining this a little differently? It is also more common to do samples in duplicate or triplicateWe appreciate the reviewer pointing this out. All samples testing with the Biomeme two3 machine were tested in singlicate due to the limited number of 3 wells available in the machine and the need to include a positive and negative control. This is the limitation of the platform which we address in the discussion in line line 707. Where possible (when using the benchtop thermocycler), samples were run in duplicate or triplicate (Fig 3 and 4), and replicates were chosen based on what we could accommodate on our 48 well Bio-Rad plate including all controls and standards. All hair samples were run in singlicate due to the higher sample volume.To clarify this in the manuscript we added a sentence in line 194 of the methods section to read “All samples were tested in singlicate except in experiments where we could accommodate duplicate or triplicate replicates on the plate where indicated”.In line 443 we also found a typo and corrected the sentence to read: “RT-qPCR was performed in singlicate and all tests were performed using Biomeme LyoRNA™ RT-PCR reagent, CDV primers and probe, on the Bio-Rad MiniOpticon. Ct values were averaged across triplicate samples and plotted with standard deviations (Fig 5A).”9. You mention the animals which died during CDV outbreaks. Was any pathology done on these animals to confirm the disease as they could have died of anything?Full necropsy and histopathology exams were performed on a subset of raccoon cases (n=4) from the New York outbreak to confirm disease, but additional examination was not performed on any of the other cases we screened. We have added “and in all but four cases, described below, no additional pathological examination was performed” at Line 294 and “but no additional pathological examination was performed.” at Line 314.We also add the following to line 297: Complete necropsy examination and a full set of tissues in 10% neutral buffered formalin was collected from four raccoons that died or were euthanized during the outbreak, and histopathology examination confirmed CDV disease in these animals.10. Line 317- 3 should be in wordsWe have replaced “3” with “three” in line 371.11. Line 326- 27- three should be in wordsWe have replaced “3” with “three” in line 373.12. and the n = 3 seems a bit repetitive?We think the reviewer is referring to original lines 326-327 in Figure 2. For this experiment the samples were run in singlicate, but the experiment was repeated 3 times (n=3 experiments). To provide more clarity we have therefore removed “n=3” from line 383 to reduce redundancy and this sentence now reads as: “Shown are standard deviations of the average from three independent experiments.”For the CDV detection comparison with Biome- were the results in Lines 356-360 significant? Again, the use of triplicates when the methodology says singular is a little confusingOriginal lines 356-360 refer to Figure 4, and p-values presented in Figure 4A and in the Fig. 4 caption were statistically significant at the lower copy number concentrations, but not at 5000 copies. To add clarity, we have corrected the following sentence in lines 413-416 to read: “Samples were tested in singlicate using a CDV plasmid positive control and Biomeme LyoRNA™ RT-PCR mastermix, primers and probe. Cycle threshold (Ct) values from three independent experiments were averaged and plotted with standard deviations.”To reduce redundancy and keep consistency with Figure 2 we have changed the following sentence in lines 431-433 to read: Standard curves of a standard dilution series of a CDV control plasmid with known copy number from triplicate experiments on the Biomeme two3™ (B) or the BioRad MiniOpticon (C).13. Line 429- four should be in wordsWe have replaced “4” with “four” in line 497.14. Line 430- comma after graphsWe have inserted a comma after “graphs” in line 498.15. Line 432- 3 and 4 should be in wordsWe have replaced “3” with “three” and replaced “4” with “four” in line 500.16. Line 438- the second ‘been’ can be removedWe have removed “been” and that part of the sentence has been rewritten to “hair has not been historically used” in line 506.17. Line 448- 4 should be in wordsWe have replaced “4” with “four” in line 516.18. Line 534- in my experience there is a lot of DNA and RNA lost using the Qiagen kits due to the use of the filters which tend to be relatively poor at releasing DNA after washing steps and Line 536- you say that this is likely due to the RNA extraction- which part of it, and could you optimise it in any way?We added the following sentence at Line 624: “Further work is needed to determine if the reduction in viral detection is due to either reduced binding of all available RNA to the column or less efficient release of RNA off the column, and if any optimization can be done to improve recovery.”19. Line 543- I would always avoid saying test with larger sample sizes- because it raises the simple question ‘why didn’t you do that then?’ (although I am not that cruel). Maybe state that using a variety of different viral titres would be beneficial?We have changed the following sentence in line 632 to read: “Further testing with a variety of different viral titers will be beneficial in ascertaining how this kit performs in a variety of clinical CDV samples that contain low versus high viral loads.”20. Line 564- and animals in a clinical settingWe have added “and in a clinical setting” to the end of the sentence in line 673.21. Line 573- comma after tissue typesWe have inserted a comma after “tissue types in line 681”.22. Line 573-575- consider rewording this as two mentions of other tissue types makes it harder to followWe have changed the following sentence in line 681 to read: “When compared to other tissues types, the Ct differences across the hair samples were comparable, suggesting hair as a good, non-invasive sample for CDV POC testing.”23. Line 579- comma after several yearsWe have inserted a comma after “years” in line 687.24. Line 588 and 589- these two sentences may benefit from being linked 4We have linked the two sentences in line 697. The sentence now reads as: “The entire Biomeme POC platform is lightweight and very portable, and all of the equipment and supplies are able to fit in a standard sized backpack.”25. Line 597- 5 in wordsWe have replaced “5” with “five” in line 706.26. Line 600 and 603- 3 in wordsWe have replaced “3” with “three” in both instances (line 710 and 714).27. Acknowledgements- can you please just confirm that Biomeme were not involved in the study and didn’t supply reagents etc?We have added to acknowledgements section the following: “Biomeme Inc. was not involved in this study. All reagents and equipment using this platform were purchased from Biomeme Inc. for use in this study.”7 Apr 2020Development and validation of a portable, point-of-care canine distemper virus qPCR testPONE-D-20-01230R1Dear Dr. SeimonWe are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Simon Russell Clegg, PhDAcademic EditorPLOS ONEAdditional Editor Comments (optional):Many thanks for re-submitting your manuscript to PLOS OneI have reviewed your modifications, and as you have addressed all the points raised, I have recommended your manuscript for publicationYou should hear from the editorial office soonIt was a pleasure working with you and I wish you all the best for your future researchHope you are keeping safe during this difficult timeThanksSimon9 Apr 2020PONE-D-20-01230R1Development and validation of a portable, point-of-care canine distemper virus qPCR testDear Dr. Seimon:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Simon Russell CleggAcademic EditorPLOS ONE
Authors: Martin Gilbert; Svetlana V Soutyrina; Ivan V Seryodkin; Nadezhda Sulikhan; Olga V Uphyrkina; Mikhail Goncharuk; Louise Matthews; Sarah Cleaveland; Dale G Miquelle Journal: Integr Zool Date: 2015-07 Impact factor: 2.654
Authors: Kenneth N Cameron; Patricia Reed; David B Morgan; Alain I Ondzié; Crickette M Sanz; Hjalmar S Kühl; Sarah H Olson; Eric Leroy; William B Karesh; Roger Mundry Journal: PLoS One Date: 2016-05-18 Impact factor: 3.240
Authors: Pierre-Yves Daoust; Scott R McBurney; Dale L Godson; Marco W G van de Bildt; Albert D M E Osterhaus Journal: J Wildl Dis Date: 2009-07 Impact factor: 1.535
Authors: Marco W G van de Bildt; Thijs Kuiken; Aart M Visee; Sangito Lema; Tony R Fitzjohn; Albert D M E Osterhaus Journal: Emerg Infect Dis Date: 2002-02 Impact factor: 6.883
Authors: Rebecca P Wilkes; Yun-Long Tsai; Pei-Yu Lee; Fu-Chun Lee; Hsiao-Fen Grace Chang; Hwa-Tang Thomas Wang Journal: BMC Vet Res Date: 2014-09-09 Impact factor: 2.741